ID: 932312562

View in Genome Browser
Species Human (GRCh38)
Location 2:70755382-70755404
Sequence TGCTTTAGCCAGAGTGGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1980
Summary {0: 2, 1: 6, 2: 26, 3: 228, 4: 1718}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932312562_932312571 22 Left 932312562 2:70755382-70755404 CCCTGACCACTCTGGCTAAAGCA 0: 2
1: 6
2: 26
3: 228
4: 1718
Right 932312571 2:70755427-70755449 GAGTTTATCTTCTGCATAATGGG 0: 1
1: 0
2: 2
3: 23
4: 268
932312562_932312570 21 Left 932312562 2:70755382-70755404 CCCTGACCACTCTGGCTAAAGCA 0: 2
1: 6
2: 26
3: 228
4: 1718
Right 932312570 2:70755426-70755448 TGAGTTTATCTTCTGCATAATGG 0: 1
1: 0
2: 3
3: 23
4: 253
932312562_932312565 -8 Left 932312562 2:70755382-70755404 CCCTGACCACTCTGGCTAAAGCA 0: 2
1: 6
2: 26
3: 228
4: 1718
Right 932312565 2:70755397-70755419 CTAAAGCAGCCTCCTCCCTCAGG 0: 1
1: 0
2: 2
3: 25
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932312562 Original CRISPR TGCTTTAGCCAGAGTGGTCA GGG (reversed) Intronic
900016284 1:152464-152486 TGCTTTAGCCTAGGAGGTCAAGG + Intergenic
900046548 1:511055-511077 TGCTTTAGCCTAGGAGGTCAAGG + Intergenic
900068751 1:752773-752795 TGCTTTAGCCTAGGAGGTCAAGG + Intergenic
900170998 1:1268759-1268781 TGCTTGAGCCGAGGTGGTCAAGG - Intronic
900252832 1:1680215-1680237 TGCTTGAACAAGAGAGGTCAAGG + Intronic
901258740 1:7855783-7855805 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
901378857 1:8859438-8859460 TGCTTGAGCCCCAGAGGTCAAGG - Intergenic
901395648 1:8979391-8979413 TGCTTGAGCCAGGGAGGTGAAGG + Intergenic
901434918 1:9241485-9241507 TGCTTGAGCCCGAGAGGTCCAGG - Intronic
901504771 1:9677559-9677581 CGCTTGAACCAGGGTGGTCAAGG + Intronic
901693642 1:10990654-10990676 TGCTTGAGGCAGGGAGGTCAAGG + Intergenic
901699337 1:11035810-11035832 TGCTTGAGCCTGAGAGGTCAAGG + Intronic
901780226 1:11589281-11589303 TGCTTGAGCCAGGGAGTTCAAGG + Intergenic
901826669 1:11866434-11866456 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
902129971 1:14251730-14251752 TGCTTGAGCCCAAGAGGTCAAGG - Intergenic
902258438 1:15206150-15206172 TGCTTAAGCCTGGGAGGTCAAGG + Intronic
902307618 1:15554117-15554139 TGCTTCAGCCCGGGAGGTCAAGG + Intronic
902464813 1:16609993-16610015 TGCTTGAGCCTGAGAGATCAAGG + Intronic
902519518 1:17008224-17008246 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
902528016 1:17071750-17071772 TGCTTTGGCCAGTGGGATCAGGG + Intronic
902641130 1:17767077-17767099 GACTTTGGCCACAGTGGTCAGGG + Intronic
902708754 1:18224415-18224437 TTCTTTAGCCAGAGGGGCCCTGG - Intronic
902731353 1:18371761-18371783 TGCTTTAGATAGAGTGTTCAAGG - Intronic
902811838 1:18892451-18892473 TGCTTCAGCCAGGGTGGTCAGGG + Intronic
902898626 1:19497605-19497627 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
902900931 1:19515533-19515555 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
902938860 1:19785194-19785216 TACTGTAGCCTGGGTGGTCAGGG - Intronic
903114616 1:21168504-21168526 TGCTTGAGCCCGGGAGGTCAAGG - Intronic
903117137 1:21187614-21187636 TGCTTGAGCCTGAGAGATCAAGG + Intergenic
903119034 1:21202443-21202465 CACTTGAGCCTGAGTGGTCAAGG - Intergenic
903155986 1:21443695-21443717 TGCTTGAGCCTGAGAGATCAAGG - Intronic
903312219 1:22468003-22468025 TGCTTCAGCCCAGGTGGTCAAGG + Intronic
903322561 1:22551777-22551799 GGCTGGAGCCACAGTGGTCACGG + Intergenic
903374597 1:22858040-22858062 TGCTTTAGCCAGGGTGGTCAGGG + Intronic
903654757 1:24942494-24942516 TACTTTAGACAGGGTGGTCAGGG + Intronic
903699574 1:25236549-25236571 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
903954328 1:27014481-27014503 TGCTTGAGCCAGGGTGGTTGAGG - Intergenic
903991983 1:27278793-27278815 TACTTTAGATATAGTGGTCAGGG - Intronic
904096414 1:27981692-27981714 TGCTTGAGCCAGGGAGGTCGAGG + Intronic
904136532 1:28316867-28316889 TGCTTGAACCCGAGAGGTCAAGG - Intergenic
904178315 1:28647369-28647391 TGCTTGAGCCAGGGAAGTCAAGG - Intergenic
904195122 1:28779633-28779655 TGCTTTAGCCCAGGAGGTCAAGG + Intergenic
904205895 1:28855159-28855181 TACTTTAGATAGAGTGGTCAGGG + Intronic
904502514 1:30923801-30923823 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
904531804 1:31174995-31175017 TACTTTAGAGAGAGTGGGCAGGG - Intergenic
904581401 1:31546806-31546828 TACTTTAGGTAGAGGGGTCAGGG + Intergenic
904830284 1:33302003-33302025 TGCTTGAGCCTGGGAGGTCAGGG + Intergenic
904936956 1:34137654-34137676 TGCTTTAGCCAGGTTGGGCCAGG - Intronic
905035744 1:34917429-34917451 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
905142453 1:35858857-35858879 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
905160393 1:36028123-36028145 TGCTTGAGCCCAAGAGGTCAAGG - Intronic
905420164 1:37837142-37837164 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
905523173 1:38615649-38615671 TATTTTAGACAGGGTGGTCAAGG - Intergenic
905582777 1:39094806-39094828 TGCTTGAGCCCGGGAGGTCAAGG + Intronic
905681158 1:39871985-39872007 GGCTTGAGCCAGGGAGGTCAAGG - Intronic
905739293 1:40355704-40355726 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
906016570 1:42587079-42587101 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
906327538 1:44856886-44856908 TGCTTGAGCCTGAGAGGTCAAGG - Intronic
906483427 1:46216423-46216445 TGCTTGAGCCTGGGGGGTCAAGG - Intronic
906561600 1:46762179-46762201 TGCTTGAGCCTGAGAGGTCAAGG - Intronic
906830942 1:49031169-49031191 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
906874746 1:49525313-49525335 TGCTGTAGAGTGAGTGGTCAGGG + Intronic
907061512 1:51430873-51430895 TGCTTAAGCCTGGGAGGTCAAGG + Intronic
907083797 1:51649956-51649978 TGCTTGAGCCAAGGAGGTCAAGG - Intronic
907264900 1:53251956-53251978 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
907302052 1:53493773-53493795 TGCTTGAGCCCGGGAGGTCAAGG - Intergenic
907344346 1:53761899-53761921 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
907344586 1:53764350-53764372 TGCTTGAGCCTGAGAGGTCAAGG + Intergenic
907398821 1:54211574-54211596 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
908096973 1:60749417-60749439 TGTTTTAGCCAGCATGGACATGG + Intergenic
908197903 1:61763741-61763763 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
908236040 1:62148035-62148057 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
908295951 1:62713269-62713291 TGCTTGAGCCAGAGAGGCCGAGG + Intergenic
908524461 1:64974811-64974833 TCCTTGAGCCAAAGTGGCCACGG + Intergenic
908536583 1:65084017-65084039 TGCTTTAGCCTGGGTGGTCAAGG + Intergenic
908606314 1:65800765-65800787 TGCAATAGTAAGAGTGGTCACGG + Intronic
908705084 1:66944807-66944829 TGCCTGAGCCAGGGAGGTCAAGG - Intronic
908785217 1:67728830-67728852 TCCTTTAGCCAGAATGGTTTGGG + Intronic
909022863 1:70451717-70451739 TGCTTGAGCCAGGGAGGTCAAGG - Intergenic
909031380 1:70545278-70545300 TGCTTTAGCCCAGGAGGTCAAGG + Intergenic
909061731 1:70886571-70886593 TGCTTTCGACAGATTGATCAAGG - Intronic
909584839 1:77278553-77278575 AGTTTTATACAGAGTGGTCAGGG - Intergenic
909870883 1:80737084-80737106 TGCTTAAGGCTGAGAGGTCAGGG - Intergenic
910187437 1:84558815-84558837 TGCTTGAGCCCAAGAGGTCAAGG + Intronic
910215900 1:84843924-84843946 TGCTTTAGACTGGGTGGTCATGG - Intronic
910356797 1:86366520-86366542 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
910399727 1:86826522-86826544 TGAATTAGCCAGAGAGGACAGGG + Intergenic
910473699 1:87582899-87582921 CGCTTGAGCCAGAAAGGTCAAGG - Intergenic
910965383 1:92803081-92803103 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
911008734 1:93255650-93255672 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
911052902 1:93686815-93686837 CACTATAGCAAGAGTGGTCATGG - Intronic
911110955 1:94184668-94184690 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
911189748 1:94936081-94936103 TGCTTGAGCCAAAGATGTCAAGG + Intergenic
911792049 1:102029678-102029700 TGCTTGAGCCAGGGAGGTCAAGG + Intergenic
911889313 1:103346705-103346727 TGCTTTAGCTGGAGTGATCAGGG + Intergenic
912074056 1:105850297-105850319 AGCTGGAGCCAGAGTGGCCAGGG - Intergenic
912109566 1:106324317-106324339 TGATTGAGCCTGAGGGGTCAAGG + Intergenic
912325494 1:108755361-108755383 TGCTTGAGCCAGGGAAGTCAAGG + Intronic
912587373 1:110779329-110779351 TGCTTTAAACAGGCTGGTCATGG + Intergenic
912854749 1:113157393-113157415 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
912918801 1:113844900-113844922 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
912929571 1:113944929-113944951 TGCTTGAGCCTGAGAGGTCATGG - Intronic
913018238 1:114761221-114761243 TGCTTAAGCCTGGGAGGTCATGG + Intergenic
913041083 1:115024505-115024527 TGCATTAGACTGGGTGGTCAAGG + Intergenic
913124181 1:115770066-115770088 TGCTTTACTCAGAGAGGCCACGG - Intergenic
913150777 1:116040698-116040720 TGCTTGAGCCCAAGAGGTCAAGG - Intronic
913164975 1:116176746-116176768 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
913250386 1:116908533-116908555 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
913377818 1:118173774-118173796 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
913400750 1:118429950-118429972 TGCTTGAGCCTGAGTGGTGGAGG + Intergenic
913522126 1:119654519-119654541 TGCTTTAGCCTGGGAGGTCAAGG + Intergenic
913600651 1:120418632-120418654 TGCTTGAGCCTGAGAGGTCAAGG - Intergenic
914086405 1:144458001-144458023 TGCTTGAGCCTGAGAGGTCAAGG + Intronic
914192301 1:145421952-145421974 TGCTTGAGCCTGAGAGGTCAAGG + Intergenic
914311921 1:146474369-146474391 TGCTTGAGCCTGAGAGGTCAAGG - Intergenic
914590207 1:149099896-149099918 TGCTTGAGCCTGAGAGGTCAAGG + Intronic
914686091 1:149980927-149980949 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
914703460 1:150153269-150153291 TGCTTAAGCCCGGGAGGTCAAGG - Intronic
914736852 1:150426015-150426037 CGCTTGAGCCTGAGTGGTGAAGG + Intronic
915190032 1:154142071-154142093 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
915190485 1:154146546-154146568 CGCTTGAGCCTGGGTGGTCAAGG + Intronic
915207681 1:154282858-154282880 TGCTTGAGCCAGGGAGTTCAAGG + Intergenic
915209241 1:154294856-154294878 CGCTTGAGCCTGGGTGGTCAAGG + Intergenic
915550213 1:156628077-156628099 CGCTTTAGCCAAGGAGGTCAAGG + Intergenic
915657763 1:157375948-157375970 TGCTTGAGCCAGGGAGGTCAAGG - Intergenic
915671295 1:157491040-157491062 TGCTTGAGCCAGGGAGGTCGAGG + Intergenic
915961392 1:160269914-160269936 TGCTTGAGCCCGGGAGGTCAGGG - Intergenic
915999224 1:160598565-160598587 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
916073597 1:161186915-161186937 TGCTTGAGCCTGAGAGTTCAAGG + Exonic
916091602 1:161311780-161311802 TGCTTGAGCCTCAGAGGTCAAGG - Intergenic
916142113 1:161709209-161709231 TGCTTAAGCCCAAGAGGTCAAGG - Intronic
916525971 1:165609709-165609731 TGCTTGAGCCCAAGAGGTCAAGG + Intergenic
916737820 1:167623601-167623623 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
916794160 1:168150218-168150240 GGCTTGAGCCTGAGAGGTCAAGG + Intergenic
917090296 1:171346459-171346481 AGCTTGAGCCCGAGAGGTCAAGG - Intergenic
917208207 1:172600755-172600777 TGCTTTAGTTAGAGTGATCTTGG + Intronic
917358453 1:174150833-174150855 TGCTTGAGCCAGAGAGGTGGAGG - Intergenic
917394514 1:174578266-174578288 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
917447908 1:175122302-175122324 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
917748748 1:178036007-178036029 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
917765593 1:178213117-178213139 TGCTTGAGCCAGGGAGGTCAAGG - Intronic
917900047 1:179532799-179532821 TGCTTGAGCCTGTGAGGTCAAGG + Intronic
918057061 1:181031266-181031288 TGCTTGAGCCAGGGAGGTCAAGG - Intergenic
918175891 1:182045011-182045033 CGCTTGAGCCTGAGAGGTCAAGG - Intergenic
918210583 1:182347652-182347674 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
918366150 1:183809871-183809893 CGCGTGAGCCAGGGTGGTCAAGG + Intronic
918547131 1:185697712-185697734 TGCTTTAGCCTGGGAGGTCAAGG - Intergenic
919109528 1:193200138-193200160 TGCTTAAGCCCCAGAGGTCAAGG + Intronic
919182966 1:194109437-194109459 TGCTTGAGCCTGGGTGGTCAAGG - Intergenic
919577288 1:199326672-199326694 TGCTTGAGCCCAAGAGGTCAGGG + Intergenic
919632985 1:199977067-199977089 TGCTTTAGAAGGAGTGGTCAGGG - Intergenic
919668320 1:200314264-200314286 TGCTTTCTCCAGTGTGTTCAGGG - Intergenic
919707819 1:200695618-200695640 TGCTTGAGCTGGAGAGGTCATGG - Intergenic
919750669 1:201035911-201035933 TGCTTGAGCCCAAGTGTTCAAGG - Intergenic
919946964 1:202326630-202326652 TGCTTGAGCCCGGGGGGTCAAGG - Intergenic
920214142 1:204350235-204350257 GGCTTGAGCCAGGGAGGTCAAGG + Intronic
920267429 1:204734522-204734544 TGCCTTATCAAGCGTGGTCAAGG - Intergenic
920337525 1:205255117-205255139 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
920344463 1:205297231-205297253 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
920399151 1:205666422-205666444 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
920507923 1:206529829-206529851 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
920620437 1:207541125-207541147 TGCTTGAGCCAGAGAGGTCGAGG + Intronic
920622219 1:207559682-207559704 TGCTTGAGCCAGAGAGGTCGAGG + Intronic
920623829 1:207576734-207576756 TGCTTGAGCCAGAGAGGTCGAGG + Intronic
920624754 1:207586219-207586241 TGCTTGAGCCAGGGAGGTCAAGG - Intronic
920636472 1:207709320-207709342 TGCTTGAGCCAGAGAGGTCAAGG + Intronic
921435889 1:215121363-215121385 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
921645207 1:217606655-217606677 TGCTTGAGCCTGGGAGGTCACGG + Intronic
921681955 1:218044264-218044286 AGCTTGAGCCAGGGAGGTCAAGG + Intergenic
921687087 1:218102662-218102684 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
921790410 1:219283553-219283575 TATTTTAGCCAGAGTGATGAGGG - Intergenic
921948476 1:220905357-220905379 TGCTTTAGTCACAGTGAACAAGG - Intergenic
922104109 1:222498163-222498185 TGCTTTAGCCTAGGAGGTCAAGG + Intergenic
922131084 1:222779319-222779341 TGCTTGAGCCTAGGTGGTCAAGG + Intergenic
922198840 1:223383666-223383688 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
922335113 1:224613079-224613101 TGCTTGAGCCCAAGAGGTCAAGG - Intronic
922510944 1:226166878-226166900 TGCTTAAGCCTGGGAGGTCAAGG - Intronic
922535642 1:226378749-226378771 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
922659726 1:227419202-227419224 TGCTTGAGCCCGGGAGGTCAAGG + Intergenic
922771835 1:228189429-228189451 TGCTTGAGCCCGGGAGGTCAAGG + Intergenic
922883154 1:228997886-228997908 TACTTTGGGAAGAGTGGTCAAGG - Intergenic
923104732 1:230845297-230845319 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
923139650 1:231150611-231150633 TGCTTGAGCCTGAGAGGTCGAGG + Intergenic
923175168 1:231456562-231456584 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
923394820 1:233551415-233551437 TGCTTGAGCCTAGGTGGTCAAGG - Intergenic
923425623 1:233865972-233865994 TGCTATAGATAGAGTGGTCAGGG - Intergenic
923432498 1:233936770-233936792 TGCTTAAGCCTGGGAGGTCAAGG - Intronic
923889434 1:238195988-238196010 TACTTTAGATAGGGTGGTCAAGG + Intergenic
923996537 1:239501650-239501672 TGTGTTAGCCAGAATGGTCTTGG - Intronic
924144990 1:241064503-241064525 TGCTTGAGCCAGGGAGGTCAAGG + Intronic
924346278 1:243075678-243075700 TGCTTTAGCCTAGGAGGTCAAGG + Intergenic
924396648 1:243628381-243628403 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
924409552 1:243789300-243789322 CGCTTTAGCCAGGGAGTTCAAGG + Intronic
924473884 1:244366998-244367020 TTCTCTAGCCAGGGTGTTCAGGG + Intronic
924754082 1:246925962-246925984 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1062908098 10:1192736-1192758 CGTGTTAGCCAGGGTGGTCATGG - Intronic
1063104501 10:2981242-2981264 TGCTTGAGCCTGGGTGGTCAAGG + Intergenic
1063221351 10:3971252-3971274 TGCTTCTGTCCGAGTGGTCAAGG + Intergenic
1063650566 10:7932759-7932781 TGCTTCAGCCTGAGAGGTCGAGG - Intronic
1063750577 10:8941579-8941601 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1064005921 10:11698886-11698908 TGCTTGAGCCAGGGAGGTCAAGG + Intergenic
1064083834 10:12330077-12330099 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1064100002 10:12455253-12455275 TGCTTAAGCCCGGGAGGTCAAGG - Intronic
1064199598 10:13273407-13273429 AGCTTGAGCCAAAGAGGTCAAGG + Intergenic
1064260668 10:13783466-13783488 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1064277967 10:13924551-13924573 TGGTTTTGACTGAGTGGTCAGGG - Intronic
1064343880 10:14512853-14512875 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1064358228 10:14639108-14639130 TGCTTGAGCCTGAGAGGTCAAGG + Intronic
1064521331 10:16205493-16205515 TGCTTAAGCCCAAGAGGTCAAGG + Intergenic
1064541953 10:16414453-16414475 TGCTTGAGCCACAGAGGTCTAGG - Intergenic
1064814898 10:19249701-19249723 AGCCTTAGCTTGAGTGGTCAAGG + Intronic
1064850177 10:19701063-19701085 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1065017064 10:21471648-21471670 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1065037976 10:21660046-21660068 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1065211785 10:23410885-23410907 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1065298469 10:24299480-24299502 TGTTTGAGCCAGGGAGGTCAAGG - Intronic
1065319671 10:24497634-24497656 TGCTTGAGCCCGAGAGGTCAAGG + Intronic
1065383225 10:25110510-25110532 TGCTTGAGCCCAAGAGGTCAAGG + Intergenic
1065706811 10:28478087-28478109 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1065809946 10:29432668-29432690 TGTTTGAGCCTGAGAGGTCAAGG - Intergenic
1065881116 10:30038600-30038622 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1065988884 10:30987234-30987256 TGCTTGAGCTTGGGTGGTCAAGG + Intronic
1066091678 10:32028054-32028076 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1066184666 10:32997677-32997699 TGCTTGAGCCAGGGAGGCCAAGG + Intronic
1066330888 10:34421086-34421108 TGCTTGAGCCTGGGTGGTCAAGG + Intronic
1066336520 10:34483396-34483418 TGCTTGAGCCTGGGAGGTCATGG + Intronic
1066373537 10:34837415-34837437 TCCTTTAGAGTGAGTGGTCAGGG - Intergenic
1066408637 10:35144140-35144162 TGCTTTGTCCAGTGTGGTGATGG + Intronic
1066420868 10:35263455-35263477 TGCTTTAGCCAAGGAGTTCAAGG + Intronic
1066496980 10:35951732-35951754 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1066504135 10:36024339-36024361 CACTTTGGCCTGAGTGGTCAGGG - Intergenic
1066668479 10:37811760-37811782 TGTTTGAGCCAGGGAGGTCAAGG + Intronic
1066730066 10:38429148-38429170 TGCTTTAGCCTAGGAGGTCAAGG - Intergenic
1068651247 10:59525447-59525469 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1068743189 10:60498470-60498492 TGCTTTGGCCCAAGAGGTCAAGG - Intronic
1068750932 10:60591421-60591443 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1068922698 10:62501411-62501433 TGATCTAGTCAGGGTGGTCAGGG - Intronic
1068931342 10:62593708-62593730 TGCTTGAGCCAGAGGGGTGCAGG - Intronic
1069018423 10:63458805-63458827 GGCTTGAGCCTGAGAGGTCAAGG - Intronic
1069417095 10:68210172-68210194 TGCTTTACCAAGAATGCTCAGGG + Intronic
1069475075 10:68724699-68724721 TGCTTGAGCCAGGGAGGTCAAGG + Intronic
1069489768 10:68851217-68851239 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1069518639 10:69100312-69100334 TGCTTGATCCTGAGAGGTCAAGG + Intronic
1069672517 10:70220334-70220356 TGCTTGAGCCAGGGTGGTTGAGG - Intronic
1069950521 10:72015298-72015320 TGCTTGAGCCTGAGAGGTCCAGG - Intergenic
1069956452 10:72054802-72054824 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1070022056 10:72596352-72596374 TGCTTGAGCCCGGGAGGTCAAGG + Intronic
1070028118 10:72651222-72651244 TGCTTGAGCCCAAGAGGTCAAGG + Intergenic
1070036894 10:72734695-72734717 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1070062773 10:73001179-73001201 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1070253083 10:74790177-74790199 TGCTTGAGCCCGGGAGGTCAAGG + Intergenic
1070285895 10:75083501-75083523 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1070957896 10:80476284-80476306 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1071175030 10:82916366-82916388 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1071294981 10:84213024-84213046 TGATTTAGCCAGAGTACACAAGG + Intronic
1071664599 10:87542381-87542403 GGCTTGTGCCAGAGAGGTCAAGG - Intronic
1071717854 10:88114916-88114938 TGCTTTAGGAAGAGTGGTCAAGG - Intergenic
1072096651 10:92188110-92188132 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1072421371 10:95292338-95292360 GGCTTGAGCCGGAGAGGTCAAGG + Intergenic
1072471237 10:95715946-95715968 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1072649625 10:97284587-97284609 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1072702400 10:97652377-97652399 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1072848726 10:98862579-98862601 TGCTTTTGGGAGAGTGATCATGG + Intronic
1072961476 10:99933210-99933232 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1072964851 10:99963150-99963172 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1073005100 10:100317453-100317475 TGCTTGAGCCCAAGAGGTCAAGG + Intronic
1073007092 10:100332857-100332879 TGCTTGAGCCCGGGAGGTCAGGG + Intergenic
1073071980 10:100800360-100800382 TGCTTAAGCCTGGGAGGTCAAGG - Intronic
1073118315 10:101105928-101105950 TGCTTTAGCCCAGGAGGTCAAGG - Intronic
1073131531 10:101192073-101192095 TGCTTGAGCCCAAGAGGTCAAGG - Intergenic
1073372885 10:103006708-103006730 CGCTTGAGCTAGAGGGGTCAAGG - Intronic
1073412945 10:103357457-103357479 TGCTTGAGTCAGAGAGGTCGGGG + Intergenic
1073426151 10:103456870-103456892 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1073937870 10:108655787-108655809 GGCTTGAGCCTGAGAGGTCAAGG + Intergenic
1074138881 10:110653638-110653660 TGCTTGAGCCAGGGAGGTCAAGG - Intronic
1074319120 10:112384589-112384611 CGCTTGAGCCAGGGAGGTCAAGG - Intronic
1074334768 10:112560403-112560425 TGCTTTAGAAAGAGTGGTCAGGG - Intronic
1074373532 10:112920281-112920303 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1074557318 10:114503365-114503387 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1074934055 10:118160003-118160025 TGCTTGAGCCTGGGTGGTCGAGG + Intergenic
1075138210 10:119806450-119806472 TGCCATCGCGAGAGTGGTCATGG + Exonic
1075237390 10:120743061-120743083 TACTTTAATCAGGGTGGTCAGGG - Intergenic
1075372138 10:121946283-121946305 TGCTTAAGCCTGGGAGGTCAAGG - Intergenic
1075381725 10:122024280-122024302 TGCTTAAGCCTGGGAGGTCAAGG + Intronic
1075503392 10:122999108-122999130 TGCTTGGGTCTGAGTGGTCAAGG + Intronic
1075819875 10:125297707-125297729 TGCTTTAGCCTGGGAGGTCAAGG + Intergenic
1075867399 10:125736858-125736880 TGCTTTGGCCAGAGTGGTCAGGG - Intronic
1076651703 10:131994118-131994140 TGCTTGAGCCCGGGAGGTCAAGG - Intergenic
1076972875 11:147533-147555 TGCTTTAGCCTAGGAGGTCAAGG + Intergenic
1077519482 11:3023476-3023498 TGCTTGAGCCAGGGAGGTCGAGG - Intronic
1077527904 11:3078953-3078975 TGCTTGAGCCAGAGAGGTTGAGG - Intergenic
1077528026 11:3079694-3079716 TGCTTGAGCCAGAGAGGTTGAGG + Intergenic
1077626442 11:3776203-3776225 TGCTTGAGCCTGTGAGGTCAAGG - Intronic
1078044003 11:7896540-7896562 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1078132896 11:8627906-8627928 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1078205554 11:9225994-9226016 TGATTGAGCCAGGGAGGTCAAGG + Intronic
1078242074 11:9538929-9538951 TGCTTGAGCCCGGGAGGTCAAGG - Intergenic
1078262099 11:9719289-9719311 CGCTTTAGCCTGGGAGGTCAAGG + Intronic
1078321070 11:10335286-10335308 CGCTTGGGCCAGAGAGGTCAAGG - Intronic
1078494261 11:11800253-11800275 TCCTTTAGAATGAGTGGTCAGGG + Intergenic
1078538125 11:12191681-12191703 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1078598471 11:12710238-12710260 TGCTTGAGCCTGAGAGGTCAAGG + Intronic
1078671951 11:13373588-13373610 TGCTTGAGCCCGGGAGGTCAAGG - Intronic
1079194032 11:18308730-18308752 CGCTTGAGCCAGGGAGGTCAAGG + Intronic
1079211692 11:18466568-18466590 TGCTTCAGCCAGGGAGGTCAAGG + Intronic
1079629356 11:22654477-22654499 TGCTTGAGCCAAGGAGGTCAAGG - Intronic
1079793114 11:24764578-24764600 TGCTTGAGCCTGAGAGGTCGAGG + Intronic
1080064354 11:27992882-27992904 TGCTTGAGCCCAAGAGGTCAAGG + Intergenic
1080202821 11:29693220-29693242 CACTTGAGCCAGAGAGGTCAAGG - Intergenic
1080537245 11:33233945-33233967 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1080556270 11:33420310-33420332 TGCTTGAGCCTGAGAGGTCGAGG - Intergenic
1080594457 11:33757870-33757892 TGCTTGAGCCAGGGGAGTCAAGG + Intronic
1080599119 11:33805186-33805208 TGCTTTAGCCAGACAGGTCAAGG + Intergenic
1080599202 11:33806224-33806246 TACTTTAGCCAGACAGGTCAGGG + Intergenic
1080604041 11:33849533-33849555 AGCTTAAGCCTGAGAGGTCAAGG - Intergenic
1080616495 11:33949176-33949198 TGCTGGAGCCAGAGTGAACAAGG + Intergenic
1080702687 11:34657704-34657726 TGCTTGAGCCAGGGAGGTCTAGG + Intronic
1080719656 11:34836882-34836904 TGCTTGAGCCTGAAAGGTCAAGG + Intergenic
1080785463 11:35471186-35471208 TTCTTTGGAAAGAGTGGTCAGGG - Intronic
1080814034 11:35736690-35736712 GGCTTTAGCCATAGTAGACAAGG - Intronic
1080852548 11:36082422-36082444 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1081382038 11:42428676-42428698 TACATTAGACAGAGTGGTGAGGG + Intergenic
1081679345 11:44990729-44990751 TGTTTTAGGAAGAATGGTCAGGG + Intergenic
1081714464 11:45238690-45238712 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1081724965 11:45321626-45321648 TGCTCTAGCCTCACTGGTCAGGG + Intergenic
1081777731 11:45687473-45687495 TGCATAAGCCACAGTTGTCAGGG + Intergenic
1081920200 11:46768272-46768294 TGTTTTAGCCAGGGAGGTCAAGG - Intronic
1082038456 11:47664963-47664985 TGCTTGAGCCCGAGAGGTCAAGG - Intronic
1082086970 11:48058286-48058308 TGCTTGAGCCCAAGAGGTCAAGG - Intronic
1082266127 11:50120517-50120539 TGCTTGAGCCAGAGAGGTTGTGG + Intergenic
1082289962 11:50358055-50358077 TGCTTGAGCCAGAGAGGTTGTGG - Intergenic
1082777684 11:57260101-57260123 TGCTTGAACCTGAGAGGTCAAGG - Intergenic
1082955952 11:58870022-58870044 TGCTTGAGCCTGAAAGGTCAAGG + Intronic
1082963414 11:58940881-58940903 TGCTTGAGCCTGAATGATCAAGG + Intronic
1082972574 11:59039022-59039044 TGCTTGAGCCTGAAAGGTCAAGG + Intronic
1083434174 11:62631339-62631361 TGCTTTAGATAGTGTGGTCTAGG - Intronic
1083586701 11:63864971-63864993 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1083790980 11:64985725-64985747 TGCTTGAGCCAGGGAGGTCGAGG - Intergenic
1083975380 11:66115123-66115145 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1084009500 11:66339678-66339700 TGCTTGAGCCTGAGAGATCAAGG - Intronic
1084159477 11:67338249-67338271 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1084206751 11:67599062-67599084 TGCTTGAGCCCAAGAGGTCAAGG + Intergenic
1084287493 11:68141582-68141604 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1084353350 11:68619512-68619534 TGCTTGAGCCAGGGAGGTCAAGG + Intergenic
1084439962 11:69167127-69167149 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1084872412 11:72107181-72107203 TGCCTGAGCCTGGGTGGTCAAGG + Intronic
1084916993 11:72435937-72435959 TATTTTAACCAGAATGGTCAGGG - Intergenic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG + Intronic
1085021089 11:73208642-73208664 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1085061235 11:73449057-73449079 TGCTTGAGCCCAAGAGGTCAAGG - Intronic
1085076101 11:73594183-73594205 TGCTTGAGCCAGGGAGGTCAAGG - Intronic
1085082052 11:73643207-73643229 TGCTTGAGCCAGAGAGGTTGAGG + Intergenic
1085104901 11:73833938-73833960 TACCTGAGCCAGAGAGGTCAAGG - Intronic
1085206620 11:74737278-74737300 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1085361136 11:75888215-75888237 TGCCGGAGCCTGAGTGGTCAAGG - Intronic
1085497828 11:76987854-76987876 TGCTTGAGCCCGAGAGGTCAAGG + Intronic
1085563446 11:77491443-77491465 TGCTTAAGCCTGGGAGGTCAAGG + Intergenic
1085622076 11:78045185-78045207 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1085624506 11:78061712-78061734 TGCTTGAGCCCGGGAGGTCAAGG - Intronic
1085669812 11:78452489-78452511 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1086083015 11:82924729-82924751 CGCTTGAGCCTGAGCGGTCAAGG + Intronic
1086105582 11:83143714-83143736 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1086313319 11:85560946-85560968 TGCTTGAGCCTGAGAGGTCAAGG + Intronic
1087028125 11:93672504-93672526 TGCTTTAGCCTGGGAGTTCAAGG - Intronic
1087711491 11:101558631-101558653 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1087834396 11:102858168-102858190 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1087912776 11:103772805-103772827 TGCTTGAGCCTGGGAGGTCACGG + Intergenic
1088264403 11:107975666-107975688 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1088285787 11:108186098-108186120 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1088547507 11:110974640-110974662 TGCTTTAGGCAGAGAGCTGAGGG + Intergenic
1088548185 11:110982696-110982718 TCTATAAGCCAGAGTGGTCAGGG + Intergenic
1088612122 11:111588056-111588078 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1088793268 11:113245356-113245378 TGCTTGAGCCCGGGAGGTCAAGG + Intronic
1089242333 11:117092434-117092456 TGCCTCAGATAGAGTGGTCAGGG - Intronic
1089516614 11:119036431-119036453 TGCTTAAGTCTGGGTGGTCAAGG + Intergenic
1089591162 11:119541584-119541606 TGCTGTAGACAAAGTGGTCAGGG + Intergenic
1089703648 11:120260980-120261002 TGCTTGAGCCGGGGAGGTCAAGG + Intronic
1090212622 11:124933253-124933275 TGCTTGAACCAGGGAGGTCAAGG - Intronic
1090569424 11:128030585-128030607 TGCTTAAGCCACTGTAGTCAGGG - Intergenic
1090593783 11:128298730-128298752 TTAATTTGCCAGAGTGGTCAGGG - Intergenic
1090721977 11:129483753-129483775 TGCTTGAGCCAAGGAGGTCAAGG - Intergenic
1090778014 11:129982173-129982195 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1090782194 11:130017350-130017372 TGCTTGAGCCTGGGGGGTCAAGG - Intergenic
1090798182 11:130153408-130153430 TGCTTGAGCCTGAGAGGTCGAGG + Intergenic
1091193269 11:133711871-133711893 TGCTGTAGACTGAGTGGTCAGGG - Intergenic
1091618984 12:2071299-2071321 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1091926533 12:4355807-4355829 TGCTTTATCCAGGATGGGCAGGG + Intergenic
1091934812 12:4426719-4426741 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1092026547 12:5245592-5245614 CGCTTGAGCCAGAGAGGTCAAGG - Intergenic
1092157437 12:6293354-6293376 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1092250502 12:6892620-6892642 TGCTTGAGCCTGAGAGGTCCAGG + Intronic
1092259949 12:6947583-6947605 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1092294246 12:7185542-7185564 TGCTTTACCCCAAGTGTTCAGGG + Intergenic
1092603441 12:10092461-10092483 TGCTTGAGCCAGGGAGGTCAAGG + Intronic
1092798573 12:12139637-12139659 TCCTTGAGCCAGGGAGGTCAAGG + Intronic
1092843452 12:12563841-12563863 TGCTTTAGGCAGGGTGCACATGG - Intergenic
1093135938 12:15450687-15450709 TGCTTGAGCCTGAGAGGTTAAGG + Intronic
1093770787 12:23015346-23015368 TGCTTCAGCCCAAGAGGTCAAGG - Intergenic
1093840366 12:23891953-23891975 TGTTTTAGGCAGAGTAGTGAAGG - Intronic
1094084596 12:26575668-26575690 TGCTTTGGCCAGTATGGACATGG + Intronic
1094166910 12:27452571-27452593 TGCTTAAGCCCAAGAGGTCAAGG - Intergenic
1094361583 12:29636974-29636996 CACTTTAGCCAGGGAGGTCAAGG + Intronic
1094464346 12:30736055-30736077 TGCTTGAGCCCGGGAGGTCAAGG + Intronic
1094576889 12:31694660-31694682 TGCTTGAGCCAGGGCAGTCAAGG + Intronic
1095443738 12:42264384-42264406 TGCTTGAGCCAAGGAGGTCAAGG - Intronic
1095753454 12:45736152-45736174 TGTGTTAGCCAGACTGGTCTTGG - Intronic
1095774170 12:45994049-45994071 TGCTTGAGCCTGGGAGGTCAGGG + Intergenic
1095809104 12:46353006-46353028 TGCTTGAGCCTGGGTGGTCCAGG + Intergenic
1096043110 12:48537848-48537870 CGCTTGAGCCCGGGTGGTCAAGG + Intergenic
1096270732 12:50164349-50164371 TGCTTGAGCCAAAGAGGTCGAGG + Intronic
1096274171 12:50191440-50191462 TGCATTAGCCTGGGAGGTCAAGG + Intronic
1096278587 12:50232141-50232163 TGCTTGAGCCCGGGAGGTCAAGG - Intronic
1096728456 12:53585054-53585076 TGCTTGAGCCCGGGAGGTCAAGG - Intronic
1097094223 12:56533016-56533038 TGCTTGAGCCAGGGAGGTCGAGG - Intronic
1097096462 12:56552756-56552778 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1097443185 12:59636546-59636568 TGCTTGAGCCTGAATAGTCAAGG - Intronic
1097646709 12:62243862-62243884 TGCTTGAGCTGGAGAGGTCAAGG - Intronic
1097866537 12:64563794-64563816 TGCTTTAGTTTGGGTGGTCAAGG - Intergenic
1097871258 12:64604207-64604229 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1098434247 12:70451900-70451922 TGCTTGAGCCCGGGTGATCAAGG - Intergenic
1098756493 12:74370168-74370190 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1098894020 12:76036982-76037004 TGCTTGAGCCAGGGAGGTGAAGG + Exonic
1098953873 12:76668918-76668940 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1099262004 12:80395378-80395400 TGCTTGAGCCCAAGAGGTCAAGG - Intergenic
1099897067 12:88661619-88661641 TGCTTGAACCCCAGTGGTCAAGG - Intergenic
1099976995 12:89556464-89556486 TGCTTGAGCCTAAGAGGTCATGG + Intergenic
1099977345 12:89559766-89559788 TACTTTAGGCGGAGTGGCCAGGG + Intergenic
1100540562 12:95553292-95553314 TGCTTGAGCCTGAGAGGTCAAGG - Intergenic
1100583097 12:95954482-95954504 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1100699180 12:97128268-97128290 TGCTTTATCCAGAGGGCTCTGGG + Intergenic
1100824667 12:98463278-98463300 TGCTTGAGCCTGAGAGGTCGAGG + Intergenic
1100847390 12:98674077-98674099 TGCTTGAGCCCAAGAGGTCAAGG - Intronic
1100974918 12:100112421-100112443 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1101358387 12:104002859-104002881 TGCTTGAGCCAGGGAGGTCAAGG + Intronic
1101364303 12:104057435-104057457 CGCTTTAGCCTGGGAGGTCAAGG + Intronic
1101407154 12:104438721-104438743 TGCCTTAGAAAGGGTGGTCAAGG - Intergenic
1101585204 12:106079646-106079668 TCTTTTACCTAGAGTGGTCAGGG - Intronic
1101762729 12:107672125-107672147 TGCTTGAGCCTGAGAGGTCGAGG + Intergenic
1102123828 12:110464253-110464275 TGCTTTAGCTAGAATTGTCAGGG - Intronic
1102194883 12:111018050-111018072 TGCTTTAGCCAAGGAGTTCAAGG + Intergenic
1102236589 12:111297898-111297920 TCCTTTATCCAGGGTAGTCAGGG + Intronic
1102238154 12:111307611-111307633 TGCTTGAGCCTGAGAGGTCAAGG + Intronic
1102351617 12:112196672-112196694 TGCTTGAGCCCGGGAGGTCAAGG - Intronic
1102356215 12:112238294-112238316 TGCTTGAGCCAGGGAGGTCGAGG - Intronic
1102497218 12:113328114-113328136 TGCTTGAGCCTGAGTGGTTGAGG - Intronic
1102512766 12:113426853-113426875 TGCTTGAGCCTGAGAGGTCGAGG + Intronic
1102696299 12:114802333-114802355 TGCTTAAGCCTGAGAGGTCAAGG - Intergenic
1102802013 12:115743642-115743664 TGCTTGAGCCCGAGAGTTCAAGG - Intergenic
1102914419 12:116742349-116742371 TGCTTGAGCCTGAGAGGTCGAGG - Intronic
1102953854 12:117046946-117046968 TGCCAAAGCCAGAGGGGTCAGGG + Intronic
1103052793 12:117795710-117795732 TGCTTGAGCCTGAGAGTTCAAGG - Intronic
1103167810 12:118785196-118785218 AGCTTTGGCCAGAGAAGTCAAGG + Intergenic
1103171585 12:118825124-118825146 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1103249565 12:119487923-119487945 CGCTTGAGCCAGGGAGGTCAAGG - Intronic
1103433228 12:120905042-120905064 TACTTTAGATAGGGTGGTCAAGG + Intergenic
1103570784 12:121843458-121843480 TGCTTTACAGAGACTGGTCAGGG - Intronic
1103601359 12:122056720-122056742 TGCTTGAGCCTGAGAGTTCAAGG + Intronic
1103605487 12:122082902-122082924 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1103930310 12:124446625-124446647 GACATTAGCCAGAGAGGTCAGGG - Intronic
1103945350 12:124523109-124523131 TCCCTTAGCCAACGTGGTCAGGG - Intronic
1104165946 12:126229982-126230004 TCCTTCAGACACAGTGGTCAGGG + Intergenic
1104371713 12:128229241-128229263 TGCTTTAGGCAGAAGTGTCAAGG + Intergenic
1104432013 12:128724227-128724249 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1104492601 12:129208081-129208103 TGCTACAGCCAGGGCGGTCACGG - Intronic
1105357583 13:19672970-19672992 TGCTTGAGCCAGGGAGGTCAAGG + Exonic
1105362270 13:19731495-19731517 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1105370727 13:19799623-19799645 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1105381543 13:19892023-19892045 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1105484587 13:20814613-20814635 GGTTTTGGCCAGAGTGGCCATGG - Intronic
1105496850 13:20938053-20938075 CTCTTGAGCCAGAGAGGTCAAGG - Intergenic
1105895424 13:24713145-24713167 TGGTTTGGGCAGTGTGGTCATGG + Intergenic
1106010609 13:25817759-25817781 TGCTTGAGCCAGAGAGGTTGAGG - Intronic
1106011667 13:25830090-25830112 TGCTTGAGCCAGGGAGGTCAAGG - Intronic
1106033933 13:26026979-26027001 TGCTTTAGGCAGAGAGGTTAGGG - Intergenic
1106209541 13:27628897-27628919 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1106330304 13:28733527-28733549 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1106729479 13:32524844-32524866 TGCTTGAGGCAGGGAGGTCAAGG - Intronic
1106806316 13:33311211-33311233 CTCTTGAGCCAGAGAGGTCAAGG + Intronic
1107088716 13:36452576-36452598 TGCTTTAGCCCAGGAGGTCAAGG + Intergenic
1107110103 13:36688295-36688317 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1107473759 13:40715266-40715288 TGCTTTAGCCTGGGAGTTCAAGG - Intergenic
1107500446 13:40968801-40968823 TGCTTGAGCCCCAGAGGTCAAGG - Intronic
1107844240 13:44494472-44494494 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1107861656 13:44666583-44666605 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1107910038 13:45097014-45097036 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1107990009 13:45811544-45811566 TGCTTTAGCCCAGGAGGTCAAGG - Intronic
1108075665 13:46676859-46676881 TGCTTGAGCCCGAGAGGTCAAGG - Intronic
1108206768 13:48097985-48098007 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1108258889 13:48637530-48637552 TACTTTAGCTAGAGTGGTCAGGG + Intergenic
1108284691 13:48895184-48895206 TGGTTTAGCTAGGATGGTCAAGG + Intergenic
1108322578 13:49302573-49302595 TGCTTTAAGGACAGTGGTCAGGG + Intergenic
1108325699 13:49328749-49328771 TGCTTGAGGCCGAGAGGTCAGGG + Intronic
1108333938 13:49419492-49419514 TGCTTGAGCCCGGGAGGTCAAGG + Intronic
1108346014 13:49547870-49547892 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1108445965 13:50509330-50509352 TGCTTGAGCCCAAGAGGTCAAGG - Intronic
1108604211 13:52021146-52021168 TACTTTAGATAGAGTGATCAGGG + Intronic
1108609434 13:52069730-52069752 TGCATGAGCCAGAGTGGTGCAGG - Intronic
1109170645 13:59093098-59093120 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1109258816 13:60118856-60118878 TACTTTAGATAAAGTGGTCAGGG - Intronic
1109430598 13:62229499-62229521 TGCTTGAGCCAGGGAGGTCAAGG - Intergenic
1109792123 13:67262752-67262774 TGCCCTAGCCAGAGTGGGGAGGG - Intergenic
1110261126 13:73486305-73486327 TACTTTAGATAGAGTAGTCAAGG - Intergenic
1110425173 13:75358778-75358800 TGCTTGAGCCGGAAAGGTCAAGG + Intronic
1110431283 13:75426963-75426985 TGCTTGAGCCTGAGAGTTCAAGG + Intronic
1110568935 13:76983859-76983881 CGCTTGAGCCTGAGAGGTCAAGG + Intergenic
1110718261 13:78732333-78732355 TAATGTAGACAGAGTGGTCAGGG + Intergenic
1110839941 13:80130498-80130520 TGCTTGAGCCAGAGAGGTCAAGG - Intergenic
1110933822 13:81257723-81257745 TGCTTGAGCCCAAGTGTTCAAGG + Intergenic
1111140500 13:84112352-84112374 TGCTTAAGCCTGGGAGGTCAAGG - Intergenic
1111416372 13:87950754-87950776 TGCTTGAGCCCGAGATGTCAAGG - Intergenic
1111680039 13:91430956-91430978 TGCTTGAGCCCAAGAGGTCAAGG - Intronic
1111703963 13:91724771-91724793 TGCTTGAGCCAGGGAGGTCAAGG + Intronic
1111808405 13:93066973-93066995 TGTTTTAGACAGGATGGTCATGG + Intergenic
1111980322 13:95008553-95008575 TGCTTGAGCCCGGGAGGTCAAGG + Intergenic
1112148589 13:96730649-96730671 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1112273608 13:97995039-97995061 TGCTTGAGCCCAAGAGGTCAAGG + Intronic
1112291547 13:98147738-98147760 TGCTTGAGCCCAAGAGGTCAAGG - Intronic
1112319293 13:98392414-98392436 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1112364392 13:98744155-98744177 TGCTTAAGCCAGGGAGGTCAAGG + Intronic
1112400441 13:99072913-99072935 TGCTTGAGCCCGGGAGGTCAAGG + Intronic
1112500524 13:99939795-99939817 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1112576220 13:100639070-100639092 TGCTTTATCCAGATTGGGCAGGG - Intronic
1112577476 13:100648761-100648783 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1112898038 13:104325054-104325076 TGTTTTAGATAGAGTGGCCAAGG - Intergenic
1113185634 13:107683162-107683184 TGCTTGAGCCAGGGAGGTCGAGG + Intronic
1113261688 13:108572001-108572023 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1113538236 13:111084540-111084562 TGCTTGAGCCAGGGAGGTCAAGG + Intergenic
1114356067 14:21909992-21910014 TGCTTAAGCCTGGGAGGTCAAGG + Intergenic
1114430917 14:22659742-22659764 TGCTTGAGCCAGGGAGATCAAGG + Intergenic
1114445785 14:22786850-22786872 CGCTTGAGCCCAAGTGGTCAAGG + Intronic
1114514328 14:23287894-23287916 TGCTTCAGCCTGGGAGGTCAAGG - Intronic
1114584692 14:23799857-23799879 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1115233186 14:31183789-31183811 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1115269316 14:31534305-31534327 TGCTTGAGCCCTGGTGGTCAAGG - Intronic
1115274723 14:31594337-31594359 TGCTTGAGCCAGGAAGGTCAAGG + Intronic
1115389910 14:32842604-32842626 TGCTTCAGCCTAGGTGGTCAAGG + Intergenic
1115540539 14:34415513-34415535 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1115634107 14:35274562-35274584 TGCTTGAGCCTCAGAGGTCAAGG + Intronic
1115704090 14:35980601-35980623 TGCTTGAGCCAAAGAAGTCAAGG - Intergenic
1115825256 14:37264542-37264564 TGCTTAAGCCCGGGAGGTCAAGG + Intronic
1115828134 14:37300587-37300609 TGCTTGAGCCCAAGAGGTCAAGG - Intronic
1115964573 14:38873272-38873294 TGCTGTAGCCAGTGTCCTCAAGG + Intergenic
1116104245 14:40479089-40479111 TGCATTAGCCAGAGAGGCTAAGG + Intergenic
1116459184 14:45151828-45151850 TGCTTGAGCCTGGGTGGTCGAGG + Intronic
1116645111 14:47517996-47518018 TGCTTTATCGTGTGTGGTCATGG + Intronic
1116821180 14:49629360-49629382 TGCTTGAGCCAGGGAGGTCAAGG - Intronic
1116881957 14:50179466-50179488 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1116882850 14:50188978-50189000 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1116956195 14:50926265-50926287 TGCTTGAGCCCGGGAGGTCAGGG + Intronic
1117027593 14:51637136-51637158 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1117033012 14:51694604-51694626 TGCTTTAGCCTGAGAGGTTGAGG + Intronic
1117137766 14:52754294-52754316 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1117355643 14:54921407-54921429 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1117415573 14:55492263-55492285 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1117423834 14:55575139-55575161 TGCTTGAGCCCCAGAGGTCAAGG + Intronic
1117467712 14:56010072-56010094 TGCCTGAGCCTGAGAGGTCAAGG - Intergenic
1117637259 14:57756736-57756758 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1117690787 14:58302874-58302896 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1117844620 14:59897657-59897679 TGCTTGAGCCTGAAAGGTCAAGG - Intergenic
1118103880 14:62636461-62636483 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1118122541 14:62861351-62861373 TGCTTGAGCCTGAGAGGTCAAGG - Intronic
1118178791 14:63470153-63470175 TGCTTCAGCCAGGGAGGTCGAGG - Intronic
1118194754 14:63614389-63614411 TGCTTGAGCCAGGGAGGTCAAGG - Intronic
1118218186 14:63829331-63829353 TGCTTGAGCCCAAGTGGTCAAGG + Intergenic
1118291593 14:64529685-64529707 TGCTTGAGCCTGAGAGGTCAAGG + Intronic
1118387579 14:65269162-65269184 TGCTTGAGCTAGGGAGGTCAAGG - Intergenic
1118566288 14:67144151-67144173 CGCTTGAGCCTGGGTGGTCAAGG + Intronic
1118592021 14:67409157-67409179 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1118598660 14:67455436-67455458 TGATCTAGTCAGGGTGGTCAGGG - Intronic
1118663943 14:68046205-68046227 TGCTTGAGCCCGAAAGGTCAAGG - Intronic
1118691863 14:68347586-68347608 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1118755581 14:68840994-68841016 TGCTTGAGCCCTAGAGGTCAAGG + Intergenic
1118800651 14:69186455-69186477 TGCTTGAGCCAGGGAGGGCAAGG - Intergenic
1118979995 14:70708631-70708653 AGTTTTAGAGAGAGTGGTCATGG + Intergenic
1119279749 14:73395535-73395557 TGCTTGAGCCCGGGAGGTCAAGG + Intronic
1119411760 14:74436310-74436332 TGCTTGAGCCAAGGAGGTCAAGG - Intergenic
1119637844 14:76291284-76291306 TGCTTGACCCCGAGTGTTCAAGG + Intergenic
1119654657 14:76408506-76408528 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1120047409 14:79823490-79823512 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1120125541 14:80737804-80737826 TGCTTGAGCCTGAGGGGTCAAGG + Intronic
1120249171 14:82041345-82041367 TGCTTGAGCCCGGGAGGTCAAGG + Intergenic
1120772621 14:88397557-88397579 TACTTGAGCCAGGGAGGTCAAGG + Intronic
1120894858 14:89520316-89520338 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1121085913 14:91145960-91145982 TGCTTCAGCCTCAGAGGTCAAGG - Intronic
1121146241 14:91585098-91585120 TGCTTCAGCCTGGGAGGTCAAGG - Intronic
1121190850 14:92028467-92028489 TGCTTGAACCTGAGAGGTCAAGG + Intronic
1121350421 14:93168801-93168823 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1121392035 14:93583887-93583909 TGCTTGAGCCCAGGTGGTCAAGG - Intronic
1121461683 14:94084416-94084438 TGCTTGAGCCCAAGAGGTCAAGG + Intronic
1121497520 14:94404632-94404654 TGCTTTAGGTAGGGTGGTTAGGG + Intergenic
1122114117 14:99519197-99519219 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1122161038 14:99784172-99784194 TGCTTGAGCCTGGGTGGTCAAGG - Intronic
1122174561 14:99907382-99907404 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1122673544 14:103390790-103390812 TGCTTGAGCCCAAGAGGTCAAGG - Intronic
1122726095 14:103753827-103753849 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1123470461 15:20548035-20548057 TGCTTTGGCTACAGTGGTCAAGG + Intergenic
1123647598 15:22452665-22452687 TGCTTTGGCTACAGTGGTCAAGG - Intergenic
1123755176 15:23392279-23392301 TGCTTTAGCCTTGGAGGTCAAGG - Intergenic
1124016398 15:25880053-25880075 TGCTTGAGCCCCAGAGGTCAAGG - Intergenic
1124020094 15:25912957-25912979 TGCTTGAGCCTGAGAGGTTAAGG - Intergenic
1124266889 15:28244078-28244100 TGCTTGAGCCGGGGAGGTCAAGG + Intronic
1124281271 15:28364321-28364343 TGCTTTGGCTACAGTGGTCAAGG + Intergenic
1124301431 15:28547300-28547322 TGCTTTGGCTACAGTGGTCAAGG - Intergenic
1124467999 15:29956803-29956825 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1124944046 15:34246728-34246750 CGCCTGAGCCAGAGAGGTCAAGG - Intronic
1124951547 15:34326773-34326795 TGCTTGAGTCCGAGAGGTCAAGG - Intronic
1125059952 15:35407595-35407617 TGCTTTAGCTAGGGTAGTCAGGG + Intronic
1125126970 15:36235596-36235618 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1125308167 15:38346231-38346253 TGCTTGAGCCAGGGAGGTCCAGG + Intronic
1125544453 15:40492361-40492383 TGCTTGAGCCTAAGAGGTCAGGG - Intergenic
1125586507 15:40824452-40824474 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1125588675 15:40840798-40840820 TGCTTGAGCCAGGGAGGTCAAGG - Intergenic
1125660395 15:41390045-41390067 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1125769952 15:42158537-42158559 TGGTACAGCCAGTGTGGTCATGG - Intergenic
1125854238 15:42933807-42933829 TGCTTGAGCCTAAGAGGTCAAGG + Intergenic
1125899912 15:43336123-43336145 TGCTTGAGCCCCAGAGGTCAAGG - Intronic
1125900662 15:43343576-43343598 CACTTTAGACAGAGTGGTAAAGG - Intronic
1125951349 15:43754869-43754891 TGCTTAAGCCAGAGAGGTTGAGG + Intronic
1126007988 15:44276866-44276888 TGCTTGAGCCAGGGAGGTCGAGG + Intergenic
1126030588 15:44493714-44493736 TGCTTGAGCCTGTGAGGTCAAGG + Intronic
1126135364 15:45384790-45384812 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1126395956 15:48217888-48217910 TGCTTGAGCTAGGGAGGTCAAGG - Intronic
1126474735 15:49053970-49053992 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1126589765 15:50326748-50326770 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1126700910 15:51366812-51366834 TGCTTTAGCCTGGGAGGTCGGGG + Intronic
1126717823 15:51539723-51539745 TGCCTGAGCCGGAGAGGTCAAGG + Intronic
1126735740 15:51730430-51730452 CGCTTGAGCCTGAGAGGTCAAGG + Intronic
1126815553 15:52449916-52449938 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1127198662 15:56619263-56619285 TGCTTGAGCCTGAGAGGTCAAGG - Intergenic
1127307851 15:57725745-57725767 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1127444551 15:59047409-59047431 TGCTTGAGCCCGGGAGGTCAAGG + Intronic
1127484295 15:59405116-59405138 TGGCTTAGACTGAGTGGTCAGGG - Intronic
1127505344 15:59592625-59592647 CGCTTGAGCCTGAGAGGTCAAGG - Intergenic
1128035949 15:64526719-64526741 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1128045373 15:64613235-64613257 TGCTTGAGCCTGAGAGGTCAAGG + Intronic
1128045900 15:64617406-64617428 TGCTTGAGCCAGAGAGGTTGAGG + Intronic
1128167010 15:65474562-65474584 AGCTTGAGCCTAAGTGGTCAAGG - Intronic
1128196176 15:65758395-65758417 TGCTTGAGCCCAGGTGGTCAAGG - Intronic
1128205590 15:65849004-65849026 GGCTTGAGCCTGAGAGGTCAAGG + Intronic
1128205951 15:65852210-65852232 TGCTTGAGCCCGGGAGGTCAAGG - Intronic
1128306622 15:66603234-66603256 TGCTTAAGCCAGGGAGGTCAAGG + Intronic
1128381963 15:67119878-67119900 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1128410640 15:67393602-67393624 TGCTTGAGCCAGGGAGGTCAAGG - Intronic
1128484554 15:68071862-68071884 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1128500682 15:68225564-68225586 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1128583507 15:68826543-68826565 TGCTTGAGCCCAAGAGGTCAAGG - Intronic
1128676001 15:69609019-69609041 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1128836332 15:70811873-70811895 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1129088659 15:73124671-73124693 TGTTTTAAACAGAGTGTTCAAGG - Intronic
1129094478 15:73189013-73189035 TGCTTGAGCCTGAGAGGTCGAGG + Intronic
1129165842 15:73776863-73776885 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1129186972 15:73914107-73914129 TGATTGAGCCAGGGAGGTCAAGG + Intergenic
1129326947 15:74805271-74805293 TGCTTCAGCCTGGGAGGTCAAGG - Intergenic
1129362495 15:75032882-75032904 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1129406936 15:75326100-75326122 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1129409655 15:75342452-75342474 TGCTTGAGCCAGGGCGGTCAAGG + Intronic
1129734889 15:77954172-77954194 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1129967794 15:79752374-79752396 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1130013648 15:80171542-80171564 TGCTTGAGCCAGGGAGGTCAAGG - Intronic
1130053663 15:80504682-80504704 TGCTTGAGCCTCAGAGGTCAAGG + Intronic
1130509643 15:84578669-84578691 TGCTTAAGCCTGGGAGGTCAAGG + Intergenic
1130575307 15:85087284-85087306 TGCTTGAGCCCAAGAGGTCAAGG - Intronic
1130772627 15:86939963-86939985 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1131033050 15:89202675-89202697 TGCTTGAGCCCAAGAGGTCAAGG - Intergenic
1131101744 15:89696576-89696598 TGCTTTAGCCAGGGAGGTCAAGG - Intronic
1131101797 15:89697050-89697072 TGCTTGAGCCAGGGAGGTCAAGG - Intronic
1131136400 15:89939718-89939740 TGCTTCAGCCTGGGAGGTCAAGG - Intergenic
1132059297 15:98678594-98678616 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1132199659 15:99942639-99942661 TGCTTGAGCCTGAGAGGTTAAGG - Intergenic
1132395786 15:101473158-101473180 TGCTTGAGCCTGGGAGGTCAGGG - Intronic
1132486394 16:194185-194207 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1132493575 16:248702-248724 TGCTTGAGCCCGGGAGGTCAAGG - Intronic
1132513933 16:357402-357424 GGCTTGAGCCCGAGTGGTCAAGG + Intergenic
1132807283 16:1780814-1780836 TGCTTGAGCCAGGGAGGTCAAGG - Intronic
1132907984 16:2293453-2293475 TGCTTGAGCCCGGGAGGTCAAGG - Intronic
1133004792 16:2873773-2873795 CGCTTGAGCCAGAGAGGTCGAGG - Intergenic
1133006887 16:2887652-2887674 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1133052715 16:3126519-3126541 CGCTTGAGCCTGAGAGGTCAAGG - Intergenic
1133095127 16:3439297-3439319 TGCTTGAGCCTGGGAGGTCAGGG + Intronic
1133158112 16:3890063-3890085 TGCTTGAGCCTGGGTGGTCAAGG - Intergenic
1133191279 16:4135417-4135439 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1133312140 16:4855530-4855552 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1133335034 16:5001460-5001482 TGTGTTAGCCAGAATGGTCTCGG + Intronic
1133424378 16:5675062-5675084 TGCTTGAGCCCAAGAGGTCAAGG + Intergenic
1133756368 16:8765250-8765272 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1133781532 16:8942629-8942651 TGCTTGAGCCTGGGAGGTCATGG - Intronic
1133789578 16:8999197-8999219 TACTTGAGCCCGAGAGGTCAAGG - Intergenic
1133845870 16:9453363-9453385 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1133940166 16:10302573-10302595 TGCTTGAGCCTGGGTGGTCAAGG - Intergenic
1133987900 16:10682409-10682431 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1134004807 16:10811350-10811372 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1134034831 16:11021711-11021733 TGCTTGAGCCAGAGAGGTCAAGG + Intronic
1134150757 16:11802839-11802861 TACCTTAGCTAGAGTGGACAGGG - Intergenic
1134180430 16:12043436-12043458 TGCTTGAGCCAGGGAGGTCCAGG - Intronic
1134242522 16:12516394-12516416 TGCTTGAGCCTGGGAGGTCAGGG + Intronic
1134273483 16:12755363-12755385 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1134296773 16:12953108-12953130 TCTTTTAGATAGAGTGGTCAGGG + Intronic
1134461198 16:14430732-14430754 TGCTTTAGCCTTGGAGGTCAAGG + Intergenic
1134602440 16:15543735-15543757 TGCTTAAACCTGAGAGGTCAAGG + Intronic
1134658867 16:15968804-15968826 TGCTTGAGCCTGAGAGGTCATGG - Intronic
1134747891 16:16602078-16602100 AGCTTGAGCCTGAGAGGTCAAGG - Intergenic
1134805752 16:17123157-17123179 TGCTTTTGGCAGTATGGTCATGG + Intronic
1134848220 16:17459286-17459308 TGCTTGAGCCTGCGAGGTCAAGG + Intronic
1134900731 16:17935605-17935627 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1134997578 16:18751581-18751603 AGCTTGAGCCTGAGAGGTCAAGG + Intergenic
1135086189 16:19476261-19476283 TGCTTGAGCCCGGGAGGTCAAGG + Intronic
1135117308 16:19734695-19734717 TGCTTGAGCCTGAGAGGTCCAGG + Intronic
1135144081 16:19946549-19946571 TGCTTGACCCTGAGAGGTCAAGG - Intergenic
1135150553 16:20001672-20001694 TGCATTAGCCAGGCTGGTAAGGG - Intergenic
1135307173 16:21377197-21377219 TGCTTGAGCCAGGGAGGTCCAGG - Intergenic
1135391431 16:22096659-22096681 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1135526989 16:23220784-23220806 GGCTTGAGCCAGGGAGGTCAAGG + Intergenic
1135582251 16:23638778-23638800 TACTTTAGTTACAGTGGTCAGGG + Intronic
1135650601 16:24203139-24203161 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1135809986 16:25578248-25578270 TGCTTGAGCCCGGGAGGTCAAGG - Intergenic
1136227802 16:28870765-28870787 GGCTTGAGCCAGGGAGGTCAAGG - Intronic
1136303918 16:29356335-29356357 TGCTTGAGCCAGGGTGGTCCAGG - Intergenic
1136374271 16:29856097-29856119 TGCTTGAGCCTGAGAGGTCGAGG + Intergenic
1136461414 16:30412706-30412728 TGCTTTAGCCCGGGAAGTCAAGG + Intronic
1136621384 16:31431007-31431029 TGCTTTAGAAAATGTGGTCATGG - Intergenic
1137291338 16:47054103-47054125 TGCTTGAGCCCAAGAGGTCAAGG - Intergenic
1137302238 16:47162890-47162912 AGCTTGAGCCTGAGAGGTCAAGG - Intronic
1137378388 16:47974873-47974895 TGCCTGAGCCAGAGCGGTCAAGG + Intergenic
1137398687 16:48135462-48135484 CGCTTGAGCCTGAGAGGTCAAGG - Intronic
1137443726 16:48518890-48518912 CGCTTGAGCCTGAGAGGTCAAGG + Intergenic
1137600132 16:49750798-49750820 AGCTCCAGCCAGAGTGGTGAGGG + Intronic
1137630909 16:49943927-49943949 TGCTTGAGCCTGAGAGGTCGAGG + Intergenic
1137783920 16:51121991-51122013 TACTTTAGCCTGGGTGGTCAGGG + Intergenic
1137923797 16:52519876-52519898 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1137939833 16:52673359-52673381 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1138006653 16:53343577-53343599 TGCTTGAGCCTGGGAGGTCAGGG - Intergenic
1138010128 16:53371661-53371683 TGCTTTGGCTACAGTGGTCAAGG + Intergenic
1138021501 16:53486215-53486237 TGCTAGAGCCTGCGTGGTCAAGG + Intronic
1138545174 16:57714540-57714562 TGCTTGAGCCCGGGAGGTCAAGG + Intronic
1138556749 16:57775356-57775378 TGCCTTGGCCAGAGTGCTCGTGG - Intronic
1138573088 16:57888550-57888572 TGCTTGAGCCATGGAGGTCAAGG - Intronic
1138884530 16:61060170-61060192 TGCTTGAGCCAAGGTGGTAATGG + Intergenic
1139214035 16:65109963-65109985 TGCTTGAGCCGGAGAGGTCGAGG - Intronic
1139383060 16:66546833-66546855 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1139413206 16:66782947-66782969 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1139447625 16:67007702-67007724 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1139518906 16:67468502-67468524 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1139526990 16:67522916-67522938 TGCTTTCGTCAGGTTGGTCAGGG - Intronic
1139633327 16:68243782-68243804 TGCTTGAGCCTGAGAGGTCAAGG + Intergenic
1139714868 16:68804912-68804934 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1139772496 16:69289836-69289858 TGCTTGAGCCCGAGAGGTCAAGG + Intronic
1139799115 16:69506830-69506852 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1139820948 16:69720962-69720984 AGCTTGAGCCTGAGAGGTCAAGG - Intronic
1139841487 16:69884542-69884564 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1139894924 16:70280909-70280931 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1139948256 16:70656433-70656455 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1140031499 16:71342928-71342950 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1140032999 16:71353418-71353440 TGCTTTGGCCAGGGTGGAGATGG + Intergenic
1140068989 16:71633276-71633298 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1140243657 16:73228577-73228599 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1140326963 16:74013782-74013804 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1140334800 16:74095174-74095196 TGCTTTTGCTAGAGTGTTTAGGG - Intergenic
1140345864 16:74212570-74212592 TGCTTGAGCCCAAGAGGTCAAGG - Intergenic
1141108538 16:81253260-81253282 TGCAGTAGACAGAGTGATCAAGG - Intronic
1141133779 16:81452561-81452583 TGCTTTGTACATAGTGGTCAGGG + Intronic
1141226932 16:82126513-82126535 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1141584368 16:85023700-85023722 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1141616116 16:85210503-85210525 TGCTTGAGCCAGGGAGGTCCAGG + Intergenic
1141674594 16:85510925-85510947 AGTTTTTGACAGAGTGGTCAAGG - Intergenic
1141678861 16:85532342-85532364 TGCTTGAGCCCGGGAGGTCAAGG - Intergenic
1141734959 16:85846172-85846194 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1141880293 16:86853838-86853860 TGCTCGAGCCAAAGAGGTCAAGG + Intergenic
1141922636 16:87146246-87146268 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1142337549 16:89499791-89499813 TGCTTTAGCCTGGGAGGTCAAGG - Intronic
1142390078 16:89793662-89793684 TGCTTGAGCCAGGGAGGTCGAGG - Intronic
1142447375 16:90149994-90150016 TGCTTTAGCCTAGGAGGTCAAGG - Intergenic
1142460118 17:85338-85360 TGCTTTAGCCTAGGAGGTCAAGG + Intergenic
1142734821 17:1890278-1890300 CGCTTGAGCCCGAGAGGTCAAGG + Intronic
1142775565 17:2135771-2135793 TGCTTGAGCCTGAGAGGTTAAGG - Intronic
1142783827 17:2204045-2204067 TGCTTGAGCCTGAGAGGTCAAGG - Intronic
1143221474 17:5265702-5265724 TGCTTGAGCCTAAGAGGTCAAGG + Intergenic
1143343798 17:6234530-6234552 TGCTTAAGCCTGGGAGGTCAAGG - Intergenic
1143534807 17:7531436-7531458 TGCTTGAGCCAAGGAGGTCAAGG + Intergenic
1143755566 17:9064840-9064862 TGCTTGAGCCTGCGAGGTCAAGG - Intronic
1143953012 17:10648336-10648358 TGCTTTAGGCAGGGTGGGCAGGG - Intronic
1144216793 17:13062956-13062978 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1144407459 17:14966004-14966026 TGCTTAAGCCCGGGAGGTCAAGG + Intergenic
1144525019 17:15981830-15981852 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1144602768 17:16633066-16633088 TGCTTCAAACAGGGTGGTCAGGG - Intronic
1144699839 17:17329886-17329908 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1144935312 17:18893669-18893691 TGCTTGAGCCCAAGAGGTCAAGG + Intronic
1145112714 17:20178102-20178124 TGCTTGAGCCTGAGAAGTCAAGG - Intronic
1145254759 17:21316460-21316482 TGTTTGAGCCAGAGTGGTCCTGG - Intergenic
1145321841 17:21771505-21771527 TATTTGAGCCAGAGTGGTCCTGG + Intergenic
1145775754 17:27527296-27527318 TGCTTAAGCCCAAGAGGTCAAGG + Intronic
1145986831 17:29052641-29052663 CACTTTAGCCAGGGAGGTCAGGG - Intronic
1146048144 17:29527379-29527401 TGCTTGAGCCTGGGAGGTCAGGG + Intronic
1146052273 17:29563460-29563482 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1146111957 17:30098016-30098038 TGCTTGAGCCAGGGAGGTCGAGG - Intronic
1146123169 17:30212468-30212490 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1146249991 17:31331816-31331838 TGCTTGAGCCCCAGAGGTCAGGG + Intronic
1146260925 17:31420312-31420334 CGCTTGAGCCAGGGAGGTCAAGG - Intronic
1146288467 17:31591105-31591127 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1146319344 17:31834319-31834341 TGTTTGAGCCTGAGAGGTCAAGG + Intergenic
1146368651 17:32249951-32249973 TGCTTTAGCCTGGGTGATCGAGG - Intronic
1146714178 17:35070252-35070274 TGCTTGAGCCAGGGTGGTCAAGG - Intronic
1146772789 17:35584113-35584135 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1146932738 17:36789525-36789547 GGCTTGAGCCTGAGAGGTCAAGG - Intergenic
1147176917 17:38661634-38661656 TGCTTGAGCCTGGGAGGTCAGGG - Intergenic
1147248439 17:39138014-39138036 TGCTTGAGCCTGGGCGGTCAAGG - Intronic
1147280530 17:39356737-39356759 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1147618127 17:41843040-41843062 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1147842561 17:43382300-43382322 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1147859006 17:43505483-43505505 TGCTTGAGCCTGAGAGGTCGCGG + Intronic
1147935636 17:44009198-44009220 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1147940974 17:44047644-44047666 TGCTTTAGCCAAGGAGGTCAAGG - Intronic
1148017568 17:44533005-44533027 TGCTTGAGCCAGGGAGGTCAAGG + Intergenic
1148087792 17:45004957-45004979 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1148095334 17:45048996-45049018 TGCTTGAGCCCAAGAGGTCAAGG + Intronic
1148162544 17:45459042-45459064 CGCTTGAGCCAGGGAGGTCAAGG + Intronic
1148204671 17:45772586-45772608 TGCTTGAGCCTGAGAGATCAAGG - Intergenic
1148241342 17:46001143-46001165 TGCTTGAGCCTGGGAGGTCAGGG + Intronic
1148262592 17:46196152-46196174 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1148372670 17:47112442-47112464 TGCTTGAGCCAGAGAGGTAGAGG + Intergenic
1148398773 17:47334829-47334851 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1148409390 17:47451762-47451784 TGCTTGAGCCCAAGAGGTCAAGG + Intergenic
1148593474 17:48834031-48834053 TGCTTGAGCCAGGGATGTCAAGG + Intronic
1148650783 17:49248820-49248842 TGCTTGAGCCAGGGAGGTCAAGG - Intergenic
1148661982 17:49341578-49341600 CGCTTGAGCCAGGGAGGTCAAGG + Intronic
1148671853 17:49416275-49416297 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1148823381 17:50374319-50374341 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1148875122 17:50682653-50682675 TGCTTTATACAGGGTGGTCAGGG - Intronic
1148939474 17:51195989-51196011 TGCTTGAGCCGGGGAGGTCAAGG - Intronic
1148982805 17:51593551-51593573 TTTTTTAACCAGAGTGCTCAGGG - Intergenic
1148997921 17:51727967-51727989 TGCTTGAGCCCAAGTGTTCAAGG - Intronic
1149012936 17:51876248-51876270 TGCTTGAGCCTGAGAGGTCCAGG - Intronic
1149293699 17:55241527-55241549 TGCTTTAGCCTGGGAGGTCAAGG - Intergenic
1149706784 17:58702077-58702099 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1149803430 17:59591950-59591972 TGCTTGAGCCCGGGAGGTCAAGG - Intronic
1149825914 17:59827848-59827870 TGCTTGAGCCCGGGAGGTCAAGG + Intronic
1149843059 17:59983536-59983558 TGCTTGAGCCCGGGAGGTCAAGG + Intergenic
1150019284 17:61594496-61594518 TGCTTAAGCCTGAGAAGTCAAGG - Intergenic
1150053333 17:61987833-61987855 TGCTTGAACCCGAGAGGTCAAGG - Intronic
1150095794 17:62373535-62373557 CGCTTGAGCCAGGGAGGTCAAGG + Intronic
1150219536 17:63488273-63488295 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1150230683 17:63548409-63548431 TGCTTGAGCCCGGGAGGTCAAGG + Intronic
1150334216 17:64318780-64318802 TGCTTGAGCCCGGGAGGTCAAGG + Intergenic
1150352898 17:64459347-64459369 TGCTTGAGCCTGAGAGGTCGAGG + Intronic
1150361263 17:64536363-64536385 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1150371725 17:64644510-64644532 TGCTTGAGCCTGGGTGGTCCAGG + Intronic
1150381983 17:64728145-64728167 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1150393772 17:64805706-64805728 CGCTTGAGCCAGGGAGGTCAAGG + Intergenic
1150772937 17:68056797-68056819 CGCTTGAGCCAGGGAGGTCAAGG + Intergenic
1150774282 17:68066707-68066729 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1150800296 17:68276530-68276552 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1150829780 17:68509268-68509290 TGCTTTAGCCCAGGAGGTCAAGG - Intergenic
1151088060 17:71403767-71403789 TGCTTGAGCCAGGGTGGTGGAGG + Intergenic
1151228608 17:72665472-72665494 AGCTTTAACCTGAGAGGTCAAGG - Intronic
1151390013 17:73780216-73780238 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1151549089 17:74811244-74811266 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1151567058 17:74904545-74904567 TGCTCCAGCCAGAGTGGTGTTGG + Intergenic
1151602014 17:75111652-75111674 TGCTTAAGCCTGGGAGGTCAAGG + Intronic
1151795348 17:76341319-76341341 TGCTTGAGCCTGGGTGGTCGAGG - Intronic
1151856932 17:76728150-76728172 TGCTTGAGCCCGAGAGGTCGAGG + Intronic
1151895805 17:76980062-76980084 TGCTTGAGCCTGAGAGGTCAAGG + Intergenic
1151931757 17:77236692-77236714 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1152222956 17:79079245-79079267 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1152300642 17:79493563-79493585 TCCTTTAGCATGGGTGGTCAGGG - Intronic
1152440112 17:80302774-80302796 CGCTTGAGCCAGGGAGGTCAAGG + Intronic
1152580196 17:81162402-81162424 TGCCTGAGCCTGAGTGGTCTGGG + Intronic
1153210264 18:2755136-2755158 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1153344411 18:4010462-4010484 TGCTTGAGCCTAAGAGGTCAAGG + Intronic
1153624937 18:7014536-7014558 TGCTTGAGCCCAAGAGGTCAAGG + Intronic
1153793903 18:8605125-8605147 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1153827757 18:8892088-8892110 TGCTTGAGCCAGGGAGGTCAAGG + Intergenic
1153859278 18:9184474-9184496 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1153908822 18:9688368-9688390 TGCTTTAGGGAGCATGGTCAGGG - Intergenic
1154013196 18:10592991-10593013 TGCTTGAGCCCGGGAGGTCAAGG + Intergenic
1154227795 18:12523765-12523787 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1154939047 18:21092498-21092520 TGCTTCAGCCTGGGAGGTCAAGG + Intronic
1155015930 18:21839586-21839608 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1155040313 18:22059780-22059802 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1155204802 18:23549278-23549300 TGCTTGAGCCTGAGAAGTCAAGG - Intronic
1155209816 18:23590836-23590858 CACTTTAGCCAGGGAGGTCAAGG - Intergenic
1155213512 18:23622284-23622306 TGCTGTAGCCAGAGGGGTGCGGG + Intronic
1155219960 18:23675932-23675954 TGCTTGAGCCCAAGAGGTCAAGG - Intergenic
1155432364 18:25773510-25773532 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1155484707 18:26329139-26329161 TGCTTGAGCCTGAGAGGTGAAGG - Intronic
1155524151 18:26699476-26699498 AGCTTGAGCCAGAGAGGTCAAGG + Intergenic
1155655925 18:28193358-28193380 TGCTTAAGCCTGGGAGGTCAAGG - Intergenic
1156394909 18:36690638-36690660 TGCAGTGGCCAGAGTGGTGAAGG - Intronic
1156456269 18:37296412-37296434 TGCTTGAGCCCAAGAGGTCAAGG - Intronic
1156536661 18:37870991-37871013 GGCTTTGGTCAGAGTGGACAAGG + Intergenic
1157321773 18:46640153-46640175 TGCTTGAGCCAGAGTGGGAGAGG - Intronic
1157660876 18:49442465-49442487 TGCCTGAGCCTGAGAGGTCAAGG + Intronic
1157849850 18:51038171-51038193 TGCTTCAGCCAGGGAGTTCAAGG + Intronic
1158146668 18:54322383-54322405 TACTTTTGCCAGAGTGGTGATGG - Intergenic
1158253634 18:55519348-55519370 TGCTTAAGCCAGGCAGGTCAAGG + Intronic
1158454265 18:57592562-57592584 TGCTTAAGCCAGGGAGGCCAAGG + Intergenic
1158852665 18:61511068-61511090 TGCTTGAGCCCAAGAGGTCAAGG - Intronic
1158852694 18:61511278-61511300 TGCTTGAGCCCAAGAGGTCAAGG + Intronic
1158907489 18:62027821-62027843 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1158951337 18:62498101-62498123 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1159012000 18:63066532-63066554 TGCTTGAGCCAGGGAGGTCAAGG - Intergenic
1159566746 18:70059689-70059711 TGCTTTTGCCAGAATTGTCTTGG - Intronic
1159649650 18:70962737-70962759 TGATTTAGCCAAAATGTTCATGG - Intergenic
1160035095 18:75293622-75293644 TGCTTGAGTCAGTGAGGTCAAGG - Intergenic
1160513296 18:79464787-79464809 TGCTTCAGCCTGGGAGGTCAAGG - Intronic
1160530519 18:79559642-79559664 TGCTTGAGCCCGGGAGGTCATGG + Intergenic
1160649833 19:217838-217860 TGCTTTAGCCTAGGAGGTCAAGG + Intergenic
1160656484 19:274289-274311 AGCTTGAGCCAGGGAGGTCAAGG + Intergenic
1160891340 19:1380289-1380311 CGCTTGAGCCAGGGAGGTCAAGG - Intergenic
1161044160 19:2126041-2126063 TGCTTAAGCCCGGGAGGTCAAGG + Intronic
1161108975 19:2458253-2458275 TGTTTGAGCAAGAGAGGTCAAGG + Intergenic
1161353343 19:3805722-3805744 TGCTTGAGCCTGAGAGTTCAAGG - Exonic
1161673664 19:5629345-5629367 TGCTTAAGCCCAAGAGGTCAAGG + Intronic
1161763154 19:6189183-6189205 CACTTTAGCCAGCATGGTCAGGG - Intronic
1161915760 19:7226642-7226664 TGCTTGAGCCCAAGAGGTCAAGG + Intronic
1162054945 19:8056924-8056946 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1162060801 19:8093939-8093961 TGCTCAAGCCAGACTGGTCCAGG + Intronic
1162211341 19:9094621-9094643 TGCTTCAGCCAGGGAGGTCAAGG - Intergenic
1162291319 19:9783003-9783025 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1162314959 19:9933197-9933219 TATTTGAGCCAGTGTGGTCAGGG - Intronic
1162375380 19:10302115-10302137 TATTTTAGACTGAGTGGTCAAGG + Intergenic
1162375542 19:10303158-10303180 TATTTTAGTCTGAGTGGTCAAGG + Intergenic
1162388054 19:10372375-10372397 TGCTTGAGCCAGGGAGGTCATGG - Intronic
1162390881 19:10389457-10389479 TGCTTGAGCCCGGGAGGTCAAGG - Intergenic
1162486460 19:10963287-10963309 TGCTTGAGCCAGAGAGGTGGAGG + Intronic
1162618171 19:11818631-11818653 TGCTTGAGCCGGGGAGGTCAAGG - Intronic
1162626922 19:11892059-11892081 TGCTTGAGCCAGGGAGGTCAAGG - Intronic
1162851332 19:13433375-13433397 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1162851526 19:13434871-13434893 TGCTTAAGCCTGGGAGGTCAAGG - Intronic
1163032213 19:14552250-14552272 TGCTTGAGCCCGGGAGGTCAAGG - Intronic
1163226212 19:15963241-15963263 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1163244606 19:16085480-16085502 TGCTTGAGCCTGAGAGGACAAGG + Intronic
1163362502 19:16855971-16855993 AGCTTGAGCCAGGGAGGTCAAGG + Intronic
1163363689 19:16864208-16864230 TGCTTGAGCCAGAGAGGCCGAGG + Intronic
1163449389 19:17367024-17367046 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1163589750 19:18185953-18185975 TGCTTGGGCCTGAGAGGTCAAGG - Intergenic
1163634276 19:18431175-18431197 TGCAGTAGCCACAGTGGTCCTGG + Intronic
1163646288 19:18491164-18491186 TGCTTGAGCCAGGGAGGTCAAGG - Intronic
1163771048 19:19191661-19191683 TGCTTGAGCCCGGGAGGTCAAGG - Intronic
1163816585 19:19469226-19469248 TGCGTTAGCCAGGATGGTCTTGG - Intronic
1164277351 19:23732003-23732025 TGTGTTAGCCAGACTGGTCTCGG + Intergenic
1164650395 19:29887111-29887133 TCCTTTAGCCTGGGTGGTCAGGG - Intergenic
1164691199 19:30211823-30211845 TGCTTTGGACAGAGTTGTGAGGG - Intergenic
1164699414 19:30272994-30273016 TGCTTTAGCCTGGGAGGTCGAGG - Intronic
1164828955 19:31305695-31305717 TGCTCTAAACAGAGTGGGCAGGG - Intronic
1164860688 19:31560037-31560059 TACTTTAGACAGAGTGGTAAGGG - Intergenic
1164917375 19:32062711-32062733 TGCTTGAGCCCGAGAGTTCAAGG + Intergenic
1165018870 19:32906646-32906668 TGCTTTAGATACAGTGTTCAAGG - Intronic
1165194286 19:34089519-34089541 TGCTTGAGCCAGGGAGGTCGAGG - Intergenic
1165373712 19:35426614-35426636 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1165381304 19:35482615-35482637 TGCTTGAGCCAGGGAGGTGAAGG + Intergenic
1165382479 19:35490900-35490922 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1165557303 19:36645142-36645164 TGCTTGAGCCTGAGAGGTCCAGG + Intronic
1165558165 19:36654448-36654470 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1165688621 19:37844715-37844737 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1165750243 19:38255205-38255227 TGCTTGAGCCTGAGAGGCCAAGG - Intronic
1165828363 19:38718450-38718472 TGATTGAGCCAGGGAGGTCAAGG + Intronic
1165834864 19:38748116-38748138 TGCTTGAGCCCGGGAGGTCAAGG - Intronic
1165869788 19:38963376-38963398 TGCTTGAGCCTGGGAGGTCATGG - Intronic
1166223254 19:41378913-41378935 TGCTTAAGCCCGGGAGGTCAAGG - Intronic
1166378287 19:42341047-42341069 TGCTTGAGCCCGGGAGGTCAAGG - Intronic
1166390359 19:42405874-42405896 TGCTTCAGCCTGGGAGGTCAAGG + Intronic
1166550958 19:43665748-43665770 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1166557500 19:43710691-43710713 TGCTTGAGCCATGGAGGTCAAGG - Intergenic
1166573558 19:43815489-43815511 TACTTGAGCCAGGGAGGTCAAGG + Intronic
1166745087 19:45138037-45138059 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1167280973 19:48568378-48568400 TGCTTTAGCCAAGGTGGTCAGGG + Intronic
1167634678 19:50647594-50647616 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1168030186 19:53673319-53673341 TGTGTTAGCCAGGGTGGTCTCGG + Intergenic
1168054150 19:53852154-53852176 TACTTTAGATGGAGTGGTCAGGG - Intergenic
1168057689 19:53872588-53872610 TGCTTGAGCCTGTGGGGTCAGGG - Intronic
1168083246 19:54025861-54025883 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1168122270 19:54258153-54258175 TGCTTGAGCCTGGGTGGTCCAGG + Intronic
1168221973 19:54966923-54966945 TGCTTGAACCTGAGAGGTCAAGG - Intronic
1168236989 19:55069679-55069701 TGCTTCAGGTAGGGTGGTCAGGG - Intronic
1168424826 19:56231127-56231149 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1168636919 19:58003567-58003589 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
926182685 2:10659597-10659619 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
926261698 2:11269832-11269854 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
926819263 2:16834871-16834893 TGCTTAAGCCTGGGAGGTCAAGG - Intergenic
927212718 2:20648543-20648565 TGTTTGAGCAAGAGTGGCCAGGG - Intronic
927534236 2:23840988-23841010 TGCTTGAGCCTGGGTGGTCGAGG - Intronic
927543047 2:23929204-23929226 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
927560817 2:24071666-24071688 TACTTCAGCTAGGGTGGTCAGGG + Intronic
927796833 2:26056709-26056731 TGCTTGAGCCCGAGAGTTCAAGG - Intronic
928142291 2:28740200-28740222 TGCTTTAAACAGGGTTGTCATGG - Intergenic
928150154 2:28819925-28819947 TGCTTGAGCCAGGGAGATCAAGG + Intronic
928578446 2:32680506-32680528 TGTTTTAGACAAGGTGGTCAGGG + Intronic
929104154 2:38347467-38347489 TGATTTAGATTGAGTGGTCAGGG - Intronic
929168436 2:38906872-38906894 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
929188041 2:39115496-39115518 TGCTTGAGTCTGAGAGGTCAAGG - Intronic
929342235 2:40834529-40834551 ATCTTTAGACAGAGTGATCAAGG - Intergenic
929355065 2:41013965-41013987 TGCATTACACACAGTGGTCAAGG + Intergenic
929721830 2:44377088-44377110 TGCTTAAGCCTGGGAGGTCAAGG - Intronic
929729049 2:44467168-44467190 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
930031384 2:47060072-47060094 TGCTTGAGCCCAAGAGGTCAAGG + Intronic
930672178 2:54162902-54162924 TGCTTGAGCCTGAGAAGTCAAGG + Intronic
930808127 2:55512485-55512507 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
930916416 2:56694726-56694748 ACCTTTAGCCAGATTGATCAGGG + Intergenic
931294092 2:60904804-60904826 TGCTTCAGCCTGGGAGGTCAAGG + Intronic
931297583 2:60944042-60944064 CGCTTGAGCCCGAGAGGTCAGGG + Intronic
931333795 2:61318107-61318129 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
931421425 2:62131624-62131646 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
931702201 2:64918341-64918363 TGCTTGAGCCAGGGAGGTCGAGG - Intergenic
931753130 2:65348245-65348267 TGCTTTATATAGAGTGGGCAGGG - Intronic
931950337 2:67354769-67354791 TGCTTTCCCCAGTGTGTTCAGGG - Intergenic
932018096 2:68053582-68053604 TGCTTTAAACAGTCTGGTCATGG + Intronic
932033982 2:68221412-68221434 TGCTTGAGCCTGATAGGTCAAGG + Intronic
932192857 2:69755525-69755547 AGCTTGAGCCAGGGAGGTCAAGG + Intronic
932202547 2:69844733-69844755 TGCTTAAGCCATAGAGGTCAAGG + Intronic
932216532 2:69969796-69969818 TGCTTCAGCCCGGGAGGTCAAGG - Intergenic
932312562 2:70755382-70755404 TGCTTTAGCCAGAGTGGTCAGGG - Intronic
932363804 2:71132537-71132559 TGCTTTGGCTACAGTGGTCAAGG - Intronic
932385284 2:71326740-71326762 TGCTTTAGATAGAGTAGTCAGGG - Intronic
932499460 2:72170720-72170742 TGCTTGAGCCAGGGAGGTCAAGG + Intergenic
932550441 2:72764453-72764475 TGCTTGAGCCTGGGAGGTCAGGG - Intronic
932558219 2:72844067-72844089 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
932603875 2:73150639-73150661 TGCTTGAGCCAGGGAGGTCGAGG - Intronic
932630165 2:73335150-73335172 TGCTTGAGCCAAGGAGGTCAAGG - Intergenic
932635231 2:73382344-73382366 TTCCTTAGCCAGAGTTTTCATGG - Intergenic
932683400 2:73846996-73847018 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
933280250 2:80324906-80324928 TTCTTTAGATGGAGTGGTCAGGG - Intronic
933629201 2:84636808-84636830 TGCTTGAGCCTGAGATGTCAAGG + Intronic
933643203 2:84786340-84786362 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
933680196 2:85093088-85093110 TGCTTGAGCCAGAGAGGTCGAGG - Intergenic
933707515 2:85303112-85303134 TGCTTGAGCCCGGGAGGTCAAGG - Intronic
933899147 2:86836680-86836702 TGCTTGAGTCAGGGAGGTCAAGG + Intronic
934077073 2:88437591-88437613 CGCTTTAGCCAGGGAGATCAAGG - Intergenic
934085336 2:88504571-88504593 TGCTTGAGCCGAAGAGGTCAAGG + Intergenic
934557603 2:95295733-95295755 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
934722429 2:96590374-96590396 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
934878583 2:97951587-97951609 TCCTTTGGCCAGAGAGGACAGGG + Intronic
935148330 2:100411844-100411866 TGCCTTGGGCAGAGTGGTCTGGG + Intronic
935189226 2:100762645-100762667 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
935973252 2:108552671-108552693 TGCTTCAGCCTGGGAGGTCAAGG - Intronic
936408982 2:112236975-112236997 TGCTTGAGCCAAGGTGTTCAAGG + Intronic
937102344 2:119281422-119281444 AGCTTGAGCCAGGGTGGTCGAGG + Intergenic
937278335 2:120700737-120700759 TGCTTGAGCCCGGGAGGTCAAGG + Intergenic
937298632 2:120824917-120824939 TGCTTGAGCCCGGGTGGTCGAGG - Intronic
937682948 2:124664237-124664259 TGCTTGAGCCCAAGTGGTCAAGG + Intronic
937945589 2:127333046-127333068 TGATTGAGCCAGGGAGGTCAAGG + Intronic
938000563 2:127732002-127732024 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
938111265 2:128567274-128567296 TGCTTGAGCCGCAGAGGTCAAGG + Intergenic
938259347 2:129884138-129884160 CGCTTCAGCCTGAGAGGTCAAGG + Intergenic
938458941 2:131485254-131485276 TGATTAGGTCAGAGTGGTCAAGG - Intronic
939489496 2:142860169-142860191 TGCTTGAGCCTGAGAGGTCGAGG - Intergenic
939492696 2:142895766-142895788 TGCTTGAGCCAGGGAGATCAAGG - Intronic
939945894 2:148410511-148410533 TGCTTGAGCCAGAGTGGTCAAGG - Intronic
940326573 2:152431878-152431900 TGCTTGAGCCAGAGAGGTCAAGG + Intronic
940419321 2:153460756-153460778 TGCATTAATCAGAGTGGACATGG + Intergenic
940428075 2:153553416-153553438 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
940666119 2:156612073-156612095 TGCTTAAGTCCGAGGGGTCAAGG - Intronic
940704924 2:157092921-157092943 TGCTTGAGCCCAAGAGGTCAAGG + Intergenic
940835600 2:158517830-158517852 TGCCTGAGCCTGAGAGGTCAAGG + Intronic
940894705 2:159069850-159069872 TACTTGAGCCTGAGAGGTCAAGG - Intronic
940947567 2:159635971-159635993 TGCTTAAGCCTGGGAGGTCAAGG + Intergenic
941368576 2:164636493-164636515 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
941607726 2:167621170-167621192 TGCTTGAGCCCCAGAGGTCAAGG - Intergenic
941624846 2:167820306-167820328 TGCTTTAGAAAGGGTGGTTAGGG + Intergenic
941637571 2:167951708-167951730 TGCCTGAGCCTGAGAGGTCAAGG + Intergenic
941718026 2:168784137-168784159 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
941796917 2:169609290-169609312 TGCTTGAGCCAGGGAGGTCGAGG - Intronic
941926393 2:170899555-170899577 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
941936870 2:170988653-170988675 TGCTTGAGCCCGGGAGGTCAAGG + Intergenic
941963964 2:171282415-171282437 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
941978123 2:171427673-171427695 TGCTTTAGCCAGAGTGGTCAGGG - Intronic
941984956 2:171500932-171500954 TGCTTGAGCCTGGGTGGTGAAGG + Intergenic
941985031 2:171501873-171501895 TGCTTGAGCCCGAGAGTTCAAGG + Intergenic
941989864 2:171545053-171545075 TGCTTAAGCCTGGGAGGTCAAGG + Intronic
942132783 2:172897480-172897502 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
942146819 2:173035136-173035158 TGCTTGAGCCCAAGAGGTCAAGG - Intronic
942191438 2:173474409-173474431 TGCTTTAGCTAGGGTAGTCAGGG + Intergenic
942260832 2:174161579-174161601 TGCTTTAGCCCAAGTGTTCGAGG + Intronic
942324149 2:174761362-174761384 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
942643966 2:178091152-178091174 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
942754417 2:179322488-179322510 TGCTTGAGCCCCAGAGGTCAAGG + Intergenic
942803183 2:179899368-179899390 TACTTTAGACAGAGGGTTCAGGG - Intergenic
942970593 2:181953358-181953380 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
943340065 2:186670382-186670404 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
944063862 2:195598606-195598628 TGCTTGAGCCCAAGAGGTCAAGG + Intronic
944214368 2:197239313-197239335 TGCTTGAGCCCGGGTGGCCAAGG - Intronic
944323710 2:198378432-198378454 TGCTTGAGCCAGGGAGGTCGAGG - Intronic
944335742 2:198531742-198531764 TGCCTTAGTCATAGTGGTTAAGG + Intronic
944391197 2:199221680-199221702 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
944420681 2:199526832-199526854 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
944458963 2:199924321-199924343 TGCTTGAGCCTGATAGGTCAAGG + Intronic
944536750 2:200717751-200717773 CGCTTAAGCCTGTGTGGTCAAGG + Intergenic
944689473 2:202146713-202146735 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
944736879 2:202575116-202575138 TGCTTGAGCCCAGGTGGTCAAGG - Intergenic
944797650 2:203204412-203204434 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
944942386 2:204642908-204642930 TGTGTTAGCCAGGGTGGTCTTGG - Intronic
945079042 2:206070338-206070360 TGCTTGAGCCTGAGAGGTCGAGG + Intronic
945099279 2:206249646-206249668 TGCTTGAGCCAGGGAGGTCGAGG - Intergenic
945275139 2:207980650-207980672 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
945462643 2:210127713-210127735 TGCTTGAGCCCGGGAGGTCAAGG + Intronic
945893529 2:215456741-215456763 TGTTGTAGACAGAGTGATCAAGG + Intergenic
945894131 2:215463246-215463268 TGTTTTAGCCAGGATGGTCTCGG - Intergenic
945990682 2:216393034-216393056 CGCTTGAGCCAGGGAGGTCAAGG + Intergenic
946100982 2:217322943-217322965 TGCCTGAGCCTGAGAGGTCAAGG - Intronic
946275553 2:218629130-218629152 CGCTTAAGCCTGAGAGGTCAAGG + Intronic
946346630 2:219116438-219116460 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
946400953 2:219468272-219468294 TGCTTCATCCAGGGTGGGCAGGG + Intronic
946425045 2:219590129-219590151 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
946935792 2:224719229-224719251 CGCTTGAGCCAGGGAGGTCAAGG + Intergenic
946950745 2:224871784-224871806 TACTTTAGACAGGATGGTCATGG - Intronic
947214216 2:227735444-227735466 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
947226347 2:227844200-227844222 TGCTTGAGCCCAAGTGATCAAGG - Intergenic
947509260 2:230735595-230735617 TGCTTGAGCCAGTGAGGTCAAGG - Intronic
947538337 2:230955808-230955830 TGCTTGAGCCCGGGAGGTCAAGG - Intronic
947609693 2:231516682-231516704 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
947674941 2:231970027-231970049 TGCTTGAGCCCCAGAGGTCAAGG - Intronic
947774016 2:232693547-232693569 TGCTTGAGCCTGGGAGGTCAGGG - Intergenic
947811506 2:233007158-233007180 CGCTTGAGCCTGAGAGGTCAAGG + Intronic
947814884 2:233030126-233030148 TGCTTGAGCCTGAGAGGTGAAGG - Intergenic
947831591 2:233145529-233145551 TATTTTAGACAGGGTGGTCAGGG + Intronic
947969914 2:234314441-234314463 AGCTTTATACAGGGTGGTCAGGG + Intergenic
948354841 2:237369919-237369941 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
948819718 2:240535012-240535034 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
949016083 2:241711815-241711837 TGCTTGAGCCCGGGAGGTCAAGG + Intronic
1168784734 20:528497-528519 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1168792775 20:591167-591189 TATTTTAGCTAGGGTGGTCAGGG + Intergenic
1168812783 20:717074-717096 TGCTTGAGCCCAAGAGGTCAAGG - Intergenic
1168815434 20:733646-733668 CACATTAGCCAGGGTGGTCAGGG + Intergenic
1168835527 20:874794-874816 TGCTTGAGCCCAAGAGGTCAAGG - Intronic
1168852727 20:987705-987727 TGCTTGAGCCCAAGAGGTCAAGG + Intronic
1169082607 20:2806310-2806332 TGCTTTAGTCAGGGTAGTCAGGG - Intergenic
1169144190 20:3241638-3241660 TGTTTGAGCCAGGGAGGTCAAGG + Intergenic
1169330310 20:4711026-4711048 CGCTTGAGCCAGAGAGGTCAAGG - Intergenic
1169407744 20:5337290-5337312 TGCTTCAGCCAGAGAAGGCAGGG - Intergenic
1169433312 20:5559499-5559521 TGCTTGTGCCCGAGAGGTCAGGG + Intronic
1169449362 20:5698229-5698251 TGCTTGAGCCAGGAAGGTCAAGG - Intergenic
1169455617 20:5749935-5749957 TGCTTGAGCCTGAGAGGTCAAGG - Intergenic
1169582316 20:7037344-7037366 TGTTTTAGAGAGAGTGGTGAGGG - Intergenic
1169638743 20:7724508-7724530 TGTTTTAACTAGAGTGGTCAGGG + Intergenic
1169836141 20:9881539-9881561 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1170580459 20:17695360-17695382 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1170934994 20:20801969-20801991 TGCTTGAGCCTGAGAGGTCAAGG + Intergenic
1171045238 20:21804592-21804614 TGCTTTAGCCTGGGAGATCAAGG - Intergenic
1171388733 20:24787307-24787329 GGCTTTATCAAGAGCGGTCATGG - Intergenic
1171470407 20:25365954-25365976 TGCTTGAGCCCGGGAGGTCAAGG + Intronic
1172077911 20:32313789-32313811 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1172135865 20:32686333-32686355 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1172207548 20:33174825-33174847 TGCTTGAGCCGGAGAGGTCGAGG + Intronic
1172285947 20:33740586-33740608 TGCTTGAGCCTGGATGGTCAAGG - Intronic
1172288189 20:33756137-33756159 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1172315692 20:33952411-33952433 TGCTTGAGCCAAGGAGGTCAAGG + Intergenic
1172425885 20:34855876-34855898 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1172454031 20:35052181-35052203 TGCTTGAGCCTGAGAGGTTAAGG - Intronic
1172492754 20:35353706-35353728 TGCTTCAGCCTGGGAGGTCAAGG + Intronic
1172556369 20:35845447-35845469 TGCTTGAGCCCAAGAGGTCAAGG - Intronic
1172637570 20:36420324-36420346 TGCTTTGGACAGTGTGGTCAGGG + Intronic
1172899673 20:38325255-38325277 TACTTTAGACAAGGTGGTCAAGG + Intronic
1173016290 20:39228838-39228860 CGTATTAGCCAGAGTGGTCTTGG + Intergenic
1173018383 20:39247108-39247130 TGCTTTAGACAGGGTGACCAGGG - Intergenic
1173264626 20:41468064-41468086 TGATTTAGAAAGAGTGGTCTAGG - Intronic
1173494791 20:43510799-43510821 TGCTTGAGCCCGGGAGGTCAAGG - Intronic
1173506730 20:43593013-43593035 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1173508063 20:43604881-43604903 TGCTTAAGCCTGGGAGGTCAAGG - Intronic
1173559007 20:43989049-43989071 TGCTATCCCCAGTGTGGTCATGG + Intronic
1173789888 20:45821560-45821582 TGCTTGAGCCCGGGAGGTCAAGG + Intergenic
1173910554 20:46666585-46666607 TGCTTAAGCCAGGGAAGTCAAGG - Intronic
1173938307 20:46888150-46888172 TGTTTTAAACAGGGTGGTCAGGG + Intergenic
1173958365 20:47052283-47052305 TGCTTTAGCTGGAGTGGTCAGGG + Intronic
1174077168 20:47945968-47945990 TGCTTTAGCCAGGGTGGTCAGGG + Intergenic
1174195195 20:48767844-48767866 TGCTTCAGCCAGGATGGTCAGGG - Intronic
1174293029 20:49522312-49522334 TGCTCTAGCTGGGGTGGTCAGGG - Intronic
1174360270 20:50024468-50024490 TGGTTTAGCCAGGGTCATCAGGG - Intergenic
1174471683 20:50766258-50766280 CGCTTGAGCCAGAGAGGTCGAGG - Intergenic
1174627846 20:51929951-51929973 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1174808556 20:53626457-53626479 TGCTTCAGCCAAAGACGTCAAGG + Intergenic
1174852067 20:54005402-54005424 TGCTTGAGCCAGGGAGGTCAAGG + Intronic
1174901709 20:54507633-54507655 TGCTTTAGACTGAATGGTCAGGG + Intronic
1175105172 20:56609984-56610006 TACTTGAGCCTGAGAGGTCAAGG - Intergenic
1175112355 20:56657585-56657607 TCCCTTAGCGAGAGTGGTCAGGG + Intergenic
1175143674 20:56879898-56879920 TGCTTAAGCCTGAGAGGTCCAGG + Intergenic
1175173528 20:57095666-57095688 TACTTTGGCCAGGGTGGTCAGGG - Intergenic
1175203873 20:57296370-57296392 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1175255088 20:57638600-57638622 TGCTTGAGCCAGAGAGGTCAAGG - Intergenic
1175320154 20:58079784-58079806 GGCTTGAGCCTGAGAGGTCAAGG + Intergenic
1175822708 20:61918952-61918974 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1176341780 21:5705596-5705618 TGCCTGAGCCTGAGTGGTCAAGG + Intergenic
1176474034 21:7137748-7137770 TGCCTGAGCCTGAGTGGTCAAGG + Intergenic
1176503047 21:7618860-7618882 TGCCTGAGCCTGAGTGGTCAAGG - Intergenic
1176511509 21:7751907-7751929 TGCTTGAGCCTGGGAGGTCAGGG + Intronic
1176536101 21:8103665-8103687 TGCCTGAGCCTGAGTGGTCAAGG + Intergenic
1176971384 21:15270062-15270084 TGCTTGAGCCTGAGAGTTCAAGG - Intergenic
1177150975 21:17455182-17455204 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1177402906 21:20628927-20628949 TGCTTGAGCCTAAGTGTTCAAGG - Intergenic
1177769266 21:25496748-25496770 TGCTTGAGCCCAAGAGGTCAAGG + Intergenic
1178324472 21:31632556-31632578 TGCTTGAGCCAGGGAAGTCAAGG + Intergenic
1178439725 21:32588554-32588576 TGCTTGAGCCTAAGAGGTCAAGG - Intronic
1178645623 21:34382436-34382458 TGCTTGAGCCTGGGAGGTCAGGG + Intronic
1178890097 21:36513913-36513935 TGCTTGAGCCCGGGAGGTCAAGG - Intronic
1178956850 21:37030427-37030449 AGCTTGAGCCAGGGAGGTCAAGG - Intergenic
1178990713 21:37353427-37353449 CGCTTGAGCCCGAGAGGTCAAGG - Intergenic
1179005545 21:37510959-37510981 AGCATCAGCCAGAGTGGTCAGGG + Intronic
1179196671 21:39170647-39170669 TGCTTGAGCCTGAGCGGTCAAGG + Intergenic
1179247042 21:39642966-39642988 TGCTTGAGCCCGAGAGGTCAAGG + Intronic
1179480677 21:41675783-41675805 TGCTTGAGCCTGAGAAGTCAAGG + Intergenic
1179609661 21:42541823-42541845 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1180703965 22:17797408-17797430 TGCTTGAGCCCGGGAGGTCAAGG + Intronic
1180832773 22:18914529-18914551 TGCTTTAGACTGGGTGGTCCCGG - Intronic
1181284999 22:21745637-21745659 TGCTTGAGCCCGGGAGGTCAAGG - Intergenic
1181297959 22:21857106-21857128 CGCTTGAACCTGAGTGGTCAAGG - Intronic
1181472022 22:23146290-23146312 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1181925142 22:26352075-26352097 TGCTTGAGCCCAAGAGGTCAAGG + Intronic
1181954541 22:26578933-26578955 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1182075028 22:27489746-27489768 TGCTTTAGCTAGGGAGGTCGAGG - Intergenic
1182619773 22:31612636-31612658 TGCTTGAGCCCGGGAGGTCAAGG + Intronic
1182760931 22:32721841-32721863 TGCTTTAGATGGGGTGGTCAGGG + Intronic
1182878911 22:33716484-33716506 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1183021988 22:35034752-35034774 TCCTTTAAACAGAGTAGTCAGGG + Intergenic
1183045389 22:35215367-35215389 TGCTTGAGCCTGAGAAGTCAAGG + Intergenic
1183146569 22:35997916-35997938 TGCTTGAGCCTGAGAAGTCAAGG + Intronic
1183343008 22:37292461-37292483 TGCTTTAGACAGGGCAGTCAGGG + Intronic
1183396655 22:37575542-37575564 TGCTTGAGCCCAAGAGGTCAAGG - Intronic
1183556602 22:38532701-38532723 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1183926237 22:41208213-41208235 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1184052041 22:42014307-42014329 TGCTTCAGCCTGGGAGGTCAAGG - Intronic
1184181611 22:42831864-42831886 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1184513440 22:44946129-44946151 TGCTGGAGCCAGAGTGGTCACGG + Intronic
1184619026 22:45660191-45660213 TGCTTAAGCCCAAGAGGTCAAGG - Intergenic
1184699456 22:46160682-46160704 TGCTTGAGCCAGAGAGGTGGAGG - Intronic
1203241047 22_KI270733v1_random:20062-20084 TGCCTGAGCCTGAGTGGTCAAGG + Intergenic
1203282858 22_KI270734v1_random:139833-139855 TGCTTTAGACTGGGTGGTCCCGG - Intergenic
949254515 3:2029931-2029953 TGCTTGAGCCAGGGAGGTCAAGG + Intergenic
949469219 3:4376877-4376899 TGCTTGAGCCCAGGTGGTCAAGG - Intronic
949486511 3:4544876-4544898 TGCTTAAGCCTAAGAGGTCAAGG - Intronic
949489161 3:4571422-4571444 TGCTTGAGCCCCAGAGGTCAAGG - Intronic
949529906 3:4945621-4945643 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
949967487 3:9370526-9370548 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
950069540 3:10141472-10141494 CGCTTGAGCCAGGGAGGTCAAGG + Exonic
950103881 3:10376317-10376339 TACTTTAGCTAGGGTGGCCAGGG + Intronic
950238859 3:11349451-11349473 TGCTTGAGCCTAGGTGGTCAAGG + Intronic
950261581 3:11546052-11546074 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
950281043 3:11708289-11708311 TACTTTAGCTAGCGTGGTCTGGG + Intronic
950420102 3:12893315-12893337 TGCTTTAACCAGTGAGGTCAAGG - Intergenic
950705662 3:14778489-14778511 TGCTTAAGCCTGGGAGGTCAAGG + Intergenic
950784627 3:15423798-15423820 TGCTTGAGCCAGGGGGGTCAAGG + Intronic
951124186 3:18963924-18963946 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
951224526 3:20105711-20105733 TGCTTGAGCCCGGGAGGTCAAGG + Intronic
951464622 3:22989022-22989044 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
952295894 3:32061720-32061742 GGCTTCAGCCTGAGAGGTCAAGG - Intronic
952397474 3:32933666-32933688 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
952482068 3:33771632-33771654 CGCTTGAGCCAGGGAGGTCAAGG + Intergenic
952688466 3:36176075-36176097 TGCTTCAGCCTGAGGTGTCAGGG + Intergenic
952758291 3:36891390-36891412 TGCTTTAGCCAGATTTGTCCTGG - Intronic
952758784 3:36895302-36895324 TGCTTTAGCTAGTGTGTTCCCGG - Intronic
952923295 3:38302571-38302593 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
952958126 3:38572967-38572989 TGCTTGAGCCTGAGAGGTCAAGG - Intronic
953031427 3:39182432-39182454 TGCCTTAGACGGAGTGGCCAAGG - Intergenic
953332896 3:42069235-42069257 TGCTTTAGCCCGGGAGGTCAAGG + Intronic
953604479 3:44402324-44402346 TGATTGAGCCTGGGTGGTCAAGG + Intronic
953604887 3:44405587-44405609 TGCCTAAGCCTGGGTGGTCAAGG + Intronic
953869489 3:46614000-46614022 TGCTTGAGCCCAAGAGGTCAAGG - Intronic
954022921 3:47758444-47758466 TGCTTAAGCCCTAGAGGTCAAGG + Intronic
954113868 3:48452966-48452988 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
954283394 3:49600718-49600740 TGCTTGAGCCAGGGAGGTCGAGG + Intronic
954350860 3:50042650-50042672 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
954505078 3:51062489-51062511 TGCTTTAGGTGGAGTGGTCAGGG - Intronic
954559608 3:51545661-51545683 TGCTCGAGCCTGAGAGGTCAAGG - Intronic
954560370 3:51551214-51551236 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
954583585 3:51716652-51716674 TGCTTCAGATAGGGTGGTCAGGG + Intronic
954733776 3:52687714-52687736 TGCTTGAGCCTGGGTGGTCCAGG - Intronic
954770487 3:52963530-52963552 TGCTTGAGCCAGGGTGGTTGAGG - Intronic
954811004 3:53247832-53247854 TATTTTAGACAGTGTGGTCAGGG - Intronic
955087849 3:55720367-55720389 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
955208047 3:56915380-56915402 TGCTTGAGCCCGGGCGGTCAAGG + Intronic
955270568 3:57494147-57494169 TGCTTGAGCCAGGGAGGTCAAGG + Intronic
955283572 3:57617318-57617340 TGCTTAAGCCCGGGAGGTCAAGG + Intergenic
955345687 3:58159937-58159959 TGCCTTAACCTGAGAGGTCAAGG + Intronic
955347569 3:58172428-58172450 TGCTTGAGCCTGAGAGGCCAAGG + Intergenic
955357102 3:58240066-58240088 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
955490244 3:59474816-59474838 GGCTTGAGCCAGGGAGGTCAAGG - Intergenic
955536061 3:59924928-59924950 TGCTTCTGCCAGTGTGGGCACGG + Intronic
955836087 3:63056830-63056852 TGCTTGAGCCAGAGAAGTAAAGG + Intergenic
955908466 3:63832576-63832598 TGCTTAAGCCTGGGAGGTCAAGG + Intronic
956191982 3:66616655-66616677 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
956426150 3:69137733-69137755 TGCTTCAGCCCGGGAGGTCAAGG - Intergenic
956464600 3:69506617-69506639 TGCTTGAGCCAGGGAGGTCGAGG - Intronic
956563120 3:70604319-70604341 TGCTTGAGCCTGGGAGGTCAGGG + Intergenic
956733626 3:72218765-72218787 TCTGTTAGACAGAGTGGTCAGGG - Intergenic
956762727 3:72458113-72458135 CGCTTGAGCCAGGGAGGTCAAGG + Intergenic
957006745 3:74957440-74957462 TACTTGAGCCTGAGAGGTCAAGG + Intergenic
957227085 3:77463662-77463684 TGCTTGAGCCCAGGTGGTCAAGG - Intronic
958021842 3:88006870-88006892 TGTTTTAGTTAGGGTGGTCAGGG - Intergenic
958270190 3:91490115-91490137 TGCTTGAGCCAGGGAGATCAAGG + Intergenic
958889811 3:99770926-99770948 TGCCTTCGCCAGAGTGGTCAAGG + Intronic
959066945 3:101667135-101667157 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
959068444 3:101680580-101680602 CGCTTGAGCCAGGGAGGTCAAGG - Intergenic
959236039 3:103722788-103722810 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
959772448 3:110115821-110115843 TGCTTTAGATAGGGTGGCCAAGG + Intergenic
960189758 3:114689142-114689164 TGCTCTACCTAGAGTGGTGAAGG - Intronic
960356859 3:116664280-116664302 TGCTTGAGCCAGGGAGGTCGAGG - Intronic
960599768 3:119444994-119445016 TGCTTGAGCCTGAGAGGTCAAGG + Intronic
960613095 3:119572667-119572689 TGCTTGAGCCTGAGAGTTCAAGG - Intergenic
960641414 3:119827514-119827536 TGCTTGAGCCAGAGAGGTTGAGG + Intronic
960810013 3:121619077-121619099 CGCTTGAGCCTGAGAGGTCAAGG - Intronic
960878079 3:122316338-122316360 TTCTATAGCCAGAGAAGTCAAGG + Intergenic
960915370 3:122689387-122689409 TGCTTGAGCCAGGGAGGTCGAGG - Intronic
960958383 3:123051437-123051459 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
961030417 3:123598544-123598566 TGCTTTAGCCTGGGAGTTCAAGG - Intergenic
961142633 3:124567889-124567911 TGCTTGAGCCTGAGGGTTCAGGG + Intronic
961157897 3:124696352-124696374 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
961408096 3:126697633-126697655 TGCTTTAGCCCGGGAAGTCAAGG - Intergenic
961770645 3:129247614-129247636 TGCTTAAGCCTGGGAGGTCAAGG - Intergenic
961814396 3:129541765-129541787 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
961938842 3:130615888-130615910 TGCTTTGGCAAGATTGGTCATGG + Intronic
962208646 3:133457235-133457257 GGCTGTAGCCAGTGTGCTCAAGG + Intronic
962219231 3:133549748-133549770 TGCTTGAGCCCTAGAGGTCAAGG + Intergenic
962254148 3:133859060-133859082 TGCTTGAGCCTGTGAGGTCAAGG - Intronic
962752882 3:138446949-138446971 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
962820150 3:139040423-139040445 TGCTTGAGCATGAGAGGTCAAGG + Intronic
962940328 3:140119596-140119618 TGATTGAGCCTGAGAGGTCAAGG - Intronic
963093541 3:141510607-141510629 TGCTTTAGATAGAATAGTCAAGG + Intronic
963147034 3:142005129-142005151 TGCTTGAGCCCAAGAGGTCAAGG - Intronic
963171772 3:142258112-142258134 TGCTTGAGCCCGGGAGGTCAAGG + Intergenic
963659603 3:148108141-148108163 TGCTTGAGCCAGGGAGGTCGAGG - Intergenic
963849427 3:150195538-150195560 TGCTTTAGCCTGGGAGGTCAAGG - Intergenic
963873147 3:150441668-150441690 TGCTTGGGCCTGAGAGGTCAAGG + Intronic
963894737 3:150673269-150673291 TGCTTGAGCCCGAGGGGTCAAGG - Intronic
963902917 3:150749419-150749441 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
964097610 3:152951348-152951370 TGCTTGAGCCTGAGAGGTCCAGG + Intergenic
964215024 3:154270393-154270415 TGCTTAAGCCTGGGAGGTCAGGG - Intergenic
964407103 3:156360629-156360651 TGCTTGAGCCCAAGAGGTCAAGG + Intronic
964437638 3:156671433-156671455 TGCTTGAGCCCAAGAGGTCAAGG - Intergenic
964459255 3:156904541-156904563 TGCTTGAGCCCGAGCGTTCAAGG - Intronic
964625344 3:158753370-158753392 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
965523233 3:169689717-169689739 TACTTTAGAGTGAGTGGTCAGGG - Intergenic
965578987 3:170247143-170247165 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
965600179 3:170446648-170446670 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
965779292 3:172267237-172267259 TGCTTGAGCCAGGGAGGTCGAGG - Intronic
966138032 3:176722957-176722979 TGCTTGAGCCCATGTGGTCAAGG + Intergenic
966513502 3:180791033-180791055 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
966645597 3:182243578-182243600 TTCTTGAGCCAGGGAGGTCAAGG - Intergenic
966730586 3:183147796-183147818 TGCTTGAGCCTAAGAGGTCAAGG - Intronic
966781343 3:183587034-183587056 TGCTTTAGAAAGAGTGCTCAGGG + Intergenic
967083105 3:186069158-186069180 TGCTTTAGGTAGAGTAGTAAAGG - Intronic
967462555 3:189763188-189763210 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
967606280 3:191450872-191450894 AGCTTGAGCCAGGGAGGTCAAGG - Intergenic
967777318 3:193397860-193397882 AACATTAGACAGAGTGGTCAGGG + Intergenic
967957960 3:194892497-194892519 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
968368016 3:198202291-198202313 TGCTTTAGCCTAGGAGGTCAAGG - Intergenic
968508124 4:981552-981574 TGCTTGAGCCTGAGAGGTCGAGG + Intronic
968764648 4:2462071-2462093 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
970221297 4:13814761-13814783 TGCTTGAACCAGTGAGGTCAGGG - Intergenic
970607607 4:17695244-17695266 TGCTTGAGCCCGGGTGGTCAAGG - Intronic
970822989 4:20241261-20241283 TGCTTGAGCCCGGGAGGTCAAGG - Intergenic
970885673 4:20985020-20985042 TGATTCAGCCAGTGTGGTCCTGG - Intronic
971109346 4:23565639-23565661 TGCTTGAGCCTGAGAAGTCAAGG + Intergenic
971220754 4:24703949-24703971 TGCTTTAGCCTGGGAGGTCAAGG + Intergenic
971322551 4:25617000-25617022 TGCTTGAGCCCAAGAGGTCAAGG + Intergenic
971762879 4:30790837-30790859 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
971915841 4:32868804-32868826 TGCTTGAGCCAGGGTGGTCAAGG - Intergenic
971915982 4:32870468-32870490 TGCTTGAGCCAGGAAGGTCAAGG - Intergenic
972281251 4:37603900-37603922 TGCTTAAGCCTGCGAGGTCAAGG - Intronic
972514903 4:39802464-39802486 TGTTTTAGCTAGGATGGTCAGGG - Intergenic
972521441 4:39860979-39861001 TGCTTTAGCCCAGGAGGTCAAGG + Intronic
972638147 4:40902615-40902637 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
972663767 4:41143927-41143949 TGCTTTAGCTAGAGGAATCAGGG + Intronic
972749089 4:41970717-41970739 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
973042735 4:45492772-45492794 TGCTTGAGCCTGAGAGGTCAAGG + Intergenic
973286345 4:48421097-48421119 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
973768546 4:54186281-54186303 TGCTTGAGCCAGGGAGGCCAAGG - Intronic
973859855 4:55052413-55052435 CGCTTGAGCCTGAGAGGTCAAGG - Intergenic
973878828 4:55248323-55248345 TACCTTAGTCAGAGAGGTCATGG + Intergenic
973958941 4:56090479-56090501 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
974421557 4:61683194-61683216 TGCTTAAGCCAGGGAGGTCCAGG - Intronic
974618505 4:64323311-64323333 TGCTTGAGCCAGGGAGGTCAAGG + Intronic
974864016 4:67557874-67557896 TGTTTGAGCCTGAGAGGTCAAGG + Intergenic
974930246 4:68352726-68352748 TGCTTGAGCCGGCGAGGTCAAGG + Intergenic
975323401 4:73033879-73033901 TGCTTGAGCCCAAGAGGTCAAGG + Intergenic
975429104 4:74267500-74267522 TGCTTAAGCCCGGGTGGGCAGGG - Intronic
975439386 4:74393747-74393769 GTCTTTAGCTAGGGTGGTCAAGG + Intergenic
975777072 4:77798893-77798915 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
975815077 4:78209059-78209081 TTCTTGAGCCAGGGAGGTCAAGG + Intronic
975863103 4:78698905-78698927 CGCTTGAGCCAGGGTGGTCAAGG - Intergenic
975944293 4:79685901-79685923 TGCATTAGACAGACTGATCAGGG - Intergenic
975964928 4:79961516-79961538 TGCTTGAGCCAGGGATGTCAAGG - Intronic
976057332 4:81083388-81083410 TGCTTGAGCCGGGGAGGTCAAGG + Intergenic
976090798 4:81455352-81455374 TGATTAAGCCAGAGAAGTCAAGG + Intronic
976185071 4:82435183-82435205 TGCTTAAGCCTGAGAGGTCGAGG - Intronic
976259083 4:83128611-83128633 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
976280388 4:83321112-83321134 TGCTTGAGCCCAAGAGGTCAAGG + Intronic
976304196 4:83543214-83543236 TGCTTCAGCCTGGGAGGTCAAGG + Intronic
976405902 4:84659990-84660012 GGCTTAAGCCTGAGAGGTCAAGG + Intergenic
976669309 4:87634695-87634717 TGCATTAGCCCGTGAGGTCAAGG - Intergenic
976705723 4:88016880-88016902 TGTTTGAGCCCGGGTGGTCAAGG + Intronic
976708055 4:88039579-88039601 TGCTTGAGCCCGAGTGGTGGGGG + Intronic
976752708 4:88466168-88466190 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
976781348 4:88762039-88762061 TGTTTTATACTGAGTGGTCAGGG + Intronic
976831702 4:89322316-89322338 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
977300062 4:95257318-95257340 GGCTTTAGCCTGGGAGGTCAAGG + Intronic
977504393 4:97883302-97883324 TGCTTGAGCCTGAGAGATCAAGG + Intronic
977550148 4:98433377-98433399 TGCTTGAGCCAGGGAGCTCAAGG - Intronic
977801621 4:101240951-101240973 TGCTTAAGCCTGGGAGGTCAAGG - Intronic
978172495 4:105689820-105689842 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
978505182 4:109449305-109449327 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
978578826 4:110212526-110212548 TGCTTGAGCCCGGGAGGTCAAGG + Intergenic
978712385 4:111800066-111800088 TGCCTCAGCCAGAGTGGTGGTGG + Intergenic
978752097 4:112261346-112261368 TGCTTGAGCCAGAGAGGTCAAGG + Intronic
979256442 4:118612006-118612028 TGCTTTAGCCTAGGAGGTCAAGG - Intergenic
979331908 4:119428531-119428553 TGCTTTAGCCTAGGAGGTCAAGG + Intergenic
979563157 4:122122859-122122881 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
979612904 4:122708093-122708115 CACTTGAGCCAGAGAGGTCAAGG - Intergenic
979798025 4:124871592-124871614 TGCTTGAGCCTGAGAGGTCGAGG - Intergenic
980143686 4:128953589-128953611 TGTGTTAGCCAGAATGGTCTCGG - Intronic
980313082 4:131160827-131160849 CGCTTTAGCCTGAGAGGTCAAGG + Intergenic
980315158 4:131189755-131189777 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
980379957 4:132000918-132000940 TGCTTGAGCCAGGGAGGTCAAGG - Intergenic
980939620 4:139261234-139261256 TGCTTAAGCCTGGGAGGTCAAGG - Intergenic
981566029 4:146102615-146102637 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
981682936 4:147421094-147421116 TGCTTAAGTCAGAGAGTTCAAGG + Intergenic
982153004 4:152483612-152483634 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
982244658 4:153339707-153339729 TGCTTGAGCCAGGGAGGTCGAGG - Intergenic
982532142 4:156558464-156558486 TGCTTTAGCCCCAGTGGTGGTGG + Intergenic
982644855 4:158010514-158010536 TGCTTGAGTCAGGGAGGTCAAGG - Intergenic
982652055 4:158098835-158098857 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
983052445 4:163064194-163064216 CGCTTGAGCCAGGGAGGTCAAGG + Intergenic
983222719 4:165058249-165058271 TCCTTGAGCCACAGAGGTCAAGG - Intergenic
983311961 4:166076154-166076176 TGCTTAAGCCTGGGAGGTCAAGG - Intronic
983521798 4:168717003-168717025 TGCTTTAGACTGGGTGGTCAGGG - Intronic
983571200 4:169209871-169209893 CGCTTGAGCCTGAGAGGTCAAGG - Intronic
983579286 4:169291913-169291935 TGCTTGAGCCCAAGAGGTCAAGG - Intergenic
984530011 4:180904503-180904525 TGCTTGAGCCCGTGAGGTCAAGG - Intergenic
984622726 4:181972333-181972355 TACTCGAGCCAGAGAGGTCAAGG + Intergenic
984738655 4:183137580-183137602 TGTTTGAACCAGAGAGGTCAAGG - Intronic
984783535 4:183547483-183547505 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
984864973 4:184273518-184273540 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
984967983 4:185157370-185157392 CGCTTGAGCCAGGGAGGTCAAGG + Intergenic
985060184 4:186070466-186070488 TGCTTGAGCCAGGGAGGTCAAGG - Intronic
985340733 4:188950585-188950607 TGCTTGAGCCCGGGAGGTCAAGG - Intergenic
985393466 4:189515728-189515750 TGCTTTAGACAGAGTGGTCAGGG + Intergenic
985930627 5:3054664-3054686 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
986717706 5:10535736-10535758 TGCTTGAGCCCGAGAGTTCAAGG - Intergenic
987127233 5:14825433-14825455 TGCTTGAGCCCAAGAGGTCAAGG - Intronic
987358012 5:17082059-17082081 TGCTTGAGCCCGGGAGGTCAAGG + Intronic
987360727 5:17104154-17104176 CACTTGAGCCAGAGAGGTCAAGG - Intronic
987601534 5:20078377-20078399 TGCTTGAACCAGGGTGGTAAAGG + Intronic
987691303 5:21270119-21270141 TGCTTGAGCCAAGGAGGTCAAGG - Intergenic
987989462 5:25191605-25191627 TGCTTGAGCCAGGGAGGTCAAGG - Intergenic
987996727 5:25291871-25291893 CACTTGAGCCAGGGTGGTCAAGG + Intergenic
988515035 5:31896871-31896893 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
988552531 5:32209757-32209779 TGCTTGAGCCCGGGAGGTCAAGG - Intergenic
988569858 5:32353591-32353613 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
988590855 5:32547932-32547954 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
988594842 5:32581996-32582018 TGCTTGAGCCTGAGAGGTCGAGG - Intronic
988681834 5:33491038-33491060 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
988781792 5:34529168-34529190 CACTTGAGCCAGAGAGGTCAAGG + Intergenic
988866488 5:35340566-35340588 TGCTTGAGCCAGGGAGGCCAAGG + Intergenic
989189125 5:38653099-38653121 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
989241987 5:39212222-39212244 TGCTTGAGCCCGGGAGGTCAAGG + Intronic
989382921 5:40826859-40826881 TGCTTGAGCCTGGGAGGTCAAGG - Exonic
989588416 5:43091274-43091296 TGCTTTCACCAGAGTGGCCTGGG - Intronic
990037321 5:51337460-51337482 TACTTTAGACTGGGTGGTCAAGG - Intergenic
990387392 5:55279589-55279611 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
990436458 5:55796923-55796945 CGCTTCAGCCAGGGAGGTCAAGG - Intronic
990454480 5:55971748-55971770 TGCTTGAGCCCAAGAGGTCAAGG + Intronic
990718399 5:58665104-58665126 TGTTTTAGACAAACTGGTCAGGG - Intronic
990772020 5:59258210-59258232 TACTTTAGTTGGAGTGGTCAGGG - Intronic
990779570 5:59344483-59344505 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
991072529 5:62500196-62500218 TGCTTGAGCCTAAGAGGTCAAGG + Intronic
991682683 5:69154226-69154248 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
991735018 5:69623947-69623969 TGCTTGAGCCAGAGAGGTCAAGG - Intergenic
991779960 5:70122771-70122793 TGCTTGAGCCAGAGAGGTCAAGG + Intergenic
991811452 5:70479082-70479104 TGCTTGAGCCAGAGAGGTCAAGG - Intergenic
991859247 5:70998201-70998223 TGCTTGAGCCAGAGAGGTCAAGG + Intronic
991872407 5:71123094-71123116 TGCTTGAGCCAGAGAGGTCAAGG + Intergenic
991985779 5:72285181-72285203 TGCCTTAACCAGAGAGATCAGGG - Intronic
992009993 5:72516382-72516404 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
992171004 5:74102109-74102131 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
992208624 5:74455348-74455370 TGCTTGAGCCCGAAAGGTCAAGG + Intergenic
992301700 5:75388707-75388729 TCCTTGAGCCAGGGAGGTCAAGG - Intronic
992399784 5:76402156-76402178 TGCTTGAGCCCGAGAGGACAAGG - Intergenic
992412126 5:76515959-76515981 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
992466893 5:77015081-77015103 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
992666774 5:79018129-79018151 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
992682785 5:79169375-79169397 TTCTTGAGCCAAAGAGGTCAAGG + Intronic
992712001 5:79467858-79467880 CGCTTGAGCCTGAGAGGTCAAGG - Intronic
992715445 5:79506751-79506773 TGCTTGAGTCTGAGAGGTCAAGG + Intronic
992841304 5:80697989-80698011 TGCTTGAGCCTGGGGGGTCAAGG - Intronic
992947342 5:81823308-81823330 TGCTTGAGCCTGAGAGGTCAAGG + Intergenic
992985819 5:82228121-82228143 CGCTTGAGCCTGAGAGGTCAGGG + Intronic
993115715 5:83718078-83718100 TGTTTTAGACAGACAGGTCATGG - Intronic
993265257 5:85718622-85718644 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
993464641 5:88230100-88230122 TGCTTGAGCCTGAGAAGTCAAGG + Intronic
993513668 5:88802528-88802550 GGCTTGAGCCTGAGAGGTCAAGG - Intronic
993706492 5:91177588-91177610 TGCTTGTGCCTGAGAGGTCAAGG - Intergenic
993713984 5:91256255-91256277 TGCTTGAGCCCGAGAGGTTAAGG - Intergenic
993839416 5:92858526-92858548 TGCTTGAGCCCAAGAGGTCAAGG + Intergenic
993943594 5:94092260-94092282 TGCTTGAGCCTGAGAGGTCAAGG + Intronic
994418052 5:99499597-99499619 TGCTTTAGCCTGAGAGGTGGAGG + Intergenic
994461913 5:100075556-100075578 TGCTTTAGCCTGAGAGGTGGAGG - Intergenic
994472375 5:100224272-100224294 TATTTTAGGCAGAGTGGCCAAGG - Intergenic
995115737 5:108476713-108476735 TGCTTGAGCCCAAGAGGTCAAGG + Intergenic
995147241 5:108800432-108800454 TGCTTGAGCCTGGGTGGTCAAGG - Intronic
995296063 5:110523875-110523897 TGCTTGAGCCCAAGAGGTCAAGG + Intronic
995493063 5:112712468-112712490 TGCTTGAGCCTGAGAGGTCTAGG - Intronic
995513029 5:112926819-112926841 TGCTTGAGCCCAAGAGGTCAGGG - Intergenic
995517166 5:112965836-112965858 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
995734114 5:115280634-115280656 TGCTTGAGCCAGGGAGGTCAAGG - Intronic
995826825 5:116309399-116309421 TGCTTGAACCTGAGAGGTCAAGG - Intronic
996035556 5:118754563-118754585 TGCTTGAGCCTGAGAGGTCAAGG + Intergenic
996370572 5:122748609-122748631 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
996520510 5:124420786-124420808 TGCATTAGCCTCAGTGGCCATGG + Intergenic
996585202 5:125079864-125079886 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
996719242 5:126613857-126613879 TGCTTGAGCCAGGGAGGTCGAGG - Intronic
996884478 5:128339489-128339511 TGCTTGAGCCCAAGAGGTCAAGG + Intronic
996899923 5:128532954-128532976 AGCTTGAGCCCGAGAGGTCAAGG + Intronic
997922988 5:138000313-138000335 TGCTTGAGCCTGAAAGGTCAAGG + Intronic
997929085 5:138057588-138057610 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
997966737 5:138363211-138363233 TTTTTTAGACAGAGTGGTCAGGG - Intronic
998243285 5:140470705-140470727 TGCTTGAGACTGAGAGGTCAAGG - Intronic
998322364 5:141244657-141244679 TGCTTGAGCCTGGGTAGTCAAGG + Intergenic
998444892 5:142191100-142191122 TTATTAAGCCAGAGTGGGCATGG - Intergenic
998468347 5:142363804-142363826 GGCTTGAGCCAGGGAGGTCATGG + Intergenic
998485012 5:142494381-142494403 TGCTTGAGCCCAAGAGGTCAGGG - Intergenic
998795217 5:145811370-145811392 CGCTTGAGCCTGGGTGGTCAAGG - Intronic
998968984 5:147570730-147570752 TGCTTGAGCTAGACAGGTCAAGG + Intergenic
999112736 5:149136322-149136344 TGATTTAGCTAGACTGGTCATGG + Intergenic
999211338 5:149891717-149891739 TGCTTGAGCCTGAGAGGTCAAGG + Intronic
999220006 5:149967831-149967853 TGCTTGAGCCAAGGAGGTCAAGG - Intronic
999411296 5:151352162-151352184 TCCTTTAGATAGAGTTGTCAAGG - Intergenic
999506770 5:152206698-152206720 TACTTTAGCTAAGGTGGTCAGGG + Intergenic
999591893 5:153157371-153157393 TGCTTTGGTCAGTGTGGTCTAGG + Intergenic
999707021 5:154282977-154282999 TGATCTAGCCAGAGGGGTTAGGG + Intronic
999829955 5:155309048-155309070 TGCTTGAGCCCAAGAGGTCAAGG - Intergenic
999994294 5:157077479-157077501 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1000001818 5:157145792-157145814 TACTTTACACAGGGTGGTCAGGG + Intronic
1000072075 5:157750165-157750187 CGCTTGAGCCAGGGAGGTCAAGG + Intronic
1000173648 5:158728645-158728667 TGCTTAAGCCTAGGTGGTCAAGG - Intronic
1000623796 5:163515856-163515878 TGCTTAAGCCAAGGAGGTCAAGG - Intronic
1001020236 5:168176531-168176553 TGCTTTAGACAGGGAGGGCAGGG - Intronic
1001124563 5:169007813-169007835 TGCTTCAGCAAGAGAAGTCATGG - Intronic
1001389014 5:171363451-171363473 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1001467699 5:171983104-171983126 TGCTTAAGCCCGAAAGGTCAAGG + Intronic
1001819285 5:174697059-174697081 TGGTTTTGACTGAGTGGTCAGGG - Intergenic
1001925552 5:175633633-175633655 TCATTTAGACAGGGTGGTCAGGG + Intergenic
1002062092 5:176631113-176631135 TGCTTGAGACAGGGTGCTCAGGG + Intronic
1002209647 5:177590129-177590151 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1002275333 5:178100777-178100799 GGATTTAGCCTGAGAGGTCAAGG + Intergenic
1002281850 5:178135227-178135249 TGCTTGAGCCCGGGAGGTCAAGG - Exonic
1002288481 5:178181654-178181676 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1002629450 5:180561032-180561054 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1002727235 5:181307520-181307542 TGCTTTAGCCTAGGAGGTCAAGG - Intergenic
1003009076 6:2409600-2409622 TGCTTGAGCCCGGGAGGTCAAGG - Intergenic
1003054800 6:2808350-2808372 TGCTTGAGCCTGAGAGGTCGAGG + Intergenic
1003448674 6:6210144-6210166 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1003543284 6:7037021-7037043 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1004100932 6:12610755-12610777 TGCTTGAGCCAGGGAGGTCAAGG - Intergenic
1004381189 6:15133987-15134009 TGCTTGAGCCCTAGAGGTCAAGG - Intergenic
1004725678 6:18309084-18309106 TGCTTGAGCCCAAGGGGTCAAGG - Intergenic
1004877771 6:19972994-19973016 TGCTTGAGCCTCAGAGGTCAAGG - Intergenic
1004915261 6:20326045-20326067 TGCTTTAGCCCAGGAGGTCAAGG + Intergenic
1004973414 6:20937170-20937192 GGCTTGAGCCAGGGAGGTCAAGG - Intronic
1005121765 6:22398202-22398224 TGCTTGAGCCAGCGTGGTTGAGG - Intergenic
1005955811 6:30662730-30662752 TGCTGTAGCCAACCTGGTCAAGG + Exonic
1006069062 6:31484402-31484424 TGTGTTAGCCAGGGTGGTCTCGG + Intergenic
1006127443 6:31848721-31848743 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1006427838 6:33977213-33977235 TGCTTGAGCCCGAGAGATCAAGG - Intergenic
1006469383 6:34218281-34218303 TGCTTAAGCCTGGGAGGTCAAGG + Intergenic
1006482159 6:34304742-34304764 TGCTTCAGCCTGGGTAGTCAAGG - Intronic
1006612418 6:35302273-35302295 CGCTTGAGCCCGAGAGGTCAAGG + Intronic
1006672923 6:35740981-35741003 TGCTTGAGCCTGAGAAGTCAAGG - Intronic
1006734192 6:36260905-36260927 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1006792018 6:36708126-36708148 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1006998253 6:38283563-38283585 TGCTTGAGCCCAAGAGGTCAAGG + Intronic
1007011857 6:38425831-38425853 TGCTTCAGCCTGGGAGGTCAAGG + Intronic
1007503925 6:42319737-42319759 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1007552473 6:42740639-42740661 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1007768919 6:44177939-44177961 TGCTTGAGCCTGGGAGGTCAGGG - Intronic
1007792909 6:44323340-44323362 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1007796731 6:44354896-44354918 TGCTTCAGCCTGGGAGGTCAGGG - Intronic
1007818725 6:44543929-44543951 TGCTTGAGCCCGGGAGGTCAAGG + Intergenic
1008114696 6:47534876-47534898 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1008392488 6:50968966-50968988 TGCTTTAGGTAGAATGATCAGGG - Intergenic
1008868247 6:56241061-56241083 TGTTTTAACCAGAGTGGTATAGG - Intronic
1008972786 6:57389186-57389208 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1008984966 6:57531234-57531256 TGCTTGAGCCAGGGAGATCAAGG - Intronic
1009173007 6:60424180-60424202 TGCTTGAGCCAGGGAGATCAAGG - Intergenic
1009556964 6:65182870-65182892 CACTTGAGCCAGAGAGGTCAAGG - Intronic
1009765478 6:68069114-68069136 GGGCTTTGCCAGAGTGGTCAGGG + Intergenic
1010097077 6:72059308-72059330 TGCTTGAGCCCAAGAGGTCAAGG - Intronic
1010237344 6:73586254-73586276 AGCTTGAGCCCAAGTGGTCAAGG - Intergenic
1010717077 6:79242194-79242216 TGCTTGAGCCAGAGAGGTTGTGG + Intergenic
1010892728 6:81334349-81334371 TGCTTTTACCAAAGTGTTCAAGG + Intergenic
1010989209 6:82460672-82460694 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1011465333 6:87650138-87650160 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1011573848 6:88772093-88772115 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1011575311 6:88791226-88791248 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1011602134 6:89069723-89069745 TGCTCGAGCCAGGGAGGTCAAGG + Intergenic
1011624921 6:89274780-89274802 TGCTTGAGCCAGGGAGGTCCAGG + Intronic
1011670524 6:89678918-89678940 TGTTTTAACCAAACTGGTCAAGG + Intronic
1012159855 6:95870697-95870719 TGGTTTAGCCAAGGAGGTCAAGG + Intergenic
1012188189 6:96247875-96247897 GGTTTTAGCCAGAGTGCACAAGG + Intergenic
1012531963 6:100249260-100249282 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1012749044 6:103133730-103133752 TGCTTCAGCCTGATTGGTCATGG + Intergenic
1012955154 6:105561990-105562012 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1013061008 6:106634048-106634070 CATTTTAGCTAGAGTGGTCAGGG + Intronic
1013120168 6:107133996-107134018 TGCTTGAGCCCAAGAGGTCAAGG + Intergenic
1013216356 6:108031227-108031249 TGCTTGAGCCCAAGAGGTCAAGG - Intergenic
1013245824 6:108286382-108286404 TGCTTGAGCCCCAGAGGTCAAGG + Intergenic
1013246443 6:108291480-108291502 CTCTTAAGCCAGAGAGGTCAAGG + Intergenic
1013250932 6:108332689-108332711 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1013492598 6:110663613-110663635 TGCTTTAGCCCAGGAGGTCAAGG - Intronic
1013516036 6:110886687-110886709 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1013529991 6:111010209-111010231 TGCTTGAGCCCAAGAGGTCAAGG - Intronic
1013557563 6:111272084-111272106 TGCTTGAGCCTGGGAGGTCAGGG - Intergenic
1013775924 6:113678278-113678300 TGCTTGAGCCAGGGAGGTCAAGG + Intergenic
1013816836 6:114109077-114109099 TGCTTAAGCCTGGGAGGTCAAGG + Intronic
1013975008 6:116066862-116066884 TACTTTAGACAGAGTGGTTAGGG - Intergenic
1014032726 6:116724672-116724694 TGCTTAAGCCAGGGAGGTAAAGG - Intronic
1014261395 6:119222408-119222430 TGCTTGAGCCCAAGAGGTCAAGG - Intronic
1014806040 6:125830621-125830643 TGCTTGAGCCTGAGAAGTCAAGG + Intronic
1015613562 6:135051571-135051593 TGCTTTACCCAGAGTGGTCAGGG - Intronic
1015639972 6:135321177-135321199 TGCTTGAGCCCGGGAGGTCAAGG + Intronic
1015758402 6:136631594-136631616 TGCTTGAGCCCGAGAGGTCAAGG - Intronic
1015901407 6:138071675-138071697 TGCTTGAGCCCGGGAGGTCAAGG + Intergenic
1016270016 6:142277955-142277977 TGTTTTAGCCAGAGTGTTCATGG + Intergenic
1016537051 6:145119136-145119158 GGCTTTAACCAGGGTGGGCAGGG + Intergenic
1016705646 6:147103499-147103521 TGCTTGAGCCCAAGAGGTCAGGG + Intergenic
1016813198 6:148280722-148280744 CGCTTGAGCCTGGGTGGTCAAGG + Intronic
1016830528 6:148429300-148429322 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1017109010 6:150914573-150914595 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1017148419 6:151255704-151255726 TGCTTGAGCCAGGGAGGTCTGGG + Intronic
1017424198 6:154303835-154303857 TGCTTGAGCCCGGGAGGTCAAGG + Intronic
1017638290 6:156465244-156465266 AGCTTCAGACAGAGTGGTCAGGG + Intergenic
1017802917 6:157914558-157914580 TGCTTGAGCCCGGGAGGTCAAGG - Intronic
1017826866 6:158088142-158088164 TGCTTGAGCCGGGGAGGTCAAGG - Intronic
1018283532 6:162213649-162213671 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1018493570 6:164323735-164323757 TGCTTGAGCCTGAGAGATCAAGG - Intergenic
1018645141 6:165941379-165941401 TGGTTTAGACAGAGAGCTCATGG - Intronic
1018738432 6:166707825-166707847 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1018793364 6:167167575-167167597 TGCTTGAGCCTAAGAGGTCAAGG + Intronic
1018823348 6:167390803-167390825 TGCTTGAGCCTAAGAGGTCAAGG - Intergenic
1019208353 6:170382318-170382340 TGTTTGAGCCAGAGAGGTCAGGG + Intronic
1019376597 7:696050-696072 TGCTTGAGCCTGGGTGGTCGAGG - Intronic
1019456988 7:1133888-1133910 TGCTTGAGCCTGGGTGGTCGAGG - Intronic
1019728924 7:2619566-2619588 TGCTTGAGCCCAAGAGGTCAAGG - Intergenic
1019965505 7:4495522-4495544 TGCTTGAGCCAGGGAGTTCAAGG + Intergenic
1019970334 7:4535572-4535594 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1020005541 7:4782134-4782156 TGCTTGAGCCAGGGAGGTCGAGG - Intronic
1020218105 7:6211231-6211253 TCCTTTAGACAGGGTGATCAGGG - Intronic
1020249033 7:6452379-6452401 TGTTTTAGCTAAGGTGGTCAGGG - Intronic
1020721699 7:11752840-11752862 TGCTTGAGGCCGAGAGGTCAAGG + Intronic
1021258185 7:18420840-18420862 TGCTTTAGATTGTGTGGTCAAGG + Intronic
1021553510 7:21896989-21897011 TGCTTGAGCCCAAGAGGTCAAGG + Intronic
1021627563 7:22609442-22609464 TGCTTGAGCCCCAGAGGTCAAGG - Intronic
1021732586 7:23610293-23610315 TGCTTGAGCCTGAGAGGTTAAGG - Intronic
1021745096 7:23732225-23732247 TGCTTGAGCTTGAGGGGTCAAGG + Intronic
1021988352 7:26118934-26118956 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1022068087 7:26882136-26882158 TGCTTGAGCCCAAGAGGTCAAGG - Intronic
1022257238 7:28671170-28671192 TGCTTCAGCCTGGGAGGTCAAGG + Intronic
1022261829 7:28713134-28713156 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1022395265 7:29982597-29982619 TGCTTGAGCCTGGGCGGTCAAGG + Intronic
1022687870 7:32613513-32613535 TGCTTGAGCCCCAGAGGTCAAGG - Intergenic
1023179812 7:37470389-37470411 TACTTCAGATAGAGTGGTCAAGG - Intergenic
1023290225 7:38660451-38660473 TGCTTGAGCCCGGGAGGTCAAGG - Intergenic
1023414899 7:39922764-39922786 TGCTCGAGCCTGAGAGGTCAAGG + Intergenic
1023440960 7:40184361-40184383 TGCTTGAGCCCGGGAGGTCAAGG - Intronic
1023597100 7:41841980-41842002 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1023911209 7:44558343-44558365 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1023928764 7:44691446-44691468 TGCTTGAGCCCGGGAGGTCAAGG + Intronic
1023948248 7:44820806-44820828 TGCTTGAACCAGGGAGGTCAAGG - Intronic
1023949049 7:44826653-44826675 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1024595276 7:50928475-50928497 GGCTCTAGCCAGTGTGATCAAGG - Intergenic
1025077515 7:55955846-55955868 TGCTAGAGCCAGGGAGGTCAAGG - Exonic
1025098020 7:56112421-56112443 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1025191788 7:56901298-56901320 TGCTTGAGCCTGGGGGGTCAAGG - Intergenic
1025619938 7:63159271-63159293 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1025680162 7:63675636-63675658 TGCTTGAGCCTGGGGGGTCAAGG + Intergenic
1025734145 7:64132128-64132150 TGCTTGAGCCAGAGAGGTAGAGG - Intronic
1025871677 7:65440258-65440280 TGCTTGAGCCCGGGAGGTCAAGG - Intergenic
1025908512 7:65808856-65808878 TGCTTGAGCCAGGGAGGTCATGG - Intergenic
1025968063 7:66293417-66293439 TGATTGAGCCTGAGAGGTCAAGG + Intronic
1025982833 7:66421308-66421330 TGCTTGAGCCTGGGTGGTCAAGG + Intergenic
1025998278 7:66542264-66542286 TGCTTGAGCCAAAGAGTTCAAGG + Intergenic
1026036573 7:66834069-66834091 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1026037642 7:66840936-66840958 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1026237173 7:68537278-68537300 TTCATTAGCCAGAGTTGCCATGG + Intergenic
1026345133 7:69467146-69467168 TGCTTAAGCCCGGGAGGTCAAGG - Intergenic
1026517202 7:71083104-71083126 TGCTTTATGTTGAGTGGTCAAGG - Intergenic
1026749005 7:73034949-73034971 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1026752653 7:73063094-73063116 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1026756304 7:73091225-73091247 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1026821131 7:73549744-73549766 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1026991234 7:74587062-74587084 TGCTTGAGCCAAAGAGTTCAAGG + Intronic
1027091101 7:75302198-75302220 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1027094746 7:75330171-75330193 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1027203380 7:76077217-76077239 TGCTTGAGCCTGAGAGGTCGAGG + Intergenic
1027214025 7:76172671-76172693 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1027324594 7:77037513-77037535 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1027384789 7:77648876-77648898 TGCTTCAGCCTGAGAGTTCAAGG + Intergenic
1027416041 7:77975787-77975809 GGCTTTAGCCTGGGAGGTCAAGG + Intergenic
1027442890 7:78239103-78239125 TCCTTTAGAAAGAGTGGCCAGGG - Intronic
1027813299 7:82933509-82933531 TGCTTTAGCCATACTTGTAAGGG - Intronic
1028180534 7:87716918-87716940 GGCTTGAGCCTGAGAGGTCAAGG - Intronic
1029089811 7:98039446-98039468 TGCTTGAGCCCGGGAGGTCAAGG - Intergenic
1029102148 7:98140225-98140247 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1029131278 7:98333102-98333124 TGTTTTAGGTAGGGTGGTCAGGG - Intronic
1029136518 7:98376425-98376447 TGCTTGAGCCAGAGAGGTCGAGG + Intronic
1029194480 7:98795533-98795555 TGCTTTGGCCAGGGAAGTCAAGG - Intergenic
1029283173 7:99449744-99449766 TTCTCTAGGCTGAGTGGTCAAGG + Intronic
1029353346 7:100031359-100031381 TGCTTGAGCCTGAGAGGTCGAGG - Intronic
1029394851 7:100300896-100300918 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1029583752 7:101456293-101456315 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1029619653 7:101682080-101682102 TGCTTGAGCCAGGGAGGTCAAGG - Intergenic
1029641884 7:101826280-101826302 TGCTTGAGCCCGGGAGGTCAAGG - Intronic
1029660652 7:101958936-101958958 TGCTTAAGCCAGGGAGGTCGAGG - Intronic
1029672436 7:102042871-102042893 TGCTTGAGCCCGGGAGGTCAAGG - Intronic
1029735391 7:102463039-102463061 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1030029465 7:105355568-105355590 TGCTTAAGCCTGGGAGGTCAAGG + Intronic
1030067534 7:105671804-105671826 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1030178589 7:106681017-106681039 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1030263458 7:107590733-107590755 TGCTTGAGCCCAAGAGGTCAAGG + Intronic
1030302667 7:107990120-107990142 TGCTTGAGCCCGGGAGGTCAAGG - Intronic
1030339260 7:108358319-108358341 TGCTTGAGCCAGGGAGGTCGAGG + Intronic
1030350522 7:108480282-108480304 TGCTTGAGCCCGGGAGGTCAAGG + Intronic
1030636190 7:111951778-111951800 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1030649090 7:112097491-112097513 CGCTTGAGCCTGAGAGGTCAAGG + Intronic
1030673605 7:112363425-112363447 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1030871057 7:114757199-114757221 TGCTTGAGCCTGCGGGGTCAAGG - Intergenic
1030951243 7:115792692-115792714 CGCTTGAGCCTGAGAGGTCAAGG + Intergenic
1031053911 7:116973339-116973361 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1031099778 7:117465288-117465310 TGCTTGAGCCAGGGAAGTCAAGG + Intergenic
1031259122 7:119493956-119493978 GGCTTGAGCCTGAGAGGTCAAGG - Intergenic
1031373481 7:120996198-120996220 TGCTTGAGCCAGGGATGTCAAGG + Intronic
1032016939 7:128386159-128386181 TGCTTAAGCCTGTGAGGTCAAGG + Intergenic
1032162117 7:129518917-129518939 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1032199755 7:129811505-129811527 AGCTTGAGCCAGGGAGGTCAAGG - Intergenic
1032380078 7:131469957-131469979 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1032387672 7:131535843-131535865 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1032759592 7:134927466-134927488 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1032815557 7:135470211-135470233 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1032860337 7:135872298-135872320 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1033051687 7:138010334-138010356 TGCTTGAGCCAGGGAGGTCGAGG - Intronic
1033052057 7:138014587-138014609 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1033106481 7:138530841-138530863 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1033111281 7:138579837-138579859 TGGTTGAGCCTGAGAGGTCAAGG + Intronic
1033217882 7:139506767-139506789 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1033305980 7:140226062-140226084 TGCTTGAGCCAGGGAGGTCAAGG - Intergenic
1033326798 7:140386171-140386193 TGCTTGAGCCTGAGAGGTCAAGG - Intronic
1033371971 7:140717362-140717384 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1033869263 7:145730461-145730483 TACTTTAGTCAAGGTGGTCAGGG + Intergenic
1034181364 7:149140954-149140976 TGCTTAAGCCAAGGAGGTCAAGG + Intronic
1034277995 7:149832353-149832375 TGCTTTAACCACAGTGCACAGGG + Intergenic
1034510435 7:151530042-151530064 TGCTTGAGCCAGAGAGGTCAAGG - Intergenic
1034519355 7:151607363-151607385 TGCTTGAGCCTGAGAGTTCAAGG - Intronic
1034570744 7:151954118-151954140 TGCTTCAGCCTGAGAGGTCAAGG + Intergenic
1035210790 7:157326591-157326613 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1035406170 7:158598904-158598926 TGCTTGAGCCAGGGAGGTCGAGG + Intergenic
1035410204 7:158633832-158633854 TGCTTGAGCCCGAGAGGTCAAGG - Intronic
1035423156 7:158746424-158746446 TGCTTGAGCCTAAGAGGTCAAGG + Intronic
1035482581 7:159199195-159199217 TACTTGAGCCAGGGAGGTCAAGG - Intergenic
1035535320 8:386533-386555 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1035786134 8:2262776-2262798 TGCTTGAGCCTGAGAGGTCAAGG - Intergenic
1035806673 8:2458940-2458962 TGCTTGAGCCTGAGAGGTCAAGG + Intergenic
1036621832 8:10429311-10429333 TGTTTTAGCGAGGTTGGTCACGG + Intergenic
1036766041 8:11549853-11549875 TGCTTTGGAGAGAGTGATCAGGG + Intronic
1036800398 8:11786721-11786743 TGCTTGAGCCAGGGAGGGCAAGG - Exonic
1036933427 8:12977943-12977965 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1036944572 8:13082541-13082563 CGCTTGAGCCAGGGAGGTCAAGG + Intergenic
1037061318 8:14513124-14513146 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1037104068 8:15083630-15083652 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1037244485 8:16817295-16817317 TGCCTTAGCCAGGGAGGTCAAGG - Intergenic
1037537907 8:19844131-19844153 TGCTTCAGCAAGAGTGGCCACGG + Exonic
1037764672 8:21765193-21765215 TGCTTGAGCCCGTGAGGTCAAGG - Intronic
1037951618 8:23022174-23022196 CGCTTGAGCCTGAGAGGTCAAGG + Exonic
1038212753 8:25535125-25535147 TGCTTGAGCCCGGGAGGTCAAGG - Intergenic
1038324656 8:26563620-26563642 CACTTTAGACAGAGTGGTCTAGG - Intronic
1038407459 8:27332663-27332685 TGCTTGAGCCTGAGAGGTCAAGG - Intronic
1038461622 8:27722003-27722025 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1038462772 8:27730565-27730587 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1038477595 8:27878998-27879020 CGCTTGAGCCCGAGTGATCAAGG + Intronic
1038495771 8:28001144-28001166 CGCTTAAGCCTGAGAGGTCAAGG - Intergenic
1038547498 8:28436833-28436855 TGCTTGAGCCTGAGAGGTCGAGG - Intronic
1038800035 8:30741300-30741322 TGCTTGACCCTGAGAGGTCAAGG + Intronic
1038816473 8:30910526-30910548 TGCTTGAGCCCGGGTGGTCAAGG - Intergenic
1038938165 8:32275468-32275490 TGCATTATCTACAGTGGTCAGGG + Intronic
1039040761 8:33406518-33406540 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1039044799 8:33440051-33440073 GACTTTAGACAGAGTGATCAGGG - Intronic
1039062201 8:33580793-33580815 TGCTTGAGCCAGGGAGGTCAAGG + Intergenic
1039066010 8:33607994-33608016 TGCTTAAGCCTGGGAGGTCAAGG - Intergenic
1039513538 8:38111305-38111327 TGCTTTAGCCCAGGAGGTCAAGG - Intronic
1039514822 8:38123922-38123944 TGCTTGAGCCAGGGAGGTGAAGG - Intronic
1039872720 8:41560264-41560286 TGCTTGAGCCCAAGAGGTCAAGG + Intergenic
1040092342 8:43410782-43410804 TGCTACAGCCTGAGTGGCCAGGG - Intergenic
1040637342 8:49290535-49290557 TGCTCTAACCCGAGTGGTCTGGG + Intergenic
1040849015 8:51879040-51879062 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1040917749 8:52580774-52580796 TGCTTAAGCCTGGGAGGTCAAGG + Intergenic
1041087421 8:54269735-54269757 TGCTTGAGCCAGGGAGGTCAAGG - Intergenic
1041207529 8:55513401-55513423 GGCTTTGGCCAGCATGGTCAGGG + Intronic
1041509000 8:58633422-58633444 TGCTTTAGAAAGAGTAGTCAGGG - Intronic
1041522595 8:58772125-58772147 TGGTTTATTCAGGGTGGTCAGGG - Intergenic
1041675747 8:60537762-60537784 TGCTTGAGCCAGGGAGGTCAAGG - Intronic
1042033910 8:64508833-64508855 TGCTTGAGCCAGAGAGGTTAAGG + Intergenic
1042143211 8:65700265-65700287 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1042219110 8:66455854-66455876 CGCTTAAGCCAGGGAGGTCAAGG + Intronic
1042563586 8:70091782-70091804 TGCTTGAGCCTGAGAGGTCAAGG - Intergenic
1042879473 8:73471254-73471276 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1042907707 8:73789406-73789428 TGCTTGAGCCAAGGTGGTCAAGG + Intronic
1043313669 8:78893983-78894005 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1043571017 8:81602425-81602447 TGCTTAAGCCTGGGAGGTCAAGG + Intergenic
1043598836 8:81915660-81915682 CGCCTAAGCCACAGTGGTCAGGG + Intergenic
1043681898 8:83038854-83038876 TGCTTTAGCCTGGGAGGTCAAGG - Intergenic
1044651996 8:94505564-94505586 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1044653461 8:94523491-94523513 TGCTTGAGCCTGAGAGGTTAAGG - Intronic
1044719077 8:95128548-95128570 TGCTTGAGCCCAAGAGGTCAAGG - Intergenic
1044771092 8:95634957-95634979 TGCTTGAGCCTGAGAGGTCGAGG + Intergenic
1044972524 8:97633959-97633981 TGCTTTAGTCTGGGAGGTCAAGG - Intergenic
1045001623 8:97883469-97883491 TGCTTGAGCCCGAGAGGTCGAGG - Intronic
1045025066 8:98079252-98079274 TGCTTAAGCCCCAGAGGTCAAGG - Intronic
1045122718 8:99055811-99055833 TGCTTGAGCCCAGGTGGTCAAGG - Intronic
1045196824 8:99941002-99941024 TGCTTAAGCCTGGGAGGTCAAGG + Intergenic
1045219176 8:100180252-100180274 TGCTTGAGCCCTAGTGGTCAAGG + Intronic
1045640877 8:104249010-104249032 TTCTTGAGCCAAGGTGGTCAAGG - Intronic
1045780509 8:105857375-105857397 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1046276091 8:111962109-111962131 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1046945808 8:119973316-119973338 TGCTTTAGCCTGGGAGGTCAAGG - Intronic
1046996217 8:120526812-120526834 TGTTTGAGCCAGGGAGGTCAAGG - Intronic
1047094647 8:121610936-121610958 TGCTTTAGCCCCAGAGGTCGAGG - Intergenic
1047120496 8:121898558-121898580 CGCTTGAGCCAGAGAGGTCAAGG + Intergenic
1047396375 8:124502918-124502940 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1047436393 8:124838760-124838782 TGCTTGAGCCTGGGTGGTCAAGG + Intergenic
1047438139 8:124852559-124852581 TGCTTGAGCCTGGGTGGTCAAGG - Intergenic
1047453309 8:124986661-124986683 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1047521029 8:125595608-125595630 TGCCTTGGCCTGAGTGATCAGGG + Intergenic
1047676872 8:127212143-127212165 TGCTTGAGCCTGAGAGATCAAGG - Intergenic
1047961364 8:130014344-130014366 GGCTTGAGCCTGAGAGGTCAAGG + Intronic
1047991260 8:130288981-130289003 TGTGTTAGCCAGGGTGGTCTCGG - Intronic
1049141588 8:140959931-140959953 TGCTTGAGCCTGTGAGGTCAAGG + Intronic
1049223309 8:141437459-141437481 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1049256052 8:141614457-141614479 TGGTACAGCCAGAGTGGACAAGG + Intergenic
1049397573 8:142408481-142408503 TGCTTGAGCCTGGGAGGTCAGGG - Intergenic
1049834333 8:144724412-144724434 TGCTTGAGCCTGAGAGGTCAAGG - Intronic
1050143858 9:2544829-2544851 TGCTTTAGCCCAAGAGTTCAAGG + Intergenic
1050349313 9:4724693-4724715 TGCTTGAGCCCAAGAGGTCAAGG + Intronic
1050488061 9:6155929-6155951 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1050501657 9:6304681-6304703 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1050523446 9:6525342-6525364 TGCTTGAGCCAGGAAGGTCAAGG + Intergenic
1050556875 9:6797060-6797082 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1050628140 9:7528946-7528968 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1051225155 9:14891506-14891528 TGCTTGAGCCAGGGAGCTCAAGG + Intronic
1051281463 9:15445850-15445872 TGCTTGAGCCCGGGAGGTCAAGG + Intronic
1051297155 9:15608872-15608894 TGCTTTTGCCTGGGAGGTCAAGG + Intronic
1051393382 9:16590721-16590743 TGCTTGAGCCTCAGAGGTCAAGG + Intronic
1051466225 9:17380997-17381019 TGCTTTAGCCAAAGAAATCACGG - Intronic
1051551294 9:18332532-18332554 TGCTGGAGCCTGAGAGGTCAAGG - Intergenic
1051857233 9:21582414-21582436 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1052737559 9:32358540-32358562 TGCTTGAGCCCCAGAGGTCAAGG - Intergenic
1052808768 9:33037596-33037618 TGCTTGAGCCTAGGTGGTCAAGG + Intronic
1052965617 9:34338422-34338444 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1053171671 9:35891398-35891420 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1053236677 9:36461350-36461372 TTCTTTAGACTGAGTAGTCAAGG + Intronic
1053323078 9:37118012-37118034 TGCTTGAGCCTGAGAGTTCAAGG - Intergenic
1053402473 9:37837939-37837961 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1054740180 9:68798523-68798545 TGCTTTGGGTAGAGTGGCCAGGG + Intronic
1054766049 9:69043500-69043522 TGCTTGAGCCAGAGAGGTAGAGG - Intronic
1054893431 9:70279433-70279455 TGCTTGAGCCAAGGAGGTCAAGG + Intronic
1054911436 9:70458828-70458850 TGCTTGAGCCAGAGAGGTCGTGG - Intergenic
1054938238 9:70712236-70712258 TGCTTTATATAGAGTGATCAGGG + Intronic
1054939929 9:70730229-70730251 TGCTTTATATAGAGTGATCAGGG + Intronic
1055046973 9:71936840-71936862 CGCTTGAGCCAGGGAGGTCAAGG - Intronic
1055185597 9:73449451-73449473 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1055312516 9:74997714-74997736 TGCTTTATATAGAGTTGTCAGGG - Intronic
1055407302 9:75988363-75988385 TGCTTGAGCCCAAGAGGTCAAGG - Intronic
1055411217 9:76031603-76031625 TGCTTTAGCCTAGGAGGTCAAGG + Intronic
1055535908 9:77244152-77244174 TGCTTGAGCCCGGGAGGTCAGGG + Intronic
1055551945 9:77439551-77439573 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1055575449 9:77656577-77656599 TACTTTAGGCCAAGTGGTCAGGG - Intergenic
1055678592 9:78691362-78691384 TGCTTGAGCCCGAGAAGTCAAGG + Intergenic
1055774184 9:79750531-79750553 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1055937976 9:81621340-81621362 TGCTTTAGCCTGAGGGGAGATGG - Intronic
1055992575 9:82123547-82123569 TGCTTGAGCCAGAGAGGTGGAGG - Intergenic
1056105221 9:83340449-83340471 TGCTTTAGCTCGAGTGGTCCAGG + Intronic
1056191560 9:84189161-84189183 TGCTTGAGCCCAGGTGGTCAAGG + Intergenic
1056192178 9:84195020-84195042 TGCTGCAGCCAGTGTGGTGATGG + Intergenic
1057219903 9:93251624-93251646 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1057311584 9:93946427-93946449 GGCTTTAGTCAGGGTGGTCTGGG - Intergenic
1057373327 9:94494567-94494589 TGCTTGAACCTGGGTGGTCAAGG - Intergenic
1057450232 9:95151842-95151864 TGCTTGAGCCCAAGAGGTCAAGG + Intronic
1057789367 9:98113436-98113458 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1058135250 9:101300255-101300277 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1058143334 9:101381438-101381460 TGCTTGAGCCCAAGAGGTCAAGG + Intronic
1058673360 9:107379740-107379762 TGCTTGAGCCTAGGTGGTCAAGG - Intergenic
1058906632 9:109487312-109487334 TGCTCTTGCCACAGTGGCCAGGG - Intronic
1058911623 9:109525133-109525155 CACTTGAGCCAGAGGGGTCAAGG - Intergenic
1059030666 9:110692241-110692263 TGCTTTAGCCCAAGCAGTCAAGG - Intronic
1059128965 9:111724421-111724443 TGCTTGAGCCCAAGAGGTCAAGG - Intronic
1059146401 9:111903677-111903699 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1059230872 9:112720327-112720349 TGCTTGAGCCCGGGAGGTCAAGG + Intergenic
1059313332 9:113403429-113403451 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1059347526 9:113639736-113639758 TGCTTGAGCCTGGGTGGTCGAGG + Intergenic
1059854133 9:118376551-118376573 CGCTTTAGCCAGGGAGGTCAAGG + Intergenic
1060091116 9:120744466-120744488 TCTTATAGACAGAGTGGTCATGG + Intergenic
1060259664 9:122062861-122062883 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1060645691 9:125277751-125277773 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1060674436 9:125499901-125499923 TGCTTGAGCCAGGGAGGTCAAGG + Intronic
1060853277 9:126895185-126895207 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1060908107 9:127326147-127326169 TATTCTAGACAGAGTGGTCAGGG - Intronic
1061076744 9:128345982-128346004 TGCTTGAGCCTGAGAGGTCAAGG - Intronic
1061346432 9:130029898-130029920 TGCTTGAGCCCGGGAGGTCAAGG + Intronic
1061769417 9:132906463-132906485 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1061772055 9:132932830-132932852 TGCTTTAGATTGGGTGGTCAGGG - Intronic
1061966831 9:134019466-134019488 TGCTTGAGCCCGAGAGGTCAAGG - Intergenic
1062264524 9:135680879-135680901 TGCTTTAGCCACTATGGTGAGGG + Intergenic
1062429481 9:136520652-136520674 CGCTTTAGCCTGGGAGGTCAAGG + Intronic
1062492883 9:136816186-136816208 TGCTTGAGCCAGGGAGGTGAAGG - Intronic
1062752357 9:138264996-138265018 TGCTTTAGCCTAGGAGGTCAAGG - Intergenic
1203457373 Un_GL000220v1:3149-3171 TGCCTGAGCCTGAGTGGTCAAGG + Intergenic
1185637023 X:1560226-1560248 TGCTTGAGCCCGGGAGGTCAAGG - Intergenic
1185688857 X:2136144-2136166 TGCTTGAACCAGAGTTGTAAGGG - Intergenic
1185744789 X:2564040-2564062 TACTTTAGCCTGGGAGGTCAAGG - Intergenic
1186013194 X:5161130-5161152 TGCTTGAGCCCAAGAGGTCAAGG - Intergenic
1186320623 X:8420578-8420600 TGCTTCAGCCCGGGAGGTCAAGG + Intergenic
1186499110 X:10036962-10036984 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1186550348 X:10498185-10498207 TGCTTGAGCCTGAGAGGTCGAGG - Intronic
1186568309 X:10687795-10687817 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1187183987 X:16967578-16967600 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1187359636 X:18613009-18613031 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1187476542 X:19616044-19616066 TGCTTGAGCCTGAGAGGTCAAGG - Intronic
1187815059 X:23222897-23222919 TGCTTTAGCCAGATGAGTCCAGG + Intergenic
1187851559 X:23596160-23596182 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1187901108 X:24027525-24027547 TGCTTGAGCCCGGGAGGTCAAGG - Intergenic
1187901773 X:24032698-24032720 TGCTTGAGCCCGGGAGGTCAAGG + Intergenic
1187984759 X:24797962-24797984 TGCTTTAGCCCAGGAGGTCAAGG + Intronic
1188020974 X:25157257-25157279 TGCTTAAGCCAGGGAGGTCAAGG - Intergenic
1188391390 X:29624760-29624782 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1188527811 X:31105150-31105172 TGCTTGAGCCAGGGAGGTCAAGG + Intronic
1188571962 X:31598200-31598222 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1188976879 X:36686375-36686397 TGCTTGAGCCCGAGAGTTCAAGG - Intergenic
1189237874 X:39502174-39502196 TGCTGTAGGCAGAGGGGTCAGGG + Intergenic
1189338703 X:40187661-40187683 TGCTTGAGCCAGGGAGTTCAAGG - Intergenic
1189475781 X:41354405-41354427 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1189476605 X:41360960-41360982 TGCTTGAGCCCAAGAGGTCAAGG - Intronic
1189532509 X:41901401-41901423 TGCTTGAGCCTGAGAGGTCAAGG + Intronic
1189558694 X:42171167-42171189 TGCTTGAGCCTGAGAGGTCAAGG - Intergenic
1189727598 X:43983862-43983884 TGCCTTAGCCTGAGTAGTTACGG - Intergenic
1189918840 X:45883688-45883710 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1190007080 X:46750428-46750450 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1190232694 X:48594654-48594676 TGCTTGAGCCTGGGAGGTCAAGG - Intronic
1190242490 X:48668345-48668367 TGCTTGAGCCCGGGAGGTCAAGG - Intergenic
1190588978 X:51977942-51977964 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1190700712 X:52987562-52987584 TGCTTGAGCCTGAGAGGCCAAGG + Intronic
1190824654 X:54006396-54006418 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1190853173 X:54266619-54266641 TGCTTGAGCCTGAGAGATCAAGG - Intronic
1191041380 X:56084297-56084319 TGCTTTAGCCCTAGAAGTCAAGG + Intergenic
1192133973 X:68579797-68579819 TGTTTTAGAAAGAGTGGGCAGGG + Intergenic
1192136959 X:68611792-68611814 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1192229034 X:69251916-69251938 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1192252969 X:69428592-69428614 TGCTTTATAGAGAGTGATCAGGG - Intergenic
1192299397 X:69883978-69884000 TGCTTGAGCCTGAGAGGTCAAGG + Intronic
1192367341 X:70485018-70485040 TGCTTTATACAGACTGGGCAAGG + Intronic
1192476123 X:71444631-71444653 TGCTTGAGCCCGGGAGGTCAAGG + Intronic
1192492667 X:71589894-71589916 TGCTTCAGCCCGAGAGGTCGGGG - Intronic
1192782224 X:74305765-74305787 TGCTTGAGCGCGAGAGGTCAAGG + Intergenic
1193101238 X:77615080-77615102 TGCTTGATCCTGAGAGGTCAAGG - Intronic
1193105737 X:77669780-77669802 TGCTTTAGCCCGGGAGTTCAAGG - Intronic
1194047787 X:89030854-89030876 TGCTTGAGCCTGTGAGGTCAAGG + Intergenic
1195041697 X:101020751-101020773 TGCTTTAGCCCGGGAGGTCGAGG - Intronic
1195269028 X:103212895-103212917 TGCTTGAGCCCGGGAGGTCAAGG - Intergenic
1195630158 X:107047475-107047497 TGCTTGAGCCTGAGAGGTCAAGG - Intergenic
1195658710 X:107357679-107357701 TTCTTTAGCAAGTGTGGGCAGGG - Intergenic
1195677633 X:107519408-107519430 TGCTTGAGCCTGGGAGGTCAAGG + Intergenic
1195683487 X:107565609-107565631 TGCCTGGGCCAGAGAGGTCAAGG + Intronic
1195980173 X:110568916-110568938 TGCTTTATTCAGAGTGGGCAGGG - Intergenic
1196391593 X:115212581-115212603 TGCTTTAGCCTGGGAGGTCAAGG - Intronic
1197207326 X:123801393-123801415 TGCTTGAGCCCGGGAGGTCAAGG + Intergenic
1197219271 X:123896148-123896170 TGCTTGAGCCAGGGAGGTCGAGG - Intronic
1197247156 X:124177966-124177988 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1197329771 X:125139279-125139301 TGCTGTAGATAGAGTGGTCAGGG + Intergenic
1197755788 X:129993602-129993624 TGCTTGAGCCTGGGAGGTCAAGG + Intronic
1197868657 X:131045207-131045229 TGCTTGAGCCCAAGAGGTCAAGG - Intergenic
1198070717 X:133145674-133145696 TGCTTGAGCCAGGGAGTTCAAGG + Intergenic
1198070822 X:133147049-133147071 TGCTTGAGCCTGGGAGGTCAAGG - Intergenic
1198122330 X:133606503-133606525 TGCTTTAGCCCAAGAGGTCAAGG - Intronic
1198406759 X:136320833-136320855 TGCTTGAGCCCGGGAGGTCAAGG + Intronic
1198560521 X:137845072-137845094 TGCTTGAGTCAGGGTGGCCAAGG + Intergenic
1199011354 X:142762636-142762658 TGCTTGAGCCAGGGAGGTTAAGG - Intergenic
1200283156 X:154795679-154795701 TGCTTGAGCCCGGGAGGTCAAGG + Intronic
1200760332 Y:7032231-7032253 TGCTTGAGCCCGGGTGTTCAAGG + Intronic