ID: 932306065

View in Genome Browser
Species Human (GRCh38)
Location 2:70705063-70705085
Sequence GCTTCCTTCTTCCCTTTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 347}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932306065_932306075 24 Left 932306065 2:70705063-70705085 CCTGTAAAAGGGAAGAAGGAAGC 0: 1
1: 0
2: 2
3: 44
4: 347
Right 932306075 2:70705110-70705132 CTGCCTGAGCCCTGAAATCTGGG 0: 1
1: 0
2: 2
3: 32
4: 312
932306065_932306077 28 Left 932306065 2:70705063-70705085 CCTGTAAAAGGGAAGAAGGAAGC 0: 1
1: 0
2: 2
3: 44
4: 347
Right 932306077 2:70705114-70705136 CTGAGCCCTGAAATCTGGGCTGG 0: 1
1: 0
2: 2
3: 35
4: 312
932306065_932306074 23 Left 932306065 2:70705063-70705085 CCTGTAAAAGGGAAGAAGGAAGC 0: 1
1: 0
2: 2
3: 44
4: 347
Right 932306074 2:70705109-70705131 ACTGCCTGAGCCCTGAAATCTGG 0: 1
1: 0
2: 2
3: 27
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932306065 Original CRISPR GCTTCCTTCTTCCCTTTTAC AGG (reversed) Intronic
900347897 1:2219517-2219539 CCTTCCTTGTGCCTTTTTACAGG + Intergenic
900502747 1:3014503-3014525 GCTTCCTCCTTCCCCTTCCCAGG - Intergenic
903360578 1:22774435-22774457 GCCTCCTTCTTCCTTCTTCCTGG - Intronic
904363441 1:29993591-29993613 GGTTACTTCTTCCCTTTCCCTGG - Intergenic
904542191 1:31240415-31240437 CCTTCCTTCTTTCCGTCTACTGG + Intergenic
906103440 1:43277581-43277603 GCTGCCTTCCTGCCTTTTGCAGG + Intergenic
906737438 1:48144318-48144340 GCTTTCTCCTTCCCTTTTTCAGG - Intergenic
906749565 1:48246979-48247001 CCTTCCTTCTTCCCTTATTCAGG + Intronic
906799932 1:48727910-48727932 CCTTCGTTCTTCATTTTTACAGG + Exonic
908437752 1:64122921-64122943 CATTCTTTCTTCCCTCTTACTGG - Intronic
908496037 1:64695910-64695932 GCTGGCTTCTTCACATTTACTGG - Intergenic
909235230 1:73144545-73144567 GCTTTCCACTTCCCTTTTTCTGG + Intergenic
909291071 1:73884411-73884433 GCTTCCTTCGTGTCTTTTAATGG - Intergenic
909918264 1:81347948-81347970 GTTTCATTCTTCCCTTTTCTGGG - Intronic
910088695 1:83436151-83436173 CCTTCCTCCTTTCCTTTTCCTGG + Intergenic
910986728 1:93012263-93012285 ACTTCCATCTTCCCTTGTAGGGG + Intergenic
911039302 1:93579375-93579397 ACTTCCTTCTTCCCTGTCTCTGG - Intronic
911634430 1:100218266-100218288 GCTTCCTTCAGTCCCTTTACAGG + Intronic
911871210 1:103101600-103101622 GCTTCCTTCCTCTGTTTGACTGG - Intronic
912553066 1:110496959-110496981 GGCTCCTTATTCCCTCTTACAGG - Intergenic
912857953 1:113188599-113188621 CCTTCCTTCTTTCCTTATAGTGG + Intergenic
913478293 1:119260226-119260248 GCTTCCCTCTTCCCCTTTAAAGG + Intergenic
914361535 1:146939692-146939714 GCTTTCTTCCTACCTTTTGCTGG + Intronic
915019131 1:152763142-152763164 GCTTCATTCTTCCCTTCCTCTGG - Intronic
916718907 1:167468246-167468268 TCTTTTTTCTTTCCTTTTACTGG - Intronic
916990161 1:170234746-170234768 TCTTCCTTCTTCCTTTTAATTGG - Intergenic
917483438 1:175433011-175433033 TCTTCCTTCTTCCTGTTGACTGG + Intronic
918448124 1:184634418-184634440 GCTTCCTTTTTTCCTTTTTTGGG - Intergenic
919393138 1:197012790-197012812 GCTTCCTTTATCCTTTATACAGG - Intergenic
920826850 1:209430706-209430728 GCCTCTTTCTTCCCTTTGACTGG + Intergenic
921430360 1:215058263-215058285 TCTTCCTTTTTTCCTTTTAGGGG + Intronic
922039102 1:221878302-221878324 TTTCCCTTCTTCCCTTTTTCAGG - Intergenic
922992214 1:229924067-229924089 ATTTCCTTCTTTCCTTTTTCTGG + Intergenic
923165245 1:231355405-231355427 TGTTCCTTCTTCCCTTTGAAAGG - Intergenic
923776340 1:236981908-236981930 CCTCCCTTCTTCCTTTTTTCTGG - Intergenic
1063341717 10:5271504-5271526 CCATCCTTCTTTACTTTTACAGG - Intergenic
1063814483 10:9757079-9757101 CCTTCCTTTTTGCCTTTTAATGG - Intergenic
1065008867 10:21403929-21403951 GGTTCCATCTTCCCTTTTTTTGG - Intergenic
1065202535 10:23328152-23328174 GCTTTCTTCTTCTCTTTTATAGG - Intronic
1065856489 10:29834815-29834837 ACGTCCTTCTTCCTTTTTCCTGG + Intergenic
1066520516 10:36213114-36213136 CCTTCTTTCTACCCTTTCACAGG + Intergenic
1068219472 10:54025900-54025922 GCATCCTCCTTCACTTTTAAGGG + Intronic
1068672474 10:59737853-59737875 GCATTCTTAATCCCTTTTACAGG + Intergenic
1070736463 10:78866810-78866832 GCTTCCTTCTTCCCCTTGTCTGG - Intergenic
1071138859 10:82483328-82483350 TCTTCCTTCTGCCCTTTAAAGGG + Intronic
1071341500 10:84653127-84653149 GCTTCCTCCATCCCTTTCTCTGG + Intergenic
1073703235 10:105954051-105954073 GCTTACTTCTCCCCGCTTACAGG - Intergenic
1074857999 10:117487547-117487569 CCTTCCTTCCTCCTTTTTGCTGG + Intergenic
1075551446 10:123395614-123395636 GGTTCCTTCTTCCCTTGGAGTGG - Intergenic
1075602044 10:123777026-123777048 CCTTCCCTCTTCCCTTCTTCTGG - Intronic
1075710331 10:124527294-124527316 CCTTCCTTCTTCACTTTTCCAGG - Intronic
1076476548 10:130757716-130757738 GCCTCCTTCTTCCCAGTTTCAGG + Intergenic
1078067543 11:8088270-8088292 GCTTCCTTCTACCCTCTGACTGG + Intronic
1078397459 11:10993693-10993715 CCTTTCTTCTTCCTTTTTACAGG - Intergenic
1078899263 11:15626311-15626333 GTTTCCTTCTTCCATTTTTAAGG + Intergenic
1079426907 11:20352366-20352388 GGCTCATTATTCCCTTTTACAGG + Intergenic
1079701145 11:23550273-23550295 TCTTCTTTCTTCCCTCTTCCTGG + Intergenic
1079740075 11:24047285-24047307 TCTTCCTACTTCTCTATTACTGG + Intergenic
1080242663 11:30144534-30144556 CCTTCCTTCCTCCCTCATACTGG + Intergenic
1080581940 11:33651491-33651513 GCCTCCTTCTTCCCTGGGACAGG + Intronic
1080892589 11:36422334-36422356 CCTTCCTTCTGCCCCTTTACTGG - Intronic
1081750217 11:45505314-45505336 GCTTCCTTCTTCCCTTGTCTTGG + Intergenic
1082306828 11:50588424-50588446 GCTTCCTTCTTCTTTTATCCTGG - Intergenic
1082306861 11:50588912-50588934 GCTTCCTTCTTCTTTTATCCTGG - Intergenic
1084391838 11:68882459-68882481 GCTTCCTTCTTTTCTTCTTCCGG - Intergenic
1087424834 11:97972787-97972809 GTTTCCTTCTTTCCTTTTCATGG - Intergenic
1087996434 11:104815363-104815385 ACTTACTTCTTCCCTTTTTATGG - Intergenic
1088653640 11:111978577-111978599 GCCTCCTTCTGCCCTTATATGGG + Intronic
1089637265 11:119823070-119823092 GCTTCCCTCTTCCCTTCCACTGG - Intergenic
1089775420 11:120832184-120832206 GCTTTCTTCTTTCATTTTTCGGG - Intronic
1089941389 11:122421537-122421559 ACTTCCTTCTTTCTTTTTATAGG + Intergenic
1090900778 11:131028927-131028949 GCTTCCCCCTTCCCTTTCTCAGG - Intergenic
1091265156 11:134264886-134264908 TCCTCCTTCCTCCCTCTTACAGG + Exonic
1092161117 12:6316040-6316062 CCTCCCTACTTCCCTGTTACTGG + Intronic
1093980226 12:25467671-25467693 GGTTTCTTCTTCCCAATTACCGG - Intronic
1093990795 12:25587739-25587761 TCTTCTTTCTTCCTTTTTAATGG + Intronic
1095332330 12:40981735-40981757 TCTTCAATCTTCCATTTTACAGG - Intronic
1097919470 12:65056126-65056148 GCTGCATTCTTCTCTTTTTCAGG - Exonic
1099278963 12:80617952-80617974 CCTTTCATCTTCCCTTTTACAGG + Intronic
1099422163 12:82474205-82474227 GCTTACTTTTTCCCTGTAACAGG + Intronic
1099585665 12:84509259-84509281 GCCATCTTCTACCCTTTTACTGG + Intergenic
1099716772 12:86304866-86304888 TCTTCCTTCTTCCCAGCTACTGG - Intronic
1099742911 12:86664305-86664327 CTTTCCTTCTTCCCCTTTGCAGG + Intronic
1100123856 12:91399515-91399537 GCTTCCTTCTCACCTTTCATAGG - Intergenic
1100207739 12:92369382-92369404 GTTTCCGTCTTCCCTTAGACTGG - Intergenic
1100895548 12:99178435-99178457 GCTTTCTTATTACCTTTGACTGG + Intronic
1101325237 12:103709790-103709812 GCTTCCTGCTTCCCTCTCCCAGG - Intronic
1101341334 12:103844153-103844175 GGTTTCTTTTTCCCTTTTCCAGG + Exonic
1102162615 12:110781842-110781864 GCTTCCTTCCTCCCCGCTACTGG - Intergenic
1102539227 12:113606527-113606549 GATGCCTTCGTCCCTTTTCCTGG - Intergenic
1102662616 12:114542992-114543014 TCTTCCTTCTTCACTTTCAAAGG - Intergenic
1104057325 12:125240366-125240388 GCTACCTACTTCCTTTTGACAGG + Intronic
1109069699 13:57748793-57748815 TCTTTCTTCTTCCCTTTTCGTGG + Intergenic
1109136622 13:58659299-58659321 CATTCCTTCTTTTCTTTTACAGG - Intergenic
1109611163 13:64766012-64766034 GGTTCATTCTTCCCTATTAAAGG - Intergenic
1109837257 13:67876384-67876406 GTCTCCTTCTTCCACTTTACAGG - Intergenic
1112085913 13:96032829-96032851 ACTTCCTTTTTCCTTTTTAGTGG - Intronic
1112127221 13:96481352-96481374 GCTTCCCTCTTCACTTACACAGG - Intronic
1112446748 13:99471511-99471533 CCTTCCTTCTTTCCTTTTTTTGG - Intergenic
1114281360 14:21195225-21195247 GCTTCCTTCGGCCATTTTAAAGG - Intergenic
1114711469 14:24782734-24782756 GCTTCCTTATTTCCCTTTGCTGG + Intergenic
1115905509 14:38198944-38198966 GCTTCCCTCTTCCCTACTACAGG - Intergenic
1116486679 14:45458225-45458247 TCTTCCTTCTTTCCTTTTGCAGG - Intergenic
1116923180 14:50603093-50603115 GCTTCCTACTTTCCTATTACAGG - Intronic
1117251401 14:53943046-53943068 ACATCCCTCTTCCCCTTTACAGG - Intergenic
1118622960 14:67630948-67630970 CATTCATTCTTCCCTTTTTCCGG - Intronic
1120869284 14:89322745-89322767 GCCTCCTTCTTGCCTCTTCCTGG - Intronic
1121579135 14:95013619-95013641 GCTTCCATCTTGCCTTTTTTGGG + Intergenic
1121996538 14:98607479-98607501 GCTCCCTTCCTCCCTTCCACAGG + Intergenic
1122370704 14:101227524-101227546 TCTTCCTGCTGCCCTTTTGCAGG - Intergenic
1122805553 14:104254766-104254788 GCTTCCTTCTTCCCTAGGTCAGG - Intergenic
1125246001 15:37640946-37640968 GCTTCTTTCTTGACTTATACAGG + Intergenic
1126151382 15:45526302-45526324 CCTTCCTTCTTTCCTTTTTTTGG + Intergenic
1126394029 15:48192530-48192552 GCTTCTTTTCTCTCTTTTACTGG + Intronic
1127579463 15:60324170-60324192 TCCTCCTTCTTTCCTTTTACTGG + Intergenic
1129518524 15:76171338-76171360 GCTTCCCACTTCCCATTTAGGGG + Intronic
1130808558 15:87352885-87352907 GCTTCCTTCTTCCCTACTCCAGG + Intergenic
1130941827 15:88516708-88516730 GCTTTCTTTTTCTCTTTTTCTGG - Intronic
1131339078 15:91579407-91579429 TCTTTCTCCTTCCCTTTTCCTGG - Intergenic
1132396684 15:101479842-101479864 GCTTCCTTCTTGCCTTCAAAAGG - Intronic
1132948024 16:2543400-2543422 CCTTCCTGCTTCCCCTTTTCTGG + Intronic
1132966423 16:2657942-2657964 CCTTCCTGCTTCCCCTTTTCTGG - Intergenic
1132971998 16:2693684-2693706 GCTTCCTTCTCCTCTTGCACCGG + Intronic
1133647784 16:7780630-7780652 CCTTCCTTCTTCCTTTTTTAAGG + Intergenic
1134200222 16:12191807-12191829 CCTCCCTTCTTGCCTTTTATTGG + Intronic
1134682146 16:16133772-16133794 GGCTCCTTCTTCCCTCCTACAGG - Intronic
1135274742 16:21102441-21102463 GCTTCCTTCTCCCTTTGAACAGG - Intronic
1136134209 16:28244924-28244946 CCTTCCTCCATCCCCTTTACAGG + Intergenic
1137222499 16:46470126-46470148 TCTTCCTTCTTCTCTTTTCTGGG - Intergenic
1137660293 16:50199671-50199693 GATTCCTTCATGCCTTTTCCTGG + Intronic
1138354586 16:56367128-56367150 GCTTCCTTCTGTCCTTCCACGGG + Intronic
1138508620 16:57493872-57493894 TCTTCCTTCTTCTCTCTTTCAGG + Intergenic
1138688164 16:58744724-58744746 GCTTCCTTCTTCCCCTGAACCGG + Intergenic
1141246244 16:82310216-82310238 GCTTCCTTCTTCTTCTTCACTGG - Intergenic
1141830436 16:86507377-86507399 CCTTCTTTCTGCCCTTTCACCGG - Intergenic
1143907646 17:10222025-10222047 GCTCCCTCCTTCCCCTTTAAGGG + Intergenic
1145089578 17:19975938-19975960 GCTTCCTCCTACTATTTTACCGG + Intronic
1145467257 17:23483616-23483638 GCTTCCATCTAGGCTTTTACGGG - Intergenic
1145751069 17:27355491-27355513 CCTTCCTTCTTTCCACTTACTGG - Intergenic
1146386528 17:32381210-32381232 TCTTCGGTCTTCACTTTTACTGG + Exonic
1146908380 17:36632360-36632382 GCTTCCTACTGCCCCTTTCCTGG - Intergenic
1147479064 17:40741756-40741778 GCTTTCTTCTCCCCTTCCACAGG - Intergenic
1148514981 17:48208334-48208356 GCATCCTTCATCCCTTTCCCCGG - Intronic
1148799197 17:50212477-50212499 GCTGCCTCCCTCCCTTTTGCTGG + Intergenic
1151123530 17:71819905-71819927 TCTTCCCTCTTTCCTTTTCCAGG - Intergenic
1151494460 17:74451108-74451130 GCTCCCTGCTTCCCTTCCACTGG - Intronic
1151713226 17:75818406-75818428 GCTTCTCTCTTCCCTGCTACAGG + Intronic
1153128208 18:1822216-1822238 GCCTGCTTCTTCTCATTTACTGG - Intergenic
1153713933 18:7826746-7826768 GTTTCCTTTTACCCTTTTTCTGG + Intronic
1155567826 18:27155888-27155910 GCTTTATTCTCCCATTTTACCGG - Intronic
1157571131 18:48713130-48713152 GCCTCCTTCTTCCCTCTACCAGG - Intronic
1158707497 18:59805968-59805990 GCTTCCTTCTTTCCTCTTTCAGG - Intergenic
1159055581 18:63460024-63460046 CCTTCTTTCCTCCCTTTTTCTGG + Intergenic
1159148388 18:64484969-64484991 GCTTCCTTCCTGGCTGTTACAGG + Intergenic
1159599258 18:70413228-70413250 GCCTCCTTTTACCATTTTACTGG - Intergenic
1159971695 18:74663848-74663870 GTTTCCTTCTTGCCTATGACAGG - Intronic
1160098898 18:75902300-75902322 GTTTCTTTCTTCCTTGTTACCGG - Intergenic
1160707742 19:537255-537277 GCTTCCTGGTGCCCATTTACAGG + Intronic
1161352311 19:3800732-3800754 TTTTCCTTCTTCCATTTTTCTGG + Intronic
1161815837 19:6499423-6499445 GCCTCTTACTTCCATTTTACAGG - Intronic
1161927641 19:7313034-7313056 CCTTCCTTCCTCCCTGTTCCCGG + Intergenic
1163019636 19:14475343-14475365 GCTTCCTCCCTCCCTCTTCCTGG + Exonic
1163102210 19:15105042-15105064 TCTTCCTTGTTCACTTTTAGAGG + Intergenic
1163105025 19:15118379-15118401 TCTTCCTTGTTCACTTTTAGAGG + Intronic
1165961819 19:39541095-39541117 GCCACTTTCTTCCCTTTTATGGG + Intergenic
1166249655 19:41560165-41560187 GCTTCCTTTTTTCCATTTTCTGG - Intronic
928207308 2:29295194-29295216 GCCTCCTTCTTCCCTGTTAAAGG - Intronic
928381177 2:30820094-30820116 TCTTCCTTCTTCCCTTTCTGGGG - Intronic
929182553 2:39058637-39058659 ACTGCCTTCTTGCCTTTTAAGGG - Intronic
929548143 2:42870048-42870070 CCTTCCTTCCTTCCTTCTACAGG - Intergenic
929755888 2:44764457-44764479 GCTTTGTTCTTCCCATTTAATGG + Intronic
930148163 2:48029035-48029057 GCTTCTTACCTCCCTTTCACTGG - Intergenic
930649130 2:53946904-53946926 CCTTCCTTCCTTCCTTTTTCAGG - Intronic
931100617 2:58996464-58996486 GCTTCCCTCTTCCATTTTTAAGG - Intergenic
931883044 2:66587160-66587182 GCTCCCTTCTTCCATTTTCTTGG - Intergenic
932306065 2:70705063-70705085 GCTTCCTTCTTCCCTTTTACAGG - Intronic
933156681 2:78983187-78983209 GCTTGATTCTTCCCTATTAGGGG - Intergenic
936947328 2:117942351-117942373 GCCTCTCTCTTCCCTTTTACAGG + Intronic
936977936 2:118237827-118237849 GCCTCCTTCTCCCTTTGTACTGG - Intergenic
937058558 2:118962567-118962589 GTTTCTTTCTTTCTTTTTACTGG + Intronic
937804522 2:126123296-126123318 GTTTACTTCATCCCTTTAACAGG + Intergenic
939409493 2:141805719-141805741 GTTTTCTTCCTCCCTTTTAAAGG + Intronic
940172775 2:150846602-150846624 CCTTCCTTCTTGCCTTTGATGGG + Intergenic
940385199 2:153063607-153063629 CCTTCCATCTTCCTTTTTAAGGG - Intergenic
941033428 2:160538992-160539014 TCTTCCAATTTCCCTTTTACAGG + Intergenic
942537447 2:176979777-176979799 GTTTCATTCTTCCCATTTTCTGG - Intergenic
944483629 2:200181289-200181311 GCTTCCTCATCCCCTTTCACAGG + Intergenic
944617329 2:201475015-201475037 GCTTCCTTCCCCTCTTTTAATGG + Intronic
944783988 2:203048910-203048932 TCTCTCTTCTTTCCTTTTACTGG + Intronic
945801323 2:214434956-214434978 GCTTCCTTTTTCCCCCATACTGG + Intronic
945932125 2:215865775-215865797 CCCTTCTCCTTCCCTTTTACAGG - Intergenic
946455731 2:219824425-219824447 TCTTCCTTCTTCACTCCTACTGG + Intergenic
947641863 2:231711326-231711348 GGTTCCTTCTTCCCTTTTGAAGG + Exonic
948573745 2:238936484-238936506 GCTTTCTTCTTCCATGTTGCAGG + Intergenic
1169101694 20:2955804-2955826 GCTGTCTTCTTCCCTTTTTTTGG + Intronic
1170631586 20:18071129-18071151 GCTTCAGTCTCCCCTATTACAGG + Intergenic
1175081903 20:56427786-56427808 GCTTCCTACTTCCCCTTTGAGGG - Intronic
1177587547 21:23118104-23118126 GCTTCTACCTTCCTTTTTACTGG + Intergenic
1179883008 21:44301156-44301178 GCTTCCTTCTCGCCTCTTCCTGG - Intronic
1180155941 21:45977502-45977524 GCCCCCTTCTTCCCTTTCTCTGG + Intergenic
1180570134 22:16707791-16707813 TCTTCCATCCACCCTTTTACAGG - Intergenic
1181448011 22:22993475-22993497 ACTTCCTTCTTACCTTCTCCTGG - Intergenic
1182794457 22:32980702-32980724 GCTGATTTCTTCCCCTTTACAGG - Exonic
1182934528 22:34208672-34208694 GCCTCCTTCTTCCATTCTTCTGG + Intergenic
1183696167 22:39424169-39424191 CATTCATTCTTTCCTTTTACTGG + Intronic
1184011353 22:41751072-41751094 GCTTCCCTCCTCCCTCTTGCAGG - Intronic
1184677226 22:46050351-46050373 CCATCCTTCTTCCCCTTCACAGG + Exonic
1184889160 22:47369010-47369032 GCATCTTTCTTCCCTTTGAACGG + Intergenic
1185087265 22:48747554-48747576 GCTTTCTTCTTACTGTTTACTGG + Intronic
949193370 3:1276708-1276730 GCTCTCTTCTTATCTTTTACAGG + Intronic
950797543 3:15522242-15522264 ACTTCCTTCCTCCTTTTTATTGG - Intergenic
950921593 3:16700368-16700390 CCCTCCTGCTTCCCTCTTACAGG + Intergenic
951814423 3:26737857-26737879 TCCTCATTCTTCCCTTTCACTGG + Intergenic
952430640 3:33219483-33219505 GCTTCCTTCACCACTTTTCCTGG + Intergenic
952457151 3:33484002-33484024 GCTGCCTTCATCCCTTTTTATGG + Intergenic
953564461 3:44019517-44019539 GCTTCATTGTTCCCACTTACGGG - Intergenic
954043523 3:47909163-47909185 TCTTCCTTTTTCCCTTCTCCTGG + Intronic
954919907 3:54181045-54181067 GCTTCCCTCTTCTCTGTGACTGG + Intronic
956587672 3:70881821-70881843 GTTACCTTCTTTACTTTTACTGG + Intergenic
956597801 3:70987352-70987374 CTTGCCTTATTCCCTTTTACTGG - Intronic
956896780 3:73668851-73668873 GCTTTCTTTTTCCATTTTAATGG - Intergenic
957108435 3:75921996-75922018 TCTTCCATCCACCCTTTTACAGG + Intronic
958164490 3:89862271-89862293 GCTTTCCTCTTCCCCTTCACAGG + Intergenic
958801453 3:98761050-98761072 ACTTCCTTCTTCCCACTTCCTGG - Intronic
960851605 3:122060470-122060492 TCTTCCTTCCTCCATTTTAAAGG + Intronic
961198276 3:125022290-125022312 ACTTCCTTTTTCCCTTTTCTAGG - Intronic
961399610 3:126628368-126628390 GTTTGTTTCTTCCTTTTTACTGG - Intronic
961612439 3:128151940-128151962 GCCTCCTCCTTCCATTTTTCTGG - Intronic
961990543 3:131185356-131185378 CCTTCCTGCTTGCCTTTCACAGG - Intronic
962466671 3:135667018-135667040 CCTTCCTTCTTTCCTTACACAGG - Intergenic
963264378 3:143226225-143226247 GCTTCCTTCTGCACTTTTACTGG - Intergenic
963952168 3:151214618-151214640 TCTTCCTTCTTCCTTTTTTTTGG + Intronic
964192079 3:154014871-154014893 GCTTCACTCTTCCCTTTCTCTGG - Intergenic
965720084 3:171651843-171651865 TCTTCCTTCCTCTCTTTTCCAGG + Intronic
967131058 3:186471175-186471197 CCCTCCCTCTTCCCTTTTAGAGG + Intergenic
967304673 3:188049112-188049134 ATTTACTTCTTCCCTTTTAAGGG - Intergenic
967488543 3:190062054-190062076 GCTTACTTCTACCCTTCAACAGG + Intronic
967533985 3:190581350-190581372 GCTTCCTGATTTGCTTTTACTGG - Intronic
967828927 3:193902258-193902280 GCCTCCTTCTAACCTTTCACCGG - Intergenic
969055770 4:4401722-4401744 CCTGCCTTCTTCCTTCTTACTGG - Intronic
970155712 4:13139892-13139914 CCTTCCTTCTCCCATTTTCCAGG - Intergenic
970470514 4:16374069-16374091 TCCTCCCTCTTTCCTTTTACAGG - Intergenic
970773903 4:19649488-19649510 GCCCCCTTTTTCCCTTTTACTGG + Intergenic
972777247 4:42252979-42253001 GCTATCTTCTTCCATTTTTCAGG - Intergenic
973119040 4:46494872-46494894 GTGTCCTTCTTCCCTTCTATGGG - Intergenic
973833007 4:54780744-54780766 GCTTCCTTCTTCCACTTAAGTGG + Intergenic
974407279 4:61490359-61490381 GTTTCCTTCTCCTCTTTCACTGG + Intronic
975211363 4:71703898-71703920 GCTTCCTTCTTCCACTTTTAAGG + Intergenic
975654050 4:76623198-76623220 TCTTCCTTCTTCCCTATAACAGG + Intronic
975809744 4:78154919-78154941 ACTTCCTTCTACCATTTTCCTGG + Intronic
975813995 4:78198293-78198315 GCATCCTTTTTTCCTTTTAGAGG + Intronic
976054398 4:81046486-81046508 GCTTTCTCCTTGCCTTTTTCAGG - Exonic
976117911 4:81747905-81747927 CCTTCCCTCTCTCCTTTTACAGG + Intronic
976785354 4:88813509-88813531 TTTTCCTTCTTTCCTTCTACAGG - Intronic
976973413 4:91136844-91136866 GGTTCCCTCTTCATTTTTACTGG + Intronic
977370110 4:96124641-96124663 GCTTTCTGCTTCCCTTTTACAGG + Intergenic
978118647 4:105051364-105051386 GCTTCCATTTTCCCTCTTTCAGG - Intergenic
978857168 4:113406355-113406377 GCTTTCTTCTCCCCTTATAGTGG - Intergenic
979699617 4:123653318-123653340 TCTTCCTTCTTTCCTTTTCCTGG + Intergenic
980124166 4:128757656-128757678 TCTTCTTTCTTGCCTTCTACAGG - Intergenic
981862586 4:149375345-149375367 GCTTCCTCCCTTCCTTCTACAGG - Intergenic
982185538 4:152793916-152793938 GGTTCCTTCTTCCTTTATTCTGG + Intronic
983330428 4:166320722-166320744 GCTTCCTTCATTCCTTTTCATGG + Intergenic
984329520 4:178297297-178297319 GCTTCCTCCCTCCCTTTCACAGG + Intergenic
985306684 4:188550147-188550169 GCTTTCTTCTTCATTTTTATTGG - Intergenic
985899146 5:2773715-2773737 GCTTCCCTCTCTCATTTTACTGG + Intergenic
988578479 5:32448283-32448305 TCTCCCTTCTTCCCTTTACCTGG + Intergenic
989450763 5:41584102-41584124 TCTTCCTTCTTTCCTTTCAAAGG - Intergenic
989774330 5:45184570-45184592 GCTTCCCACTTCCCTCTTCCCGG - Intergenic
990315736 5:54581589-54581611 CCTCCCTTCTTCCCTTGTTCTGG + Intergenic
991253025 5:64584761-64584783 GCTCCATTCTTCCCATGTACTGG - Intronic
991962150 5:72055698-72055720 CCTTCCTTCTCTCCTTCTACTGG + Intergenic
993228606 5:85203335-85203357 GCTTTCTTCTTCTCTTTTTCAGG + Intergenic
993344979 5:86771500-86771522 CCTTCCTTCTTTTCTTTTTCTGG - Intergenic
993626134 5:90227127-90227149 GCTTCTTTTTTCCTTTTTAAAGG - Intergenic
993864716 5:93178574-93178596 GCTTCCTTTTTAACATTTACAGG + Intergenic
994413441 5:99438659-99438681 CCTTCCTTTTTCACTTTTACTGG + Intergenic
995818499 5:116199877-116199899 GCTTTCTTCTTCACTTTTAAAGG + Intronic
996470418 5:123853516-123853538 GCCTCCTTCTTCCATTTTTAAGG - Intergenic
997253246 5:132407613-132407635 CCTTCCCTCTTCTCTTTCACAGG - Intergenic
997435562 5:133871810-133871832 CCTTCCTTCCTTCCTTTCACAGG - Intergenic
998702867 5:144724321-144724343 GCTTTCTTCTCCTCTTTTTCTGG + Intergenic
999354728 5:150915423-150915445 TCTTCCTCCTTCCCTTTTTTAGG + Intergenic
999486461 5:152001942-152001964 GCTTCCTTTTTGGATTTTACTGG + Intergenic
999954903 5:156689555-156689577 GCTTCCTACTTCCCTTTCCTTGG - Intronic
1000098851 5:157995152-157995174 GCCTCCTTCTTCCATTTGGCTGG + Intergenic
1001075972 5:168628341-168628363 GCTGCCTTCTTGCCTTCTGCTGG - Intergenic
1001295470 5:170495890-170495912 CCTTCCTCCTTCCCTCTTCCTGG + Intronic
1001545938 5:172570661-172570683 CCTTCCTTCCTCCCTTTAACAGG - Intergenic
1003147411 6:3520362-3520384 CCTTCCTTCTTCCCTTTCCTTGG + Intergenic
1005929437 6:30472187-30472209 TTTTCCTTCATCACTTTTACTGG - Intergenic
1006215144 6:32435102-32435124 CCTTCCTTCTTACGTTCTACTGG - Intergenic
1006779777 6:36624433-36624455 GGTTACTTCTGCCATTTTACAGG - Intergenic
1007895758 6:45356045-45356067 GCTTTCTTCTTACCTTTCATAGG - Intronic
1008605280 6:53133787-53133809 CCTGCCATCTTCCCTTTAACAGG + Intronic
1010915573 6:81613883-81613905 CCTTCCTTCTTCCCTGTTCCAGG - Intronic
1010953485 6:82064369-82064391 GCTTCTTTCTTTCTTTTTTCAGG + Intergenic
1011717968 6:90126968-90126990 GTTTCCTTCCTCCCTTTAAAGGG + Intronic
1012647583 6:101706636-101706658 TCTTCCCTCTCTCCTTTTACAGG - Intronic
1014579666 6:123121645-123121667 GCTTCATTGTTCCCATATACAGG - Intergenic
1014729197 6:125011114-125011136 TCTTCTTCCTTCCCTTTTAACGG - Intronic
1014892032 6:126854593-126854615 GCTCCCTGCTTCCCTTTGAAAGG - Intergenic
1018395075 6:163372187-163372209 GCTTATTACTTCCATTTTACAGG - Intergenic
1018533282 6:164791293-164791315 GCTTTCATCTTCTCTTTTATTGG - Intergenic
1020685277 7:11286094-11286116 CCTTCCTCCTTTCCTTTTTCTGG + Intergenic
1020893879 7:13915528-13915550 GCTTACTTCTTCTCATTTGCTGG + Intronic
1021140042 7:17013087-17013109 TCTTCCTTCTTCCCTCTTGCTGG + Intergenic
1022035690 7:26532024-26532046 GCTTTCTTTTTCCCTTCTACTGG - Intergenic
1022391211 7:29946358-29946380 GCCTCCTTCCTCCCTTCCACAGG + Intronic
1022800074 7:33768339-33768361 GCTTCCCTCTTCCATTATATTGG + Intergenic
1023032446 7:36102372-36102394 CCTTCCTTCTTTCCTTTTTTTGG - Intergenic
1023385471 7:39652641-39652663 TCTTGCTTCTTACCTTATACAGG - Intronic
1024903636 7:54351349-54351371 ACTTCCTTCATCCCCTTTATGGG + Intergenic
1025228147 7:57181242-57181264 TCTTCCTCCTTCTCCTTTACAGG + Intergenic
1025228303 7:57182068-57182090 TCCTCCTCCTTCTCTTTTACAGG + Intergenic
1025228402 7:57182563-57182585 TCCTCCTCCTTCTCTTTTACAGG + Intergenic
1025931529 7:65998667-65998689 GGTTCATTCTTCCTTTTTAATGG + Intergenic
1025945301 7:66100039-66100061 TCTTCCTTCTCCTCCTTTACCGG - Intronic
1026283628 7:68944073-68944095 CCTTCCCTCTTCCCTTTCATGGG + Intergenic
1026620734 7:71947964-71947986 GCTTTTTTCTTCTCTTTTCCAGG + Intronic
1027305549 7:76892587-76892609 CCTTCCTCCTTTCCTTTTCCTGG + Intergenic
1029018360 7:97338217-97338239 GCTTCCTTCGTCTCCTTTTCAGG + Intergenic
1029736380 7:102467998-102468020 GCTTCCTTCCTCCCCATCACAGG - Intronic
1031111675 7:117618108-117618130 TCTTCCTTGGTCCCTTTTCCTGG + Intronic
1032151094 7:129430616-129430638 ACTTCTTTCTTCCCTTTGGCTGG - Intergenic
1033579496 7:142719050-142719072 TCTTCCTTCTCCCATTTTCCTGG + Intergenic
1033861126 7:145629385-145629407 CCTTCCTTCCTCCCTTTAATAGG - Intergenic
1034264517 7:149774388-149774410 CCTCCCTTCTGCCCCTTTACGGG + Intergenic
1035060813 7:156067995-156068017 TCTTCCTTCTTCCCTTCTCGTGG - Intergenic
1035110309 7:156476171-156476193 TCTTCCTTCTTCCCTTCTCACGG - Intergenic
1035668523 8:1397784-1397806 CTTTCCTTCTTCCCTTTTTTAGG + Intergenic
1036020048 8:4834548-4834570 ACTTCGTTCTTCCCTTCTATTGG - Intronic
1036157519 8:6356564-6356586 GCTTCTCTCTCCCCTTTTTCTGG - Intergenic
1037094285 8:14964838-14964860 GCTTCCTACCTCCCTTTTGCAGG - Intronic
1038400355 8:27279816-27279838 GCTTCTGTCTTCCCTGGTACTGG + Intergenic
1039087707 8:33796272-33796294 GTTTCTTTCTTTCCTTTTGCAGG + Intergenic
1039595005 8:38784119-38784141 GCTTCGTTCTTACCTGGTACAGG - Intronic
1040120250 8:43676299-43676321 GCTTCCTTCTCCTTTTTGACTGG - Intergenic
1040134868 8:43841293-43841315 GCTTCCTTCTAGCTTTTTTCTGG - Intergenic
1040327460 8:46359590-46359612 GCTTCCTTCTTATTTTTTATTGG + Intergenic
1040772106 8:50990347-50990369 GCTTCCTTCATCCCTTTATTTGG + Intergenic
1040879141 8:52186121-52186143 GCTTGCTTCTTCTCTCTTAATGG - Intronic
1042334977 8:67620497-67620519 CCCTCCTTCTTCCCTTCTAGAGG + Intronic
1043754658 8:83987861-83987883 TCTCCATTCTTCCCTTCTACAGG - Intergenic
1044617639 8:94158521-94158543 GCTTCCTTTTATCCTTTTGCAGG - Intronic
1045355729 8:101387331-101387353 TCTTCCTTCTTCTCCTTCACAGG - Intergenic
1046424873 8:114033899-114033921 GGTTCCTTCTACCCATCTACAGG - Intergenic
1047626065 8:126657328-126657350 CCTTCTTTGTTTCCTTTTACTGG + Intergenic
1047744885 8:127837313-127837335 GCCTTCTTTTTTCCTTTTACAGG - Intergenic
1048118576 8:131553429-131553451 GCTTTCTTCTTTCCACTTACAGG - Intergenic
1048341668 8:133544603-133544625 GATTGCTTCTTCCCCTTTAGAGG + Intronic
1050769237 9:9175914-9175936 GCTTCTTTCTTTCTTTTTTCAGG - Intronic
1051017340 9:12494764-12494786 GCTATCTTCTGCCCTTTTCCTGG + Intergenic
1053042613 9:34887500-34887522 GCTTCCTTGTTCCTTCTGACAGG + Intergenic
1054933136 9:70657340-70657362 GCTTTTTTCTCCCCTTTTAAAGG + Intronic
1055074049 9:72195595-72195617 TGTTACTTCTTCCCTTTTACTGG + Intronic
1055075029 9:72205333-72205355 CCTTCCTTCTTCCCTTTCTCAGG + Intronic
1055263050 9:74461429-74461451 GCTTGCTTCTTAGCTTTCACTGG + Intergenic
1055373205 9:75622931-75622953 GCTTGCTTTCTCCCTTTTTCAGG + Intergenic
1056666596 9:88585979-88586001 TCTTCTTTCTGCCCTTTCACAGG + Intergenic
1056743440 9:89279925-89279947 GCTTCCAGCTTCCCTTCCACTGG - Intergenic
1057872497 9:98728914-98728936 CCTTTCTTCTTCCCTTCCACAGG - Intergenic
1058318188 9:103595102-103595124 TCTTCCTTCTTTCCTTTTGCAGG - Intergenic
1058402676 9:104636261-104636283 GCTTCCTGCTTACCTTTTCCCGG - Intergenic
1058448666 9:105076158-105076180 GCTTCCTTCTTCCCACTTTCTGG - Intergenic
1059210514 9:112510543-112510565 GTTTCCCTCTTTTCTTTTACGGG + Intronic
1059530525 9:115031358-115031380 GCTTCCTCCTTTCCTTTCACCGG + Intronic
1059885974 9:118745122-118745144 GCTCCCTCCTTCCCTTCCACAGG + Intergenic
1060489599 9:124072990-124073012 TGTTCCTTCTGCCCTTTTCCGGG + Intergenic
1060624172 9:125095295-125095317 TCTTGCTTCTTCCCTTCCACAGG + Intronic
1061003614 9:127916388-127916410 TCCTCCTTCTTCCCACTTACCGG + Exonic
1203769339 EBV:40948-40970 CCTTCCTCCTTCCGTTTTAATGG + Intergenic
1203789617 EBV:143867-143889 CCTTCCTCCTTCCGTTTTAATGG + Intergenic
1186467515 X:9795561-9795583 GCTGCTTTCTTCCCTGTTAGAGG + Intronic
1186788039 X:12971594-12971616 TCTTCCTTCTTCTCTTCTTCTGG + Intergenic
1187679594 X:21753693-21753715 GCTTCCTCCTTCCCTTTTTGTGG + Intronic
1188555991 X:31412528-31412550 CCTTCCTTCTTCCATGTTGCTGG + Intronic
1191647366 X:63496436-63496458 GCTTCCTGTTTCCCTGTTATTGG - Intergenic
1191684038 X:63870596-63870618 GCTCCCCTCTTTCTTTTTACTGG - Intergenic
1192223715 X:69214597-69214619 CCTTCCCTCTTCCCTCTTAGCGG + Intergenic
1192276203 X:69633684-69633706 CCGTCCTTTTTCCCTTTTACAGG + Intronic
1192589335 X:72346840-72346862 GCTGTCTTCTTCCCATTTCCAGG + Intronic
1192743224 X:73913559-73913581 GCTTACTTCTCCCTTTCTACTGG + Intergenic
1193521393 X:82534063-82534085 GCTTCCTGCTGGCCTTTTGCAGG + Intergenic
1193608241 X:83594511-83594533 GGTTCCTTCATCCCTCTCACAGG - Intergenic
1194804596 X:98311758-98311780 GCTGCCCTCTTCCATTTTACAGG - Intergenic
1196323001 X:114365689-114365711 GATTTCCTCTTGCCTTTTACAGG + Intergenic
1197130900 X:123004512-123004534 CCTTCCTTTTCCCCTTTCACAGG + Intergenic
1197730336 X:129804400-129804422 TCTTCCTTTTTCCTTTTAACAGG - Exonic
1198273293 X:135076072-135076094 ATTTCCTTCTTCCATTTTCCAGG + Intergenic
1202275307 Y:23112291-23112313 GATTCCATTTTCCTTTTTACTGG - Intergenic
1202290721 Y:23308400-23308422 GATTCCATTTTCCTTTTTACTGG + Intergenic
1202428299 Y:24746010-24746032 GATTCCATTTTCCTTTTTACTGG - Intergenic
1202442492 Y:24924079-24924101 GATTCCATTTTCCTTTTTACTGG + Intergenic