ID: 932308514

View in Genome Browser
Species Human (GRCh38)
Location 2:70720899-70720921
Sequence CTCCCTTGCCTCCCTGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 467
Summary {0: 1, 1: 0, 2: 0, 3: 48, 4: 418}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932308503_932308514 29 Left 932308503 2:70720847-70720869 CCCTGCAGCCAAGGCAATTAAGA 0: 1
1: 0
2: 2
3: 13
4: 166
Right 932308514 2:70720899-70720921 CTCCCTTGCCTCCCTGCTGGAGG 0: 1
1: 0
2: 0
3: 48
4: 418
932308508_932308514 -3 Left 932308508 2:70720879-70720901 CCTTCTCCACTCCCTTTCTCCTC 0: 1
1: 1
2: 26
3: 271
4: 2241
Right 932308514 2:70720899-70720921 CTCCCTTGCCTCCCTGCTGGAGG 0: 1
1: 0
2: 0
3: 48
4: 418
932308509_932308514 -9 Left 932308509 2:70720885-70720907 CCACTCCCTTTCTCCTCCCTTGC 0: 1
1: 0
2: 36
3: 321
4: 2372
Right 932308514 2:70720899-70720921 CTCCCTTGCCTCCCTGCTGGAGG 0: 1
1: 0
2: 0
3: 48
4: 418
932308507_932308514 21 Left 932308507 2:70720855-70720877 CCAAGGCAATTAAGAGTGGAGGT 0: 1
1: 0
2: 0
3: 13
4: 130
Right 932308514 2:70720899-70720921 CTCCCTTGCCTCCCTGCTGGAGG 0: 1
1: 0
2: 0
3: 48
4: 418
932308502_932308514 30 Left 932308502 2:70720846-70720868 CCCCTGCAGCCAAGGCAATTAAG 0: 1
1: 0
2: 1
3: 22
4: 174
Right 932308514 2:70720899-70720921 CTCCCTTGCCTCCCTGCTGGAGG 0: 1
1: 0
2: 0
3: 48
4: 418
932308504_932308514 28 Left 932308504 2:70720848-70720870 CCTGCAGCCAAGGCAATTAAGAG 0: 1
1: 0
2: 1
3: 10
4: 164
Right 932308514 2:70720899-70720921 CTCCCTTGCCTCCCTGCTGGAGG 0: 1
1: 0
2: 0
3: 48
4: 418

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932308514 Original CRISPR CTCCCTTGCCTCCCTGCTGG AGG Intronic
900214706 1:1475295-1475317 CTTCCTGGCCTCACTGCTGGCGG + Intronic
900587861 1:3442077-3442099 CTGCCTGCCATCCCTGCTGGTGG + Intergenic
900826083 1:4928072-4928094 CTCCCTTTCCTGGCTGCTGTGGG - Intergenic
900981543 1:6048829-6048851 CTCCCTTCCCTCCATGCGCGTGG - Intronic
901137567 1:7007787-7007809 CTCCCTGGCCTCTCTTCTGGAGG - Intronic
901438511 1:9263764-9263786 CTCCATTTCCTTCCAGCTGGAGG - Exonic
901559453 1:10058660-10058682 CACCCTTGCCCACCTGCAGGCGG - Intronic
901626887 1:10629735-10629757 CCCCCTCGCCTTCCTCCTGGGGG - Exonic
902570119 1:17341923-17341945 CTCCCCTGCCTCTCTCCTAGGGG + Exonic
902623609 1:17664428-17664450 CTCCCCTCTCTCCCTGCAGGAGG + Exonic
903327595 1:22579915-22579937 CTTTCCTGCCTGCCTGCTGGGGG - Intronic
903741183 1:25559604-25559626 CTACCTGGCCTCCCTGCTTCAGG + Intronic
903773456 1:25778391-25778413 CTCCCTTCGCTCACTGCTGCCGG - Intronic
903875940 1:26472932-26472954 TTCCCTCCCCTCCCTGCGGGCGG + Intronic
904044583 1:27602180-27602202 CTCCCCTCCCTCCCAGCTTGGGG - Intronic
904379669 1:30102219-30102241 CTGCCCTGACTCCCTGCTGAGGG + Intergenic
904612635 1:31733802-31733824 CTCCCTGGCCTCCCTGCCAGGGG + Intronic
905030116 1:34876618-34876640 CTCCCTGGCCTGTCTGCTGCAGG - Intronic
905099726 1:35509075-35509097 ATCCCTTGGCTTTCTGCTGGAGG + Intronic
905365601 1:37449639-37449661 CTCCACTGTCTCCCTGCAGGAGG - Intergenic
905394895 1:37660831-37660853 ATCTCTCCCCTCCCTGCTGGTGG + Intergenic
906125038 1:43422555-43422577 CTCCCTGACCTCTCTGCTGCGGG + Exonic
906380419 1:45328888-45328910 CTGCCTTGCCTTTCTCCTGGGGG + Intergenic
907333534 1:53686366-53686388 CCCCCTAGCCTCTCTGATGGAGG + Intronic
907513338 1:54978599-54978621 CTCCCTTCCCTACCCGCTTGAGG + Intergenic
907524577 1:55046707-55046729 TGGCCTGGCCTCCCTGCTGGTGG + Intronic
907911963 1:58834807-58834829 CCCCCTTGCCTGCCTGCAGCAGG - Intergenic
908252078 1:62273491-62273513 GTCTCCTCCCTCCCTGCTGGGGG + Exonic
908356129 1:63326263-63326285 CCACTTTGCCTCCCTGGTGGTGG + Intergenic
908398977 1:63752471-63752493 CTCCCTGGGCTCTGTGCTGGTGG + Intergenic
908809234 1:67962371-67962393 CTCCCTTGCCTTCCAGCTTTTGG - Intergenic
909685755 1:78346587-78346609 CTTCCTTGGCTCAGTGCTGGTGG - Intronic
910747449 1:90588974-90588996 TTCCCATGGGTCCCTGCTGGTGG - Intergenic
912718096 1:111996288-111996310 TTTCCTTTCCTCCCTACTGGAGG - Intergenic
914758239 1:150578898-150578920 CTCCAGCGCCTTCCTGCTGGTGG + Exonic
915082238 1:153360133-153360155 CTCCCTTCCCTTCCCTCTGGAGG - Intronic
915471365 1:156127388-156127410 CTCACTTCCCTCTCTGCTCGTGG + Intronic
915478997 1:156172466-156172488 CTGCCAGGCCTCCTTGCTGGAGG + Intronic
916166925 1:161973006-161973028 CTCCCTAGCCTGGTTGCTGGAGG - Intergenic
916684005 1:167128160-167128182 CTCTCTGCCCTCCCTGGTGGAGG - Exonic
917578961 1:176354821-176354843 TACCCTTACCTCCCTTCTGGAGG + Intergenic
919540105 1:198835312-198835334 CTTCCTTGCCTCCCTCATGGGGG - Intergenic
919937566 1:202264718-202264740 CTTCCCTGTCTCCCTCCTGGAGG + Intronic
920564934 1:206965734-206965756 CTTCCTCGCCCCTCTGCTGGCGG - Exonic
920853697 1:209646720-209646742 CTCTCCTGCCTGCCTCCTGGTGG - Intronic
921075853 1:211699530-211699552 CTGCCCTTCTTCCCTGCTGGAGG + Intergenic
921298348 1:213725530-213725552 CCCTCTTGCCTTCCTGCTGTGGG + Intergenic
922592347 1:226786861-226786883 CTCCCCTTCCTCCCTGGAGGAGG + Intergenic
923109176 1:230877299-230877321 CTCGCCTGCATCCCTGCTGAGGG - Intergenic
923957488 1:239039432-239039454 CTTCCTTACCTCCCTTGTGGAGG - Intergenic
1063095643 10:2906345-2906367 ACCCTTGGCCTCCCTGCTGGAGG + Intergenic
1064348450 10:14554485-14554507 CTCTCCTGCCTCCCTTCTGTTGG - Intronic
1067070007 10:43124362-43124384 CTCCCTGGGCCCCCAGCTGGTGG + Intronic
1068503109 10:57865016-57865038 CTGCGTTTTCTCCCTGCTGGAGG + Intergenic
1069757320 10:70781338-70781360 CTCCCATCCCTCCCCACTGGAGG + Intronic
1069777372 10:70934865-70934887 CTCCCCAGCCTGCCTGCTGGAGG - Intergenic
1069798284 10:71067054-71067076 GTCCCCTGCCTCCCTGGGGGAGG + Intergenic
1069915933 10:71786852-71786874 CTCCCTTGCCTGGCTTCAGGAGG + Intronic
1069994703 10:72335261-72335283 CTCCATTTCCTCCTAGCTGGAGG + Exonic
1071430653 10:85603817-85603839 CTCCCAGGCCACCCTGCAGGTGG + Intronic
1071451099 10:85791981-85792003 CTCCCTGGCCTCCTGCCTGGGGG - Intronic
1071598198 10:86942980-86943002 CGCCTTCGCCGCCCTGCTGGAGG - Exonic
1073440917 10:103552235-103552257 GTCTGTTGCCTCCCTGCTGCAGG + Intronic
1074445114 10:113515146-113515168 CTCCCTTCCCTCCCTGCCTCTGG + Intergenic
1074465841 10:113680198-113680220 CTCCCTTCCCTCCTAGCCGGGGG + Intronic
1074855057 10:117467274-117467296 CTCCCTGGCCTCGCTGTAGGTGG + Intergenic
1075147779 10:119897176-119897198 CCCTCTTACCTCCTTGCTGGAGG - Intronic
1075440850 10:122478319-122478341 GTACCTTGCCTCCCTGCAGGTGG + Intronic
1075672283 10:124270781-124270803 CCCCCTTCCCTACCTGATGGGGG + Intergenic
1076168287 10:128299725-128299747 CTCCCTCTCCTCCTTGCTGCAGG + Intergenic
1076325252 10:129615920-129615942 CTCCCTTGCTCCCCAGCTTGGGG - Intronic
1076411078 10:130251280-130251302 TTCCCTGCCCTCCCTGATGGAGG - Intergenic
1076725247 10:132410119-132410141 CTCCCTGTCCTCACAGCTGGAGG - Intronic
1078354606 11:10624611-10624633 CTTCCTTTCCTCCCTTCTCGGGG - Intronic
1078735499 11:14016121-14016143 CTTCCTAGATTCCCTGCTGGTGG + Intronic
1079373517 11:19871909-19871931 CTGCCTTGCCTCCTTGGTGAGGG + Intronic
1079705235 11:23607466-23607488 CTCCCTTTCCTCCCAGCTTCTGG - Intergenic
1080555433 11:33411900-33411922 TTCTCTTGCCTCCCTTGTGGAGG + Intergenic
1080839413 11:35970429-35970451 CTTCCTTGCCTGGCTTCTGGAGG - Intronic
1081867550 11:46367829-46367851 CTCCCTGGCACCCCTGCTGTGGG + Intronic
1082014046 11:47471086-47471108 CTCCCTTGCCTCCTTGATTGAGG - Intronic
1083198727 11:61106509-61106531 GTCCCTTCATTCCCTGCTGGAGG - Intronic
1083527504 11:63383180-63383202 CTCCCTTCCCTCCCTCCTGAGGG - Intronic
1084161968 11:67355019-67355041 CTCCTCTGCCTCCCCTCTGGTGG - Intronic
1084267061 11:68010533-68010555 CTCATCTGCCTGCCTGCTGGGGG + Intronic
1084695951 11:70755708-70755730 CTGCCTGGCGTCCCTGCTTGTGG - Intronic
1084775203 11:71370296-71370318 CTCACTGGCCTCCCTGATGATGG + Intergenic
1085528115 11:77175730-77175752 CACCCCTGCCTCCCTGCTGTGGG - Intronic
1087369161 11:97259535-97259557 CTCACTGATCTCCCTGCTGGTGG - Intergenic
1088250641 11:107858544-107858566 CACCTCTGCCTCCCTGCTGGGGG + Intronic
1089189774 11:116645205-116645227 TTCCCTGGCCTGCCTGCTGCGGG - Intergenic
1089455076 11:118621344-118621366 CTCCCTTCCCCCGCCGCTGGTGG + Intronic
1089493571 11:118897871-118897893 CTCCCACCCCTCCCTGCAGGCGG - Exonic
1089695848 11:120215926-120215948 CTCCCTATCCTCCCTGATGCTGG - Intronic
1089752391 11:120660926-120660948 CTCCCTTGCCTTGTTGCTGTGGG + Intronic
1090025386 11:123163132-123163154 CTCCCTTGCCTCTTTGCTTAGGG - Intronic
1090077295 11:123587462-123587484 TGCCCTTGGCTCCCTGCTGAAGG - Intronic
1090377879 11:126304145-126304167 CTCCTTTTCCTCTGTGCTGGCGG - Exonic
1091352938 11:134912277-134912299 GTCCCTTTCCTTGCTGCTGGTGG + Intergenic
1091948149 12:4567791-4567813 CTCCCTTGCTTCCCTTCTGATGG - Intronic
1091964290 12:4724844-4724866 CTCCCCTGCTTCCCTCTTGGGGG + Intronic
1092462710 12:8699907-8699929 CTGCCTTGCCCCCCCGCAGGGGG + Exonic
1093990447 12:25584017-25584039 CTCCATTGCCACCATTCTGGAGG - Intronic
1095195799 12:39315216-39315238 TTCCCCTGCCTACCTTCTGGAGG + Exonic
1096617841 12:52844391-52844413 CTGCATCGCCTCCCTCCTGGAGG + Intronic
1096717453 12:53499805-53499827 GCCCCGCGCCTCCCTGCTGGCGG + Intronic
1098135574 12:67398192-67398214 CTTCCTTGCCTGCCTGCTTCTGG + Intergenic
1098403211 12:70095702-70095724 CTCTTTTGCCTGTCTGCTGGTGG + Intergenic
1098972142 12:76867996-76868018 TTCTCTTGCCTCTCTTCTGGTGG + Intronic
1099440090 12:82687890-82687912 CTCCCTTGCTTCTCGGCTGTTGG + Intronic
1100089533 12:90953914-90953936 GTCTCTTGCCCCGCTGCTGGTGG - Exonic
1101642873 12:106601231-106601253 CTCTCCTGGCTCCCTGCCGGTGG - Exonic
1102058716 12:109915932-109915954 CTCCCCTCCCTCCCTCCTGTGGG + Intronic
1102221474 12:111197776-111197798 CTCCTATGGCTCCCTGGTGGTGG - Intronic
1102986295 12:117281089-117281111 CTCCCATGCCACCATGCTGAAGG + Intronic
1103593140 12:122006360-122006382 CTGCCTTGCCACCCTACTGCTGG - Intergenic
1103716942 12:122950387-122950409 CTCCCTTCCCTCCCTGGTGCAGG + Intronic
1103984881 12:124760578-124760600 TTGCGTTGTCTCCCTGCTGGAGG - Intergenic
1103986209 12:124769062-124769084 CTCTCTCCCCTCACTGCTGGAGG - Intergenic
1104053834 12:125214530-125214552 ATCCCTTCCCTCCCTGCTCCAGG - Intronic
1104181485 12:126386090-126386112 CTCCCTGTGCTTCCTGCTGGAGG - Intergenic
1104323236 12:127771967-127771989 TTCCCTTCCCTCCTTGGTGGTGG - Intergenic
1104877288 12:132044335-132044357 CCCTCTTGCCCCCCTGCTGAGGG + Intronic
1105027143 12:132856879-132856901 CTCACTTGCCTGGGTGCTGGTGG + Intronic
1106144483 13:27039410-27039432 CTCCCTTGCCTCTCAGCAGGTGG - Intergenic
1106207465 13:27613266-27613288 CACCCTCCCCTCCCTGCTGCAGG - Intronic
1108111843 13:47082116-47082138 CTTCATTTCCTCCCTCCTGGGGG - Intergenic
1108510016 13:51147857-51147879 GACCCGTTCCTCCCTGCTGGAGG - Intergenic
1108556235 13:51595573-51595595 CTGCCATGGCTGCCTGCTGGTGG + Intronic
1108907733 13:55500437-55500459 CTCCCTTTGGTCCCTGCAGGTGG + Intergenic
1111678414 13:91415056-91415078 CTACCTTGCCTCCCTGTTGCTGG + Intronic
1113376620 13:109770118-109770140 CTCCCTGCCCTCCATGGTGGTGG - Intronic
1113448442 13:110388213-110388235 CTCGCTTGCCGCCGTCCTGGAGG - Intronic
1113448612 13:110389513-110389535 CAGCATTGCCTCCCTGCAGGAGG + Intronic
1113698749 13:112366951-112366973 CTCCCTTGTCACCATCCTGGTGG - Intergenic
1114670403 14:24408009-24408031 CCCCCCTGGCTCCCTGATGGTGG + Exonic
1117106049 14:52398025-52398047 CTCTCTTGCCTTCCTGTTGGTGG - Intergenic
1117348150 14:54854362-54854384 CTTCCTGCCCTCCCTGCTGCAGG - Intronic
1118875923 14:69784865-69784887 CTCCCCTTCCCGCCTGCTGGAGG - Intronic
1118908038 14:70037216-70037238 CTCCCTAGCCACCCTGATGCTGG + Intergenic
1119318939 14:73718188-73718210 CTCCCTTTGCTGCTTGCTGGCGG - Exonic
1119330818 14:73792280-73792302 CTCCCTTTCTGGCCTGCTGGGGG + Intergenic
1119893077 14:78197615-78197637 CTCCCTTGCTTCCTTCCTGGTGG + Intergenic
1121728592 14:96170928-96170950 CACCCTTGCCTCCCTGCCATCGG + Intergenic
1121774225 14:96579785-96579807 CTCCACTGCTTCCCAGCTGGTGG - Intergenic
1121777628 14:96600862-96600884 CTCCCCCACTTCCCTGCTGGCGG + Intergenic
1122359743 14:101152198-101152220 CTCCATGGTCTCACTGCTGGAGG + Intergenic
1122893781 14:104745217-104745239 CTCCCGTGGCTCCCTGCAGGTGG - Intronic
1124200278 15:27673479-27673501 CACCCTTGACTCTCTCCTGGGGG + Intergenic
1125597286 15:40894998-40895020 CTCTCTTGGCCCCCAGCTGGTGG + Intronic
1126100144 15:45113810-45113832 TTCCCTTCCCTGCCTCCTGGAGG - Intronic
1126453246 15:48833507-48833529 CTCCCCTCCCTCCCTTCTGAAGG + Intronic
1128112807 15:65087207-65087229 CTTCCTTGAATCCCTTCTGGCGG + Intergenic
1128142185 15:65310039-65310061 CCCTCTTCCCTCCATGCTGGGGG + Intergenic
1129246753 15:74283529-74283551 ATCCCTTTCCTTCCAGCTGGCGG + Intronic
1129253435 15:74320824-74320846 CTCCCTCGCCTGCCCTCTGGTGG + Intronic
1129300204 15:74621057-74621079 CTTCCCTGCCTCCCTCCTGCCGG + Intronic
1129656435 15:77528092-77528114 CTCCTTGGCCTGTCTGCTGGGGG + Intergenic
1129778659 15:78254339-78254361 CTCCCTGACCACCCTGGTGGAGG + Intergenic
1131095165 15:89649927-89649949 CTCCCCAGCCTCCCTCCTTGAGG - Exonic
1131248787 15:90817722-90817744 CTCACTTGCCATCCTTCTGGAGG + Intergenic
1131511351 15:93051127-93051149 GGCCCTTGCCTGCCTGCAGGGGG - Intronic
1131985815 15:98042114-98042136 TTCCCTTCCATCCCTCCTGGGGG + Intergenic
1132828041 16:1914604-1914626 CTCCTCTTCCTGCCTGCTGGAGG + Intronic
1132846619 16:2003774-2003796 CTCCGTTGCATCCCAGGTGGGGG - Intronic
1133262198 16:4558186-4558208 CTCCCTTGCCCACCAGCTGCTGG - Intronic
1134245564 16:12537102-12537124 GTCCCTTTCCTCCCAGCTGTTGG + Intronic
1134567354 16:15263067-15263089 CTCCGTTGCCTACCAGCTGCAGG + Intergenic
1134735138 16:16493633-16493655 CTCCATTGCCTACCAGCTGCAGG - Intergenic
1134932383 16:18218584-18218606 CTCCGTTGCCTACCAGCTGCAGG + Intergenic
1136088463 16:27902223-27902245 CTCCTTTTCCTCCTGGCTGGTGG - Intronic
1136500020 16:30665365-30665387 CTCCTTTGGCTCCCTGCAGGGGG + Exonic
1137441012 16:48498455-48498477 CTCCATTTCCACCCTGGTGGGGG - Intergenic
1138150095 16:54648875-54648897 CTCCTTTTCCTCCCTGCGTGTGG - Intergenic
1138658509 16:58504068-58504090 CTGCCTTGCCTGCCCTCTGGGGG + Intronic
1139877858 16:70160766-70160788 CTCCCTTGCCACCGTCTTGGTGG + Exonic
1140478936 16:75252177-75252199 CTCGCCAGCCTCCCTGCTTGAGG - Intronic
1140719566 16:77759031-77759053 GGGCCTTGCCTCCCTGTTGGTGG - Intergenic
1140812073 16:78588088-78588110 AACCCTTGCCTTCCTGCTGGCGG + Intronic
1141300873 16:82814399-82814421 CTCCCTTTCCTCCCTGGAGGTGG - Intronic
1141816339 16:86412094-86412116 CTCTCTCGCCTTCCTGATGGAGG - Intergenic
1142141893 16:88476233-88476255 CTGCACAGCCTCCCTGCTGGGGG + Intronic
1143585572 17:7848703-7848725 ATCCTTGGCCTCCGTGCTGGAGG + Exonic
1143586333 17:7852412-7852434 GCCCCTTCCCTCACTGCTGGCGG - Intronic
1143680153 17:8470319-8470341 GTGCCGTTCCTCCCTGCTGGTGG + Intronic
1144783041 17:17817337-17817359 CCCCTTGGCCTCCTTGCTGGGGG - Exonic
1145053426 17:19681807-19681829 CTCCCTTTCTTCCCTGAGGGTGG + Intronic
1146261973 17:31427822-31427844 CTCCCCTGCAGCCCTGCAGGTGG + Intronic
1146478471 17:33182162-33182184 CACCCCTGCCTCCCTGCTCCAGG - Intronic
1147566459 17:41539249-41539271 CCCCCGTGCCTCCCTGGTGCTGG - Intergenic
1147577225 17:41609813-41609835 CTCCCCTGCTCCTCTGCTGGTGG - Exonic
1148212504 17:45817034-45817056 GTCCCCTGCCTCCTGGCTGGAGG - Intronic
1148903372 17:50895314-50895336 TTCGCTTGCCTCCTTACTGGGGG + Intergenic
1149494056 17:57105973-57105995 CTTCCTTGGCACCCTGCTGAAGG - Exonic
1149642885 17:58215872-58215894 CTCCCTTCTCTGCCTGCTAGAGG - Intronic
1150248223 17:63691642-63691664 CTCCTTTGCTGCCATGCTGGGGG + Intronic
1150633655 17:66898028-66898050 CTCCGTTATCTCCCTGCTCGGGG + Intergenic
1150643826 17:66965912-66965934 CTCCGCAGCCTCCCTGCTGAGGG - Intronic
1151558615 17:74859610-74859632 CTAGCTTGCCCCACTGCTGGGGG + Intronic
1151786521 17:76277887-76277909 ATGCCTTGCCCCACTGCTGGGGG - Intronic
1151973143 17:77469380-77469402 CACCCTTGCCTCCTAGCTGCAGG - Intronic
1152237377 17:79145578-79145600 CGCCCTGGCCTTCCTTCTGGGGG + Intronic
1152421689 17:80196771-80196793 CTCCTCTGCTTCCCAGCTGGTGG - Intronic
1152688989 17:81708970-81708992 GGCCCTTTCCTCCCTGCCGGGGG + Intergenic
1152792903 17:82291840-82291862 CTCTCGTGCCTGCCTGCTTGAGG + Intergenic
1153342447 18:3989163-3989185 CTAGCTTGCGTCCTTGCTGGTGG + Intronic
1153468674 18:5417889-5417911 CTGCCTCACCTCCATGCTGGAGG - Intronic
1155859171 18:30874966-30874988 CTCTTTTGCCTCCTTGCTGCAGG - Intergenic
1156471238 18:37378332-37378354 CTCCCTGGCCTCCCTTCTGTGGG - Intronic
1157229364 18:45899730-45899752 CTCTTTAGCCTCTCTGCTGGGGG - Intronic
1157481089 18:48054261-48054283 CGCCCTTCCCTCCCTGCTCCAGG - Intronic
1157527267 18:48393304-48393326 CCCCCTTGGCTCCCTTCTGCAGG + Intronic
1158536330 18:58311449-58311471 CCCCCTGGGCTCCCAGCTGGGGG + Intronic
1160086243 18:75780007-75780029 CTCTCTCCCCTCCCTGCAGGTGG + Intergenic
1160989646 19:1855318-1855340 CTCCCATGCCCCCTTGCTCGTGG - Intronic
1161216394 19:3096971-3096993 CAACCTTGCATCCCAGCTGGAGG + Intronic
1161566613 19:5006140-5006162 CTTCCTTCCATCCCTGCTGCAGG + Intronic
1161723784 19:5917215-5917237 CACCCTTCCCACCCTGCTGTGGG - Exonic
1161812783 19:6479987-6480009 CTGCCCTGCCTCCCTGCAGGAGG - Exonic
1161963367 19:7534941-7534963 CTCCCGTGCCTCCCAGCTCCTGG + Intronic
1162556701 19:11391156-11391178 CCCCCTTTCCTCCCTCCTGCTGG - Intronic
1162728312 19:12702773-12702795 CACCCCTGCCTGCCTTCTGGAGG - Intronic
1163007672 19:14406684-14406706 CTCCCTTCCCTCCTAGCTGCTGG + Exonic
1163496430 19:17648752-17648774 CTCCCCTGCCTCCACGCTGTCGG + Intronic
1163509653 19:17727181-17727203 CTCTCCGGCCTCCCAGCTGGTGG + Exonic
1165099327 19:33429176-33429198 CAGCCCTGCATCCCTGCTGGAGG + Intronic
1165300042 19:34963084-34963106 CTCCTTGGCATCCCTGCTTGCGG + Intronic
1166224001 19:41383765-41383787 CCGCCGTGCCTTCCTGCTGGGGG + Exonic
1166365513 19:42276406-42276428 CTCCCTGGTCTCCCTGCTTCTGG - Intronic
1166704893 19:44903256-44903278 CTCCCTTCCCTCCCCCCTTGGGG + Exonic
1166760436 19:45220950-45220972 CTCCCTTCCCTCCCCACAGGTGG - Intronic
1167112403 19:47470013-47470035 CTCCCTTGCCGCCCCACTGTGGG - Intronic
1167278143 19:48551294-48551316 CTCCAGTGCCTCCCAGCTGTGGG - Intergenic
1167409625 19:49337250-49337272 TTCCCTCTCCTCCCTGCTGGGGG - Intronic
1168637069 19:58004476-58004498 TGCCCTTGGCTGCCTGCTGGAGG - Intronic
925097900 2:1222510-1222532 CTCCCTGTCCTGCCTGCTGCTGG + Intronic
925097912 2:1222580-1222602 CTCCCTGTCCTGCCTGCTGCTGG + Intronic
925097925 2:1222650-1222672 CTCCCTGTCCTGCCTGCTGGTGG + Intronic
925097935 2:1222720-1222742 CTCCCTGTCCTGCCTGCTGCTGG + Intronic
925097947 2:1222790-1222812 CTCCCTGTCCTGCCTGCTGCTGG + Intronic
925097959 2:1222860-1222882 CTCCCTGTCCTGCCTGCTGCTGG + Intronic
925097972 2:1222930-1222952 CTCCCTGTCCTGCCTGCTGGTGG + Intronic
925097984 2:1223000-1223022 CTCCCTGTCCTGCCTGCTGCTGG + Intronic
925097996 2:1223070-1223092 CTCCCTGTCCTGCCTGCTGCTGG + Intronic
925098008 2:1223140-1223162 CTCCCTGTCCTGCCTGCTGCTGG + Intronic
925098020 2:1223210-1223232 CTCCCTGTCCTGCCTGCTGCTGG + Intronic
925098030 2:1223280-1223302 CTCCCTGTCCTGCCTGCTGCTGG + Intronic
925663200 2:6224485-6224507 CACCATGACCTCCCTGCTGGGGG - Intergenic
925730996 2:6919098-6919120 CTCCCTCCCTTCCCTCCTGGGGG - Intronic
926136030 2:10337186-10337208 CTCCCTGGCCTCCCTATGGGAGG - Intronic
927649808 2:24905581-24905603 TGCCCTTGCCTCCCTGGTTGGGG - Intronic
927854013 2:26516696-26516718 CACCCTTGCCTCACTGGAGGAGG + Intronic
928511646 2:32009674-32009696 TTCCCTGCCCTCCCCGCTGGCGG - Intronic
931224537 2:60318627-60318649 CTCCCTCCCCGCCCTGCTGCAGG + Intergenic
931748343 2:65309863-65309885 GTTCCTTCCTTCCCTGCTGGTGG - Intergenic
932263390 2:70345612-70345634 CTCCCTTGTCTTCCTGCTATGGG + Intergenic
932308514 2:70720899-70720921 CTCCCTTGCCTCCCTGCTGGAGG + Intronic
933405956 2:81859776-81859798 CTCACTTGCCTCTTAGCTGGAGG - Intergenic
933574958 2:84056931-84056953 CTTCCTTCCCTACTTGCTGGAGG + Intergenic
934729277 2:96646493-96646515 CACCCTTGCCCCCTTGCTGTTGG - Intergenic
935857266 2:107288635-107288657 CTCTCCTTCCTCCCTGCTGTAGG - Intergenic
936529213 2:113263724-113263746 CCCTCATGCCTGCCTGCTGGGGG - Intronic
937345753 2:121124404-121124426 CTGCTTTGCATGCCTGCTGGAGG + Intergenic
940871815 2:158867020-158867042 TTCCCTTGCCTCTTTGCGGGGGG - Intergenic
942014121 2:171793760-171793782 CTCCCTTGCCTACAGGCTGGAGG - Exonic
945111815 2:206367139-206367161 CTACCTTGCCTCCCTGTTGCTGG - Intergenic
945936162 2:215904696-215904718 CTGCATTGCCTCGCTTCTGGAGG - Intergenic
946967749 2:225055795-225055817 CTGCCTTGCTTCCCAGCTGGAGG - Intergenic
947808354 2:232983522-232983544 CTCCCTGGCTTCCCTCCTGCAGG - Intronic
948446563 2:238038103-238038125 TTCTCTTGCCTCCCTGTCGGAGG - Intronic
948449576 2:238060877-238060899 CAGCCTCGCCTCCCCGCTGGGGG + Exonic
948529723 2:238596784-238596806 CTCCCTTCCTCCCGTGCTGGTGG + Intergenic
948595821 2:239078763-239078785 CCCCGTGGCATCCCTGCTGGCGG - Intronic
948680902 2:239634075-239634097 CTCCCTTGCCTCCCCAGTGAGGG - Intergenic
948680923 2:239634135-239634157 CTCCCTTGCCTCCCCAGTGAGGG - Intergenic
948796611 2:240406129-240406151 GTCCCTTGCCTGCCTGGTGTGGG - Intergenic
948993375 2:241565513-241565535 CATCCTTGCCTCCCTGCCTGAGG + Intronic
1168990171 20:2088201-2088223 CTCCCTTTCCTCCCTGCACCCGG + Intergenic
1169138198 20:3210354-3210376 TCCCCTTTCTTCCCTGCTGGGGG + Intronic
1170039170 20:12022332-12022354 CTCCCCTGCCTCCCATCTGTAGG + Intergenic
1171391331 20:24803407-24803429 CTGCCTGCCCTCCCTGCAGGAGG + Intergenic
1172167464 20:32907839-32907861 CTCCCATTCCTCCCAGGTGGAGG - Intronic
1172310340 20:33913245-33913267 CTCCCTCTACTCCCCGCTGGAGG + Intergenic
1172666150 20:36601708-36601730 CTCCCGTGCTTCCCCTCTGGTGG + Intronic
1173329600 20:42063387-42063409 GTCCCTTGAGGCCCTGCTGGGGG + Intergenic
1174018206 20:47506372-47506394 TTCCCTTTCCTACCTTCTGGTGG + Intronic
1174506822 20:51022716-51022738 CGCCCTGGCCTCCCCGCAGGCGG + Intronic
1175273062 20:57748543-57748565 CTCCCTGGTCTTCCTGGTGGGGG + Intergenic
1175399955 20:58694361-58694383 CTCCCTGCACTCCCTGGTGGCGG + Intronic
1175427107 20:58875285-58875307 CCTCCTTACCTCCCTGCAGGTGG + Intronic
1175658684 20:60793615-60793637 GCCCCTTGCCTCCCAGCTGAGGG - Intergenic
1176315924 21:5243784-5243806 CTGCCTTGCTTTCCTCCTGGCGG - Intergenic
1177180415 21:17738999-17739021 CTCCCCTCCCTCCCTGGTGTTGG + Intergenic
1178417036 21:32412577-32412599 CTCCGTTGCCGCCGTGCCGGAGG - Exonic
1179105719 21:38398560-38398582 CTCCCATGCCGCTCTGATGGTGG - Intronic
1180080811 21:45486851-45486873 CTCCCTTGCTCCCCTGCGTGGGG - Exonic
1180099067 21:45575910-45575932 TTCACTTCCCTCCCTGCAGGTGG + Intergenic
1180131754 21:45831107-45831129 CTGACTTGCCTCCCTGCAGCTGG + Intronic
1180205335 21:46256119-46256141 CTCCCTGGCCTCCCAGTGGGTGG - Intronic
1180749237 22:18112976-18112998 TTCACTTCCCTCCCTGGTGGGGG + Intronic
1180953694 22:19731872-19731894 CTCCTCTACCTCCCTGTTGGGGG - Intergenic
1180972206 22:19821603-19821625 CACCCTTCCCCCACTGCTGGGGG + Intronic
1180998530 22:19977280-19977302 CTTCCCTGCCTGCCTGTTGGGGG + Intronic
1181157147 22:20930171-20930193 CTTCCTTGCTTCCCTGGTGAGGG - Intronic
1181560428 22:23696738-23696760 CTCCCTTCCCCGCCAGCTGGAGG + Intronic
1181631223 22:24152533-24152555 CTTACCTGCCTCCCTGCTGTGGG - Intronic
1182944555 22:34309812-34309834 CTTCATTTCCTCCCTGCTGAAGG - Intergenic
1183265568 22:36823198-36823220 CTCTCTGGCCTCCCAGCTGGTGG + Intergenic
1183368135 22:37417916-37417938 CCCCCTCGCCTCCCTGCAGAAGG - Exonic
1183522427 22:38303252-38303274 GTCCCTTGCCTCCCTGCCCCGGG - Intronic
1184841192 22:47053252-47053274 CTTCCTTGCCTGCCTGCAGGTGG + Intronic
1185180188 22:49355517-49355539 CTTCCATTCCTCCCTGCGGGAGG - Intergenic
1185383462 22:50521058-50521080 CGCCCATCCCTCCCTGCCGGGGG - Intronic
950181576 3:10917378-10917400 CTCCATGGCATCCCTGCGGGTGG - Intronic
952925449 3:38316450-38316472 TTCCCTCTCCTCCCTGCTGCCGG + Exonic
953412443 3:42697945-42697967 CACCCTGGGGTCCCTGCTGGAGG + Intronic
953449223 3:42992180-42992202 CTCACTTCCCTCCCTGGCGGTGG + Intronic
953729993 3:45439088-45439110 CTCCCTTGAAGCCCTGTTGGGGG + Intronic
954039049 3:47870633-47870655 CTACCCCGCCTCCCTGCTGCTGG + Intronic
954314285 3:49792813-49792835 CACCCTTCCCACCCTGCTGAGGG + Intronic
954375683 3:50193065-50193087 CCTCCTGGCCTCCTTGCTGGAGG + Intronic
954442916 3:50531463-50531485 TTCCCTAGCCTCCCTGGTGATGG - Intergenic
954579857 3:51697336-51697358 CTCCCTAGCTTCCCTTCTGGAGG - Intronic
955134029 3:56198430-56198452 CTCCCTGGCCTCCCTGCTTCAGG - Intronic
955391380 3:58524738-58524760 CTGCCTGGCCTCCCTCCTGAGGG + Intronic
955485513 3:59430624-59430646 CAGCCTCGCCTCCCTGCAGGAGG - Intergenic
955977094 3:64489701-64489723 CTCTCTTGCTTCCCTGGTGGAGG + Intergenic
956399473 3:68861749-68861771 TTCCCTTTTCTCCCTGCTTGTGG - Intronic
956557905 3:70542116-70542138 CTGCCTATCCTCCCTGCTGTTGG + Intergenic
957671047 3:83303195-83303217 CTCCCTTGCCTTTCTGATTGTGG - Intergenic
960051896 3:113247178-113247200 CTCCCTTCCTTCCCTTCTTGGGG + Intronic
961179103 3:124862236-124862258 TTCCGTTGCCACCCTGGTGGTGG - Intronic
961389971 3:126546627-126546649 CTGCCTTGGTTCCCTGATGGGGG - Intronic
961473281 3:127131861-127131883 CTCCCATCCCTCCCTGCTCTGGG - Intergenic
961622757 3:128237839-128237861 CTCCTTTGGCTCCCTCCTGCAGG + Intronic
961721855 3:128902534-128902556 CTCCCTGTTCTCCCTGCAGGTGG + Exonic
961989022 3:131167812-131167834 CTCCCTTTGCTCCTTGCTGATGG - Intronic
963035089 3:141019209-141019231 CTCCCTTGCCTCCTGTGTGGAGG + Intergenic
963489695 3:145983915-145983937 TTCCCTTCCCTCCCTCCTGAGGG - Intergenic
964436496 3:156658955-156658977 CACCCTTGCCTCACTGCTTGTGG + Intergenic
967778046 3:193404984-193405006 CTCTCATGCCTCTCAGCTGGAGG + Intronic
967955878 3:194876895-194876917 CTCCCTTCCCACCTGGCTGGGGG + Intergenic
969078127 4:4596775-4596797 ATCCCTTACCTCTCTGCTGGAGG + Intergenic
969267541 4:6074309-6074331 CTCCCTGGACTCCCTGCAGGAGG - Intronic
969318342 4:6395470-6395492 CTCCCTTTCCTCCCTCCTTGTGG + Intronic
969429259 4:7144791-7144813 CTGCCTCCACTCCCTGCTGGTGG + Intergenic
975299669 4:72775025-72775047 CTCCCTAGCCTCCCTTCCTGAGG - Intergenic
976485549 4:85599143-85599165 CTCCTCTCCCTCACTGCTGGAGG - Intronic
979091593 4:116489990-116490012 CTCCCTTGCCTACTTGCTTCTGG + Intergenic
979491653 4:121335394-121335416 ATCCCTTGCCAGCCCGCTGGAGG + Intronic
979588660 4:122451017-122451039 TTCCCTTGACTCCCTCCTTGTGG - Intergenic
980478619 4:133355711-133355733 CTCCCTTGCTTCCTGGCTTGTGG + Intergenic
981730004 4:147887245-147887267 CTGCCTTTCCTCCCTGCCTGTGG + Intronic
981915137 4:150024947-150024969 CACCCTGGCCTGCCTGCTGCAGG - Intergenic
981938259 4:150256308-150256330 CTCGCCGGCCTCCCTGCTGCAGG + Exonic
982106807 4:152018373-152018395 CTCCACTGCCTCCCTGCTCCTGG + Intergenic
985498190 5:222881-222903 CTCCCCTGCCTGGCTGCTGCTGG - Intronic
985768583 5:1795130-1795152 CTTCCCTGCCTCCCTGCGAGTGG - Intergenic
985940406 5:3131291-3131313 CTCCCCTGCCTGCCAGCGGGTGG + Intergenic
987003961 5:13689988-13690010 CTCCCTTGCCTACCTGACTGTGG + Intergenic
987042676 5:14077584-14077606 CAGCCTTGCCTCCCTTCAGGGGG - Intergenic
987070846 5:14335520-14335542 CTCGCATGCCTTCCTGTTGGAGG + Intronic
988099535 5:26659386-26659408 CTCTCTTGCCTGCCTTCTAGGGG - Intergenic
988629618 5:32914824-32914846 CTGCCTTTCCTCCCTGGTGCTGG - Intergenic
989715532 5:44458207-44458229 CTCCCTTTCCATCCTGGTGGGGG - Intergenic
990951258 5:61300650-61300672 TTCCCTTGCCTACCTGCAGCAGG + Intergenic
991156329 5:63440685-63440707 CTCCCTTGACCCCCTCCTGTTGG + Intergenic
993645946 5:90462236-90462258 CTCCATTTCCTCTCTGCTGTCGG - Intronic
994072912 5:95621205-95621227 CTACTTTGCCGCCCGGCTGGCGG + Exonic
995047454 5:107669142-107669164 CTCTCTTGCCTGCATGCTGAGGG + Intronic
995886319 5:116898323-116898345 CTCCCATTCCTGCCTGCTGCTGG + Intergenic
996336300 5:122387551-122387573 CTCTCTTGCCTCCCAGCTGCTGG + Intronic
997346389 5:133195449-133195471 CTGCCTGGCCTCCTGGCTGGGGG + Intergenic
998040203 5:138946676-138946698 CTGCCTTACCTCACAGCTGGGGG + Intergenic
998368766 5:141647919-141647941 CTCCTTTCCCTCCCTGCTGAGGG + Intronic
998802835 5:145888166-145888188 TTCCCTCTCCTCCCTGCAGGTGG - Intergenic
999776284 5:154815152-154815174 CTCTCTTGCCTCCAGGATGGAGG - Exonic
1000884436 5:166735209-166735231 CTTCCTTGCCTGCCTGCCTGTGG - Intergenic
1005134824 6:22556115-22556137 CCCCCTTGCATCCCTTCTGCAGG - Intergenic
1006294821 6:33165642-33165664 CTCACTCGACTCCCTGCGGGAGG - Exonic
1006357370 6:33567892-33567914 CACCCTCCCCACCCTGCTGGGGG + Intergenic
1006424926 6:33957974-33957996 CTCCCTTCCTCCCCTGCTGGTGG - Intergenic
1006630567 6:35427288-35427310 CTCCCTTCCCTCCCTGAGGCAGG + Exonic
1006910193 6:37558615-37558637 GGGCCTTGCCTCCCTGCTGAGGG + Intergenic
1007217257 6:40250031-40250053 CTCTCTTGCCACCCTCCTGCTGG + Intergenic
1009371503 6:62908955-62908977 CTTCCTTGCCCCCCAGCTTGCGG + Intergenic
1012633680 6:101507801-101507823 GCCCCTTGCCTCCCTTCTGGGGG - Intronic
1014741768 6:125154611-125154633 CTCCCGGGGCTGCCTGCTGGAGG + Intronic
1014875123 6:126648968-126648990 CTCCTCTATCTCCCTGCTGGTGG - Intergenic
1017041669 6:150313263-150313285 CTCCCTTGCCTCTGTGCTAAAGG - Intergenic
1017082468 6:150682706-150682728 CTGCTTTGCCTCCCTCCTGCAGG - Intronic
1017707736 6:157139493-157139515 CTCCCTGGCCCGCCTGCAGGGGG + Intronic
1017852219 6:158314547-158314569 CGCCCTGGCCTCCCTACTGCTGG - Intronic
1019258763 7:68185-68207 CTCACTGGCCTCCCTGCTCCTGG + Intergenic
1019568022 7:1694268-1694290 CACACTGGCCTCCCTGCGGGTGG + Exonic
1019616599 7:1965775-1965797 CTCCCTGTCCTCCCTCCTGCAGG + Intronic
1019695936 7:2446173-2446195 CTCCCTTCCAGCCCTGCTGCTGG - Intergenic
1019922149 7:4169794-4169816 CTGCCCTCCCTCCCTGCGGGAGG + Intronic
1021533251 7:21673508-21673530 CACCCTTCCCTCCTAGCTGGAGG - Intronic
1022253910 7:28636441-28636463 ATCCCCTGCCTCCCTCCTTGAGG + Intronic
1023596106 7:41830627-41830649 CTTCCTTGCCGGCCAGCTGGTGG + Intergenic
1023979006 7:45055163-45055185 CTCCCTGGCCTCCCTGTGGCTGG - Intronic
1024824192 7:53370412-53370434 CGCCAGTGGCTCCCTGCTGGAGG - Intergenic
1029577600 7:101413732-101413754 GTCCCTTGCCATCCTGATGGAGG + Intronic
1030157223 7:106467537-106467559 CTCCCTTGACCCTCTGCTAGAGG - Intergenic
1033121677 7:138671948-138671970 CTCCCTTTCCTCCATCCTGCAGG - Intronic
1033527022 7:142226158-142226180 ATCCCCTTCCTCACTGCTGGAGG + Intergenic
1033667299 7:143453662-143453684 CTCACTTGAACCCCTGCTGGAGG + Intergenic
1033868517 7:145721222-145721244 CTTTCTTGCCTCTCTGCTTGTGG - Intergenic
1034105568 7:148486872-148486894 CTCCCTTCCCACCCTGCCGCGGG + Intergenic
1034557227 7:151858002-151858024 CTCCTTTCCCCCACTGCTGGTGG + Intronic
1035020746 7:155798635-155798657 CTCTCATGCCTCCCTGCATGAGG + Intergenic
1035114960 7:156516838-156516860 CTCCCTTGTTTCCAGGCTGGAGG + Intergenic
1035368429 7:158363168-158363190 TCCCCTTGCCTCTCTGGTGGAGG - Intronic
1035898001 8:3425643-3425665 CTCTCTGGGCTCCCTGCTGCTGG - Intronic
1036903880 8:12691576-12691598 TTCCCTTGCCTCTTTGTTGGGGG + Intergenic
1037763500 8:21757334-21757356 CTCATATGCCTGCCTGCTGGGGG - Intronic
1037862008 8:22412071-22412093 CTCCCTCTGCTCCCTCCTGGGGG + Intronic
1037908516 8:22729423-22729445 CTCCCTTGCCTCACTCTGGGTGG - Intronic
1038523147 8:28250553-28250575 CCCCCTGGCCTCCCTGCAAGAGG - Intergenic
1038779443 8:30557637-30557659 CTCCTCTGCCACCCTGCGGGAGG + Intronic
1040856901 8:51957989-51958011 CTCCTTTGTCTCTCAGCTGGTGG + Intergenic
1041331708 8:56733569-56733591 CTCCCTTCCTTCCTTTCTGGGGG - Intergenic
1041548665 8:59076035-59076057 CTCCCTTCCCTCCCTCATGTAGG - Intronic
1041811797 8:61919639-61919661 CTTCCCTCCCTCCCTGTTGGTGG - Intergenic
1044326008 8:90859125-90859147 CTCTCTTCCCTCACTGCTGCTGG - Intronic
1047583512 8:126243346-126243368 CTGCCTGTCCTCCCTGCTTGTGG - Intergenic
1048223471 8:132564101-132564123 ATCCCCTGACCCCCTGCTGGTGG - Intergenic
1048428540 8:134344947-134344969 CTACCTGGCCTCCCTGCTTCTGG - Intergenic
1048589687 8:135809947-135809969 CTCTCTTGCCTCCCTGGAGGTGG + Intergenic
1049056473 8:140241051-140241073 GTCACCTGCATCCCTGCTGGTGG + Intronic
1049423045 8:142525265-142525287 CTCTCCTGCCTCCCGCCTGGAGG - Intronic
1049766401 8:144357271-144357293 CTCTGATACCTCCCTGCTGGAGG + Intronic
1051126712 9:13813106-13813128 CTTCCTTCTCTCCCTCCTGGTGG - Intergenic
1051398703 9:16656239-16656261 CTCCCTTTCCTCCATTCTCGAGG - Intronic
1051793172 9:20831859-20831881 CTCCCATACCTCCCTGCTTTAGG + Intronic
1052319352 9:27150899-27150921 CACCCTTGTCTGTCTGCTGGAGG - Intronic
1053144304 9:35702018-35702040 CTCCCTGGTCTCCCTGCTTCTGG - Intronic
1053399028 9:37801135-37801157 CTCCCTCCCCTCCGTGCCGGCGG + Exonic
1053605883 9:39658336-39658358 CTGCCTGGCCACCCTGCAGGAGG - Intergenic
1053863800 9:42414960-42414982 CTGCCTGGCCACCCTGCAGGAGG - Intergenic
1054561778 9:66718605-66718627 CTGCCTGGCCACCCTGCAGGAGG + Intergenic
1056821187 9:89843188-89843210 TTCCCCTGCCTCCCTGATTGGGG + Intergenic
1057311819 9:93947882-93947904 CTCCCTTACCTCCCTACAGTGGG + Intergenic
1057326074 9:94065363-94065385 CTCCCTTGGCTAACTGCCGGTGG - Intronic
1057937586 9:99253858-99253880 CCACCTTGCCTCCCTGCAGTTGG + Intergenic
1058629765 9:106974467-106974489 CACCTTTGCCTCCCTCCAGGTGG - Intronic
1060010811 9:120041461-120041483 CTCCCGTGTGTCCCTGCTGGAGG + Intergenic
1060102948 9:120856406-120856428 CACCTTCGCCTTCCTGCTGGCGG + Exonic
1060212521 9:121719281-121719303 CTTCTGTGCCTCTCTGCTGGGGG + Intronic
1060880641 9:127115892-127115914 CTCCCTGGCCTCCGGGCTGATGG - Intronic
1061067121 9:128285486-128285508 CTCCATTCTCTCCCTGCAGGTGG + Intronic
1061298977 9:129693957-129693979 CTGCCTTCACTCCCTGCTGGGGG - Intronic
1061394173 9:130334214-130334236 CTCCCCTGCATCCCTGCATGGGG - Intronic
1061596749 9:131635555-131635577 CTCCAGTCCCTCCCAGCTGGGGG + Intronic
1062711700 9:137978329-137978351 CACCCTTCACTCCCTCCTGGGGG - Intronic
1186870236 X:13764469-13764491 CCCACTTCCCTCCCTGCGGGTGG + Intronic
1190265637 X:48826209-48826231 CTCCCTTGCTTTCCTGTTGGTGG - Intergenic
1190949375 X:55127800-55127822 CTTCCTTGTCTCCTTGATGGTGG - Intronic
1192202104 X:69073012-69073034 CACCATTGCCTCCCTCCTGGAGG + Intergenic
1192369787 X:70503875-70503897 CTCCCTCGCCTCCATACTGGAGG + Exonic
1195652927 X:107304514-107304536 CTCCTTTCCCTCCTTCCTGGGGG - Intergenic
1198314912 X:135455480-135455502 CTCAGTTGCCTATCTGCTGGTGG - Intergenic
1199537436 X:148918665-148918687 CTCCCTTTCCTTCCTCCTGGAGG - Intronic
1199971498 X:152865241-152865263 CTCCTTTGCCCCCCAGCTGCTGG + Intronic
1200164500 X:154026847-154026869 CTCCCGGCCCTGCCTGCTGGTGG - Intronic
1200759993 Y:7028843-7028865 CTCCCTTGCTTCTCTGCTCCTGG - Intronic