ID: 932308757

View in Genome Browser
Species Human (GRCh38)
Location 2:70723123-70723145
Sequence CAGGCTCTGAATGGCATTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 117}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932308750_932308757 5 Left 932308750 2:70723095-70723117 CCACCATACAGGACCATGGCTAC 0: 1
1: 0
2: 0
3: 3
4: 94
Right 932308757 2:70723123-70723145 CAGGCTCTGAATGGCATTAAGGG 0: 1
1: 0
2: 0
3: 8
4: 117
932308753_932308757 -8 Left 932308753 2:70723108-70723130 CCATGGCTACAAATCCAGGCTCT 0: 1
1: 1
2: 4
3: 61
4: 629
Right 932308757 2:70723123-70723145 CAGGCTCTGAATGGCATTAAGGG 0: 1
1: 0
2: 0
3: 8
4: 117
932308747_932308757 19 Left 932308747 2:70723081-70723103 CCAGGGAATTGGTTCCACCATAC 0: 1
1: 0
2: 0
3: 7
4: 60
Right 932308757 2:70723123-70723145 CAGGCTCTGAATGGCATTAAGGG 0: 1
1: 0
2: 0
3: 8
4: 117
932308751_932308757 2 Left 932308751 2:70723098-70723120 CCATACAGGACCATGGCTACAAA 0: 1
1: 1
2: 0
3: 7
4: 93
Right 932308757 2:70723123-70723145 CAGGCTCTGAATGGCATTAAGGG 0: 1
1: 0
2: 0
3: 8
4: 117
932308746_932308757 20 Left 932308746 2:70723080-70723102 CCCAGGGAATTGGTTCCACCATA 0: 1
1: 0
2: 0
3: 6
4: 100
Right 932308757 2:70723123-70723145 CAGGCTCTGAATGGCATTAAGGG 0: 1
1: 0
2: 0
3: 8
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932308757 Original CRISPR CAGGCTCTGAATGGCATTAA GGG Intronic
900303497 1:1989883-1989905 CAGGCCCTGAAGGACACTAAGGG - Intronic
900858149 1:5202786-5202808 CATGCACCGAATTGCATTAAGGG - Intergenic
906724004 1:48030453-48030475 CAGGCTCTGGATGCCCTTGAAGG + Intergenic
909726630 1:78843934-78843956 CAGGCTATGAAAGGCTTGAATGG + Intergenic
911519958 1:98917465-98917487 CAAGCCATGAATGGCTTTAAGGG - Intronic
917734281 1:177906507-177906529 CAGGATCTGAAGGGCATTCCTGG - Intergenic
918082126 1:181215763-181215785 CGGGCTGTGAATGGAAGTAATGG + Intergenic
921978125 1:221225690-221225712 CAGGCTCAGAATAGTATCAAAGG - Intergenic
922643012 1:227255028-227255050 AAGGCTTTGAATTTCATTAAAGG + Intronic
922737658 1:227997019-227997041 CATGCACTGAATGGCATTGATGG + Intergenic
923302588 1:232655662-232655684 CATGCTGTGAATGGCTTCAAAGG + Intergenic
923743722 1:236681571-236681593 AATACACTGAATGGCATTAAGGG - Intergenic
1064136389 10:12754305-12754327 CAGGGTGTGAATGGCTTTGAGGG - Intronic
1068379509 10:56232407-56232429 GAGGCTCTGGAGGGAATTAAAGG - Intergenic
1070566481 10:77607130-77607152 AAGGCTCTGAATGTCAGAAAAGG + Intronic
1073224331 10:101904238-101904260 CAGGCTCTTCGTGGCATTAAAGG - Intronic
1075922918 10:126227930-126227952 CAGGATATGAATGGTATGAAAGG - Intronic
1077739519 11:4829965-4829987 CAGGCTCTGAATCACAGTGACGG - Intronic
1078671345 11:13368507-13368529 CAGGCTCGGATTGGCATTCTAGG + Intronic
1081942192 11:46953141-46953163 CAGGTTGTTAGTGGCATTAAGGG + Intronic
1083997695 11:66280165-66280187 CAGGCTCTGGGTGGCTTTGAGGG + Intronic
1084177255 11:67429335-67429357 CTGGCTCTGAATCCCATTAGAGG - Intronic
1087656702 11:100932452-100932474 CAGGCTCTCCATGGAATTACAGG - Intronic
1096209082 12:49748620-49748642 GAGGCTCTGAATGAAATTAGAGG + Intronic
1096569598 12:52514356-52514378 GAGTCTCTGGAGGGCATTAACGG - Intergenic
1101112867 12:101503581-101503603 GAGGCACTGAAAGGCATTTACGG + Intergenic
1104069427 12:125331280-125331302 CAAGCTCTGAATTGCATTCCAGG + Intronic
1107467460 13:40664473-40664495 CACGCTCTGAAAGGCAAAAATGG + Intronic
1108009817 13:45994454-45994476 CTGGATTTGAATAGCATTAAAGG - Intronic
1110693136 13:78455646-78455668 CAGGCTCTGAATGCAATCATTGG - Intergenic
1112902058 13:104368890-104368912 CAGGCTTGGGAAGGCATTAAAGG + Intergenic
1113314229 13:109161654-109161676 CTGGCTCTGGATGGGAATAAGGG - Intronic
1114639517 14:24210004-24210026 CAGGCTCTGAATGTCATAGCAGG - Intronic
1119220261 14:72900680-72900702 CATGCTCTGAATTGATTTAAAGG + Intergenic
1125501653 15:40243479-40243501 AATGCTCTGAATGGCATGACTGG + Intronic
1127214687 15:56811863-56811885 CAGAGTCTGAATGGCATTCTTGG - Intronic
1127294168 15:57595242-57595264 AAAGCTCTGAAAGGCATTTATGG + Intronic
1130627732 15:85533284-85533306 CAGGCTCTGAATGTCAACAAGGG - Intronic
1134778232 16:16871565-16871587 CAGTTTCTGAAAGGAATTAAAGG + Intergenic
1138844534 16:60549363-60549385 GAGGCTAGGAATGGTATTAAGGG - Intergenic
1142692169 17:1613223-1613245 CTGGCTCTGAATGGCTTTGGTGG - Exonic
1152873911 17:82774842-82774864 CAGGGTCTGAATGCAATTACTGG + Intronic
1153199823 18:2636469-2636491 CAAGCTCTGATTAGAATTAAGGG + Intergenic
1155148924 18:23106932-23106954 GAAGCTTTGAATGGCATAAATGG - Intergenic
1156576600 18:38324108-38324130 CAAGCTCTGAATAGCACAAAAGG + Intergenic
1157447936 18:47760500-47760522 AATGCACTGAATGGGATTAATGG + Intergenic
1157641083 18:49215486-49215508 CTGGATCTGGATGGCAATAAGGG - Intronic
1157710146 18:49844430-49844452 TAGGCTCAGAATGGCAATGAAGG + Intronic
1158459002 18:57631496-57631518 TAGGATATAAATGGCATTAATGG + Intergenic
1163456128 19:17406643-17406665 CTGGCTCTAAGTGGCTTTAATGG - Intronic
1166485547 19:43208281-43208303 CAGGCTCTGGATGGCATGTGAGG - Intergenic
1167621844 19:50565089-50565111 CTGTCTCTGAGTGGGATTAAGGG + Intronic
926960688 2:18355499-18355521 CAGGTTGTGAAGGGCATTAGAGG - Intronic
932308757 2:70723123-70723145 CAGGCTCTGAATGGCATTAAGGG + Intronic
934502321 2:94870644-94870666 CTGGCCCTGAATGGCTTTGAGGG + Intergenic
935783050 2:106524724-106524746 CAGGCTCTGAGTGGAATTTCCGG + Intergenic
936392080 2:112084418-112084440 CAACCTCTGAATGGCAAAAAGGG + Intronic
936655695 2:114484128-114484150 CAGCCTCTGCATGCCATTATTGG - Intronic
942998518 2:182295554-182295576 CAGGCCCTGAATGGTATCTACGG + Intronic
1169429884 20:5526717-5526739 CAGGCTCAGAAAGGAATAAAAGG + Intergenic
1170223725 20:13967627-13967649 CTGGTTCTGTCTGGCATTAAGGG + Intronic
1174720867 20:52810846-52810868 CAGTCTCAGAATGGCTTTCAAGG + Intergenic
1174877828 20:54246729-54246751 CAGGCTCTGAATAGAACAAAAGG - Intergenic
1178880025 21:36442018-36442040 CTTGCTCTTATTGGCATTAATGG - Intergenic
1184635967 22:45831853-45831875 CAGGCTCTGGGTGGGCTTAAAGG - Intronic
950157989 3:10738355-10738377 CTTGCTCTGAAAGGCATTATCGG + Intergenic
951681836 3:25303049-25303071 CAGGCTCTGATGGCCATCAAGGG - Intronic
951834441 3:26966051-26966073 CAGGCTCTTAATTGTAATAAAGG - Intergenic
954464738 3:50647791-50647813 CAGGCTGTCACTGACATTAAGGG + Intronic
954964145 3:54595947-54595969 TGGGCTCTGAGTGGCATTCAAGG - Intronic
957191318 3:77013534-77013556 AAGGCTCTGACCGTCATTAAAGG + Intronic
957441109 3:80249254-80249276 CAAGCTCAGAGTGGCATTGAAGG + Intergenic
959225661 3:103580832-103580854 AAGGCTCTGATTAGCATTAATGG + Intergenic
961718167 3:128873164-128873186 CAGGCCCCGAATGTCATGAAGGG - Intergenic
961971052 3:130968659-130968681 CAGGCTCTTCTTGGCCTTAAAGG - Intronic
962252915 3:133848947-133848969 CAGGCCCTGAACAGCATTATAGG - Intronic
963029388 3:140952402-140952424 CAGCCTCTGAAAGGGATTACAGG + Intronic
964485642 3:157182920-157182942 CAGCCTCAGAAAGGCATTATGGG + Intergenic
973272882 4:48279415-48279437 CAGGATCTGACTGACATTTACGG + Intergenic
974846349 4:67355015-67355037 AAGGATCTGAATAGAATTAAAGG - Intergenic
975758877 4:77598396-77598418 CAGGCTCTGAAAGGGACGAAGGG - Intronic
978937665 4:114397917-114397939 CAGAGTCTGGCTGGCATTAATGG + Intergenic
984357516 4:178682585-178682607 CAGGCTAGGAATGGCATCTAAGG + Intergenic
987254137 5:16131999-16132021 CAGTCTCTGAACGGCACTCATGG - Intronic
991083446 5:62625701-62625723 CAAGCTCTGAATGACATTCAAGG - Intronic
991136502 5:63187650-63187672 GAGGCTTGGAATGGCATAAATGG + Intergenic
993631411 5:90290527-90290549 CAGGCTCTCAATGGTGTAAAAGG - Intergenic
993807005 5:92423433-92423455 CAGTCTCAGAATGTCATTTATGG + Intergenic
995349781 5:111161809-111161831 CAAGATCTGAATGGTTTTAAAGG + Intergenic
996537283 5:124591756-124591778 CATGCTATGAATGGCATTTGGGG - Intergenic
998396146 5:141819609-141819631 CAGGCTCTGGATTGCCTAAAAGG - Intergenic
1001795135 5:174495864-174495886 GAGCCTCTGAATGGATTTAAAGG - Intergenic
1003639167 6:7862279-7862301 CATGCTTTGATTTGCATTAAAGG + Exonic
1005809539 6:29505591-29505613 CAGGCTCTGGGTGGCTTTATGGG + Intergenic
1006608503 6:35277348-35277370 CAGGGTCTGATAGGGATTAATGG - Intronic
1007991706 6:46262688-46262710 AAGGCTCTGCTTGGCATTAAAGG + Intronic
1011042543 6:83046931-83046953 CAGGCAGTGAAAGGAATTAAGGG + Intronic
1013996685 6:116317046-116317068 CAGGGTCAGACTTGCATTAAGGG - Intronic
1016090283 6:139969633-139969655 TAGACACTGAATGGCATGAATGG - Intergenic
1018557153 6:165061509-165061531 CAGGCTCTGAATCTCCTTAAAGG - Intergenic
1018929353 6:168230231-168230253 CAGTCTCTGTCTGGCTTTAATGG + Intergenic
1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG + Intronic
1030913878 7:115288096-115288118 CAAGCTCTGAAAGGCACTATTGG - Intergenic
1032611023 7:133413878-133413900 CAGACTCTGAATAACTTTAAAGG + Intronic
1032662589 7:134001751-134001773 CAGGCTCTGAAGGCCATGTAGGG - Intronic
1033389108 7:140909126-140909148 CAGCCTCTGAATTACATTTAAGG - Intronic
1033710535 7:143938484-143938506 TAGTGTCTAAATGGCATTAATGG - Intergenic
1033915634 7:146321854-146321876 CAGCCTCTGTATGGGATTAGTGG + Intronic
1040023518 8:42761460-42761482 CAGGCTTTGAAGGGCAGTTAGGG - Intronic
1040577956 8:48670745-48670767 CAAACTCTGAATGTGATTAATGG + Intergenic
1041541842 8:58993679-58993701 CAGTCTCTGAATGAGATCAAGGG + Intronic
1041779132 8:61558243-61558265 CAAGCTCTGAAAGGTATTTAGGG + Intronic
1042363466 8:67909010-67909032 TAGACTCAGAATGGCATTCATGG + Intergenic
1048456888 8:134586602-134586624 CAGGCTTGGAATGGCATTCATGG - Intronic
1050564608 9:6869252-6869274 TGGGCCATGAATGGCATTAAGGG + Intronic
1051022583 9:12562402-12562424 CTGGCTCTCCATGTCATTAATGG + Intergenic
1058451254 9:105098550-105098572 CAGGCTCTGGAAAGCATTTAAGG - Intergenic
1059182930 9:112236771-112236793 GAGCCTTTAAATGGCATTAAGGG + Intronic
1060437455 9:123606422-123606444 CAGCCTTTGAAGGGCGTTAAGGG - Intronic
1061175920 9:128996879-128996901 CATTCTCTTAATGGCATTAGTGG + Intronic
1189258102 X:39655947-39655969 CAGTTTCTGAATGCTATTAAGGG + Intergenic
1190304521 X:49074435-49074457 AAGGCCCTTAATGGCATTTACGG - Intronic
1198884456 X:141319053-141319075 CAATCTCTGAATAGCATTTAAGG + Intergenic
1198914542 X:141653641-141653663 CGTGCTCTGAAGGGCAGTAAGGG - Intronic
1199111657 X:143942535-143942557 CAAGGTCTCAGTGGCATTAAAGG - Intergenic
1200148965 X:153942170-153942192 CAGGCTCAGAGGGGCATTTAAGG + Intronic