ID: 932308100

View in Genome Browser
Species Human (GRCh38)
Location 2:70718134-70718156
Sequence CCTACCAACTATTAGGTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 96}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932308100_932308105 20 Left 932308100 2:70718134-70718156 CCTCAAACCTAATAGTTGGTAGG 0: 1
1: 0
2: 0
3: 6
4: 96
Right 932308105 2:70718177-70718199 ATCCAGGAATTGGATTGTTGTGG 0: 1
1: 0
2: 3
3: 11
4: 194
932308100_932308107 29 Left 932308100 2:70718134-70718156 CCTCAAACCTAATAGTTGGTAGG 0: 1
1: 0
2: 0
3: 6
4: 96
Right 932308107 2:70718186-70718208 TTGGATTGTTGTGGCATGAATGG 0: 1
1: 0
2: 0
3: 13
4: 164
932308100_932308103 4 Left 932308100 2:70718134-70718156 CCTCAAACCTAATAGTTGGTAGG 0: 1
1: 0
2: 0
3: 6
4: 96
Right 932308103 2:70718161-70718183 GTTTTTCTGTTCTTCTATCCAGG 0: 1
1: 0
2: 1
3: 27
4: 388
932308100_932308104 10 Left 932308100 2:70718134-70718156 CCTCAAACCTAATAGTTGGTAGG 0: 1
1: 0
2: 0
3: 6
4: 96
Right 932308104 2:70718167-70718189 CTGTTCTTCTATCCAGGAATTGG 0: 1
1: 0
2: 1
3: 11
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932308100 Original CRISPR CCTACCAACTATTAGGTTTG AGG (reversed) Intronic
903109264 1:21115505-21115527 CCTAACAAATTTAAGGTTTGTGG - Intronic
907769687 1:57448183-57448205 TCTACAAACTATTAGGTTATTGG - Intronic
909047301 1:70726433-70726455 CCTACAAACTAGAAGATTTGGGG - Intergenic
910520826 1:88120520-88120542 CATACCATTTATTAGGTATGTGG + Intergenic
910956705 1:92714510-92714532 CCCACCAACTAGTAAGTCTGGGG - Intronic
913534792 1:119760923-119760945 CCTACCATTTATTAGCTATGTGG - Intronic
916445942 1:164871770-164871792 CCTTCCAACTCCGAGGTTTGGGG - Intronic
918211625 1:182356668-182356690 TCTACCACCCATTAGCTTTGGGG - Intergenic
918458532 1:184752806-184752828 TCTACCAATTACTAGCTTTGTGG + Intronic
921130386 1:212214842-212214864 CCTACCACCTGTAAGGTTAGCGG + Intergenic
924449736 1:244166686-244166708 CCCAGAACCTATTAGGTTTGAGG + Intergenic
1067231434 10:44413793-44413815 CCTTCCAACTTTTAGGTTCAGGG + Intergenic
1068200455 10:53777031-53777053 CCTACCAACTTTTATTTTTCAGG - Intergenic
1073189386 10:101640098-101640120 CCTACCAGGTATTAATTTTGTGG - Intronic
1077796065 11:5493543-5493565 CTTAACAACTATTAGATTTAAGG + Intronic
1081662218 11:44895112-44895134 CCTAATAACTACTAGGATTGAGG - Intronic
1087578546 11:100022683-100022705 CCTACCTACAATTATGTTGGAGG - Intronic
1087976357 11:104552649-104552671 ACTACCAACCATTGAGTTTGAGG + Intergenic
1092324183 12:7511763-7511785 CCTACCTACTAATACCTTTGAGG - Intergenic
1100283617 12:93142155-93142177 ACTACCAAGTAGTAGGTTTTAGG + Intergenic
1100948707 12:99820473-99820495 CCTACCAATTATAATGTTTATGG + Intronic
1105792994 13:23821098-23821120 CCTATCAACTATTATTTTTATGG + Intronic
1107339858 13:39394439-39394461 CCTTTCAACTATTACATTTGAGG - Intronic
1114581564 14:23765084-23765106 CCTCCCAAATATTAGATCTGAGG + Intergenic
1117229246 14:53698549-53698571 CCTAACATCTACTAAGTTTGGGG + Intergenic
1117671854 14:58116046-58116068 TCTTTCAACTTTTAGGTTTGGGG - Intronic
1119758766 14:77137079-77137101 GCTACCAACTGTTCGGATTGAGG + Intronic
1126895253 15:53250449-53250471 CCTGTCACTTATTAGGTTTGTGG - Intergenic
1126959519 15:53975853-53975875 CCAACCATCTATAAGTTTTGAGG + Intergenic
1139697555 16:68685860-68685882 CCTCCCAACTCTTGGGTTTTAGG - Intronic
1140966908 16:79975768-79975790 CCTACCATCTATTATTTGTGTGG - Intergenic
1141724316 16:85776547-85776569 CCTGCCAACTCTCAGGTATGTGG - Intronic
1155375924 18:25157710-25157732 CCTGCCAACTATTACCTGTGTGG + Intronic
1156278074 18:35603930-35603952 CTTTCCAACTTTTAGGTTCGGGG + Intronic
1156955165 18:42953862-42953884 CCTTCCAACTATTATGCTCGAGG + Intronic
1158236196 18:55317513-55317535 CCAACCAACTGTGAGGTTTGGGG + Intronic
1158342127 18:56477832-56477854 TCTGCCAAATATTTGGTTTGGGG + Intergenic
1158787705 18:60735612-60735634 CCTAGAAACTATGAAGTTTGGGG + Intergenic
1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG + Exonic
1162907539 19:13832723-13832745 CCTACCAACTCATAGGGCTGTGG - Intergenic
925996097 2:9294510-9294532 CCTACCAACTCTATGGTCTGGGG + Intronic
926966084 2:18413069-18413091 CTTACCAACTATGTGTTTTGGGG - Intergenic
932308100 2:70718134-70718156 CCTACCAACTATTAGGTTTGAGG - Intronic
936608167 2:113977904-113977926 CCTACCAGAAATTAGGTTTCAGG + Intergenic
937300109 2:120833751-120833773 CCTGCCAGCTAGCAGGTTTGGGG - Intronic
938212990 2:129484285-129484307 GCTAACAACTAATAGGTTAGAGG - Intergenic
938394706 2:130935394-130935416 TCTTCCATCTATTAGCTTTGGGG + Intronic
942660266 2:178256501-178256523 CCTACCAACTGCTGGGTTTTAGG - Intronic
944408828 2:199416453-199416475 CCTGCCAACTAGTAGATGTGTGG - Intronic
945487313 2:210412163-210412185 CCTTCCAACTTTTAGGTTCAAGG + Intergenic
946700605 2:222409229-222409251 CCAATCAACTTTTAGGTTTTAGG + Intergenic
947752900 2:232541973-232541995 CCTCCCCACACTTAGGTTTGAGG - Intronic
1173106637 20:40143303-40143325 CCTTCCAACTTTAAGGTTTTTGG - Intergenic
1173532537 20:43781464-43781486 CCCACCACCTGTTAGCTTTGTGG - Intergenic
1176235878 20:64053296-64053318 CCTCTCAACTGTTAGGTGTGGGG + Intronic
1178718243 21:34986306-34986328 CCTTTCAACTTTCAGGTTTGAGG - Intronic
1183101393 22:35586219-35586241 CCTACCACCTATGGGGTTGGAGG - Intergenic
1203294697 22_KI270736v1_random:30693-30715 CCTGCCACCTATTAGCTTTATGG - Intergenic
953017587 3:39093106-39093128 CCAACCAGCTGTTGGGTTTGTGG + Intronic
956968096 3:74487592-74487614 CCCACCAATTAATAGTTTTGGGG - Intronic
959500436 3:107100432-107100454 CCTAGCTTCTATTAGTTTTGAGG + Intergenic
960445698 3:117746252-117746274 CCTACCAACTAGGAGGCTTCTGG + Intergenic
961965783 3:130901308-130901330 TCTACCAACTTTTAGGATAGAGG - Intronic
963518730 3:146338668-146338690 CCCAGCAACTATTTGGTTTTGGG - Intergenic
966470789 3:180286581-180286603 TCTACCAATTTTTAGGTTTCAGG + Intergenic
967765360 3:193273055-193273077 CCTACAACCTATAAGGTTTCTGG - Intronic
971512086 4:27439035-27439057 TCTGCCAAATAGTAGGTTTGTGG + Intergenic
974241022 4:59247263-59247285 CCTACCAATTTTGAAGTTTGGGG + Intergenic
981082437 4:140648750-140648772 CCAACCAACAAATAGGTGTGTGG + Intronic
981220254 4:142223675-142223697 CCTACCAACTCCTAGTATTGAGG - Intronic
990942981 5:61222174-61222196 CCCACCAACTATTCTCTTTGAGG - Intergenic
992767395 5:80013697-80013719 TCTACCATTTATTAGGTTTGTGG + Intronic
993968063 5:94382195-94382217 TCTACCAACTATGGTGTTTGGGG - Intronic
994735930 5:103555926-103555948 CTTACCAACTCTTGGGTATGAGG + Exonic
1004606698 6:17201486-17201508 CCTACCTTCTACTGGGTTTGTGG - Intergenic
1007059402 6:38923812-38923834 CCTACCCACTTTTGGGTTTGGGG + Intronic
1010742934 6:79528632-79528654 CCTAGCAAGTATTTGGTTTCGGG - Intronic
1011862609 6:91778935-91778957 ACTACCTAGTATTAGGTTTGAGG + Intergenic
1014837882 6:126181327-126181349 ACTTCCAACTATTAGGGTTTGGG - Intergenic
1015537489 6:134281279-134281301 TCTACCACCTATTAGATGTGTGG + Intronic
1020833479 7:13120631-13120653 CCTTCCAACTATTTGGTTTTTGG + Intergenic
1026012837 7:66650223-66650245 CCCACAAACTATTGGATTTGAGG + Intronic
1029028190 7:97440282-97440304 CCTACCAACTTTTATGTTCATGG - Intergenic
1029105291 7:98170124-98170146 CCTACCATTTATTAGCTCTGTGG + Intronic
1038912949 8:31987731-31987753 CCTTCCAACTTTTAGGTTCAGGG - Intronic
1050043252 9:1517464-1517486 GCTACCAATAATTAGGTTTCTGG - Intergenic
1054251740 9:62724068-62724090 GCTGCCAACTATCAGGTTGGGGG - Intergenic
1058650347 9:107170090-107170112 CCTTCCAAGTGTTAGTTTTGGGG + Intergenic
1059796473 9:117702728-117702750 CCTACCAACCTTTAGTTTTCTGG - Intergenic
1188161367 X:26808010-26808032 CCTACCACCTGTTAGGATAGAGG - Intergenic
1188706225 X:33335118-33335140 CCTACAAACTATAACATTTGAGG - Intronic
1191670813 X:63746602-63746624 CTTAACTACTTTTAGGTTTGAGG + Intronic
1192085093 X:68088141-68088163 TCTACCACCTACTAGCTTTGGGG - Intronic
1193791359 X:85819248-85819270 ACAACCAACTATTCTGTTTGGGG - Intergenic
1194159693 X:90435403-90435425 CTTAGCAACTTTTAGTTTTGGGG + Intergenic
1194374746 X:93118260-93118282 CCTTCCAACTTTTAGGTTTAGGG - Intergenic
1197268009 X:124396671-124396693 ACTACCTACTACTGGGTTTGTGG + Intronic
1198056152 X:132997216-132997238 CTTACCACCTATTATCTTTGTGG - Intergenic
1199319133 X:146417732-146417754 CCTACCCACTATGAGTTTGGAGG + Intergenic
1199913407 X:152313063-152313085 CCTTCCAACTTTTAGGTTCAGGG - Intronic
1200505995 Y:4012369-4012391 CTTAGCAACTTTTAGTTTTGGGG + Intergenic
1200682769 Y:6232326-6232348 CCTTCAAACTTTTAGGTTTAGGG - Intergenic
1200878460 Y:8184935-8184957 CACACAAACTATTAGTTTTGTGG + Intergenic