ID: 932304475

View in Genome Browser
Species Human (GRCh38)
Location 2:70692117-70692139
Sequence GTCCTGTTGGACCAAGGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 52}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932304475_932304484 29 Left 932304475 2:70692117-70692139 CCCACGCCTTGGTCCAACAGGAC 0: 1
1: 0
2: 0
3: 6
4: 52
Right 932304484 2:70692169-70692191 CTTGTGTATGCAGTATGTGGGGG 0: 1
1: 0
2: 0
3: 10
4: 147
932304475_932304481 26 Left 932304475 2:70692117-70692139 CCCACGCCTTGGTCCAACAGGAC 0: 1
1: 0
2: 0
3: 6
4: 52
Right 932304481 2:70692166-70692188 CTGCTTGTGTATGCAGTATGTGG 0: 1
1: 0
2: 0
3: 8
4: 127
932304475_932304483 28 Left 932304475 2:70692117-70692139 CCCACGCCTTGGTCCAACAGGAC 0: 1
1: 0
2: 0
3: 6
4: 52
Right 932304483 2:70692168-70692190 GCTTGTGTATGCAGTATGTGGGG 0: 1
1: 0
2: 0
3: 15
4: 154
932304475_932304482 27 Left 932304475 2:70692117-70692139 CCCACGCCTTGGTCCAACAGGAC 0: 1
1: 0
2: 0
3: 6
4: 52
Right 932304482 2:70692167-70692189 TGCTTGTGTATGCAGTATGTGGG 0: 1
1: 0
2: 0
3: 8
4: 137
932304475_932304479 1 Left 932304475 2:70692117-70692139 CCCACGCCTTGGTCCAACAGGAC 0: 1
1: 0
2: 0
3: 6
4: 52
Right 932304479 2:70692141-70692163 GACCTGAGTAGAAACTTAGCAGG 0: 1
1: 0
2: 0
3: 1
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932304475 Original CRISPR GTCCTGTTGGACCAAGGCGT GGG (reversed) Intronic
900295550 1:1947292-1947314 GACCTGTTGGCCCAGGGCGAGGG + Intronic
903065494 1:20697080-20697102 GTCCTGTGGGCCGGAGGCGTGGG - Intronic
904333580 1:29783333-29783355 GTCCTGTTGGCTCAAGGGGCTGG + Intergenic
907303167 1:53500711-53500733 ATCCTGTTGCACCCAGGCCTGGG + Intergenic
1075684228 10:124353021-124353043 GTCCTGTTGGCCCAACGCCTGGG + Intergenic
1076141600 10:128083591-128083613 GTCCCGTTGACCCACGGCGTTGG + Exonic
1085291149 11:75400548-75400570 CTCCTGTTGGAACAAGGGTTTGG + Intronic
1089582346 11:119489300-119489322 GTCCTGATGGACCAGGGTGGGGG + Intergenic
1090414141 11:126529145-126529167 GTCCTCTTGGAGGAAGGCGCGGG + Intronic
1092956322 12:13553586-13553608 GTCCTGTTGGACCACCACCTGGG + Exonic
1105702226 13:22942202-22942224 GTCCTGTGGGTCAAAGGCATGGG - Intergenic
1105854845 13:24363987-24364009 GTCCTGTGGGTCAAAGGCATGGG - Intergenic
1107169416 13:37322113-37322135 TTCCAGTTGTACCAAGGAGTGGG + Intergenic
1109846921 13:68005422-68005444 TTCCTGTTGGTCCCAGGCTTTGG + Intergenic
1114613641 14:24057192-24057214 GTCCAGGTGCACCAGGGCGTTGG - Exonic
1116810269 14:49533427-49533449 CTCCTTTTGGACCATGGCTTTGG - Intergenic
1125403309 15:39327441-39327463 GTCCTTTTGGACGAAGGGGTGGG - Intergenic
1133818612 16:9216721-9216743 GTCTGGCTGGACCAAGGAGTTGG + Intergenic
1137606190 16:49788209-49788231 GTCCTGGTTGACCCAGGCTTGGG - Intronic
1139563466 16:67758231-67758253 GTCCTGTCGGGACAAGGTGTTGG - Intronic
1144251193 17:13418487-13418509 GTCCTGTTGGAGAGAGGCTTAGG + Intergenic
1146100165 17:29973096-29973118 GTCCTGGTGGACCAAGGCTGGGG - Intronic
1149937602 17:60824497-60824519 GACCTGTTGGATCAAAGCCTGGG - Intronic
1151341424 17:73473390-73473412 GTCCTGTGGGACCATTGCCTAGG - Intronic
1152235136 17:79134750-79134772 GTCCTTTTGGGCCCAGGCGCAGG - Intronic
1159071460 18:63627382-63627404 GCCCTGGTGGACCCAGGCTTAGG + Intergenic
1163428994 19:17255604-17255626 CTCCTGTGGGACCAAGGAGAGGG + Exonic
1165049446 19:33132268-33132290 GTCCTGGGGGACCATGGCGAGGG + Exonic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1166795474 19:45423182-45423204 GGCCTGTGGGACCAGGGTGTGGG - Intronic
932304475 2:70692117-70692139 GTCCTGTTGGACCAAGGCGTGGG - Intronic
936566113 2:113583947-113583969 GTCCTGGTGGACCGAGTCGCGGG - Intergenic
938115766 2:128602140-128602162 GCCCTGTGGCACCAGGGCGTGGG - Intergenic
947749881 2:232526436-232526458 GTCCTGCTGGACCATGAGGTTGG - Intronic
948800902 2:240433104-240433126 TGCCTGTTGGGCCAGGGCGTGGG - Intergenic
1169515531 20:6312235-6312257 GTCCTGTTGCACCAAGATCTAGG - Intergenic
1184238638 22:43200042-43200064 GTCAGGTGGGACCCAGGCGTGGG - Exonic
1184762144 22:46550710-46550732 GTCCTGTTGGGCCATGGCCAGGG - Intergenic
1184787724 22:46679984-46680006 GTCCTGTTGGACGTGGGCATTGG + Intergenic
1185000362 22:48241788-48241810 ATCCTCATGGAGCAAGGCGTGGG + Intergenic
949555397 3:5148173-5148195 GTCCAGCTGGACCAATTCGTAGG - Intronic
954906223 3:54065360-54065382 GGCCTGTTTGTCCCAGGCGTGGG + Intergenic
956727076 3:72164875-72164897 GGCCTGGTAGACCAAGGCGTGGG + Intergenic
962720195 3:138166674-138166696 TTCCTGTGGGACTAAGGCATAGG - Intronic
964540223 3:157771579-157771601 CTACTTTTGGACCAAGGCCTGGG - Intergenic
1004551910 6:16656133-16656155 GTCCTGTTTGACCAAAGGGCTGG + Intronic
1013011457 6:106124592-106124614 GTTCTGTTGGAGGAAGGCGTGGG + Intergenic
1021090510 7:16477489-16477511 GTCCAGTAGGACCAAGGCACTGG - Intronic
1023339735 7:39207339-39207361 TTCCTGTGGAACCAAGGCATGGG - Intronic
1026652932 7:72231283-72231305 GGCCTGTTGGACAGGGGCGTTGG - Intronic
1026826693 7:73586944-73586966 GTCCTATTGGACCAGGGCGGTGG + Intergenic
1028105125 7:86867973-86867995 CTCCTGTGGGACCAAGGCTCTGG - Intergenic
1035258261 7:157645890-157645912 GTCATATTGTACCAAGGGGTGGG - Intronic
1036201359 8:6773807-6773829 GTCCTGTGAGACCAGGGAGTGGG - Intergenic
1052095669 9:24380863-24380885 TGCCAGTTGGACCAAGGCATAGG - Intergenic
1053313425 9:37033988-37034010 GTCCTGCTGGTCCGAGGAGTCGG + Exonic
1186611681 X:11143984-11144006 GTTCTCCTGGACCAAGGCTTGGG - Exonic
1192190687 X:68989643-68989665 GTCCTCTGGAACCAAGGCATTGG - Intergenic
1202115679 Y:21467525-21467547 CTCCTGTTTGCCCAGGGCGTAGG + Intergenic