ID: 932308514

View in Genome Browser
Species Human (GRCh38)
Location 2:70720899-70720921
Sequence CTCCCTTGCCTCCCTGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 467
Summary {0: 1, 1: 0, 2: 0, 3: 48, 4: 418}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932308508_932308514 -3 Left 932308508 2:70720879-70720901 CCTTCTCCACTCCCTTTCTCCTC 0: 1
1: 1
2: 26
3: 271
4: 2241
Right 932308514 2:70720899-70720921 CTCCCTTGCCTCCCTGCTGGAGG 0: 1
1: 0
2: 0
3: 48
4: 418
932308503_932308514 29 Left 932308503 2:70720847-70720869 CCCTGCAGCCAAGGCAATTAAGA 0: 1
1: 0
2: 2
3: 13
4: 166
Right 932308514 2:70720899-70720921 CTCCCTTGCCTCCCTGCTGGAGG 0: 1
1: 0
2: 0
3: 48
4: 418
932308507_932308514 21 Left 932308507 2:70720855-70720877 CCAAGGCAATTAAGAGTGGAGGT 0: 1
1: 0
2: 0
3: 13
4: 130
Right 932308514 2:70720899-70720921 CTCCCTTGCCTCCCTGCTGGAGG 0: 1
1: 0
2: 0
3: 48
4: 418
932308504_932308514 28 Left 932308504 2:70720848-70720870 CCTGCAGCCAAGGCAATTAAGAG 0: 1
1: 0
2: 1
3: 10
4: 164
Right 932308514 2:70720899-70720921 CTCCCTTGCCTCCCTGCTGGAGG 0: 1
1: 0
2: 0
3: 48
4: 418
932308502_932308514 30 Left 932308502 2:70720846-70720868 CCCCTGCAGCCAAGGCAATTAAG 0: 1
1: 0
2: 1
3: 22
4: 174
Right 932308514 2:70720899-70720921 CTCCCTTGCCTCCCTGCTGGAGG 0: 1
1: 0
2: 0
3: 48
4: 418
932308509_932308514 -9 Left 932308509 2:70720885-70720907 CCACTCCCTTTCTCCTCCCTTGC 0: 1
1: 0
2: 36
3: 321
4: 2372
Right 932308514 2:70720899-70720921 CTCCCTTGCCTCCCTGCTGGAGG 0: 1
1: 0
2: 0
3: 48
4: 418

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932308514 Original CRISPR CTCCCTTGCCTCCCTGCTGG AGG Intronic