ID: 932313836

View in Genome Browser
Species Human (GRCh38)
Location 2:70767160-70767182
Sequence GAGGCCATCCCCGGTCCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 102}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932313836_932313852 10 Left 932313836 2:70767160-70767182 CCTCCGGGACCGGGGATGGCCTC 0: 1
1: 0
2: 0
3: 5
4: 102
Right 932313852 2:70767193-70767215 GCAGAAAGGGAGGGGAGGCAGGG 0: 1
1: 0
2: 11
3: 203
4: 1864
932313836_932313854 20 Left 932313836 2:70767160-70767182 CCTCCGGGACCGGGGATGGCCTC 0: 1
1: 0
2: 0
3: 5
4: 102
Right 932313854 2:70767203-70767225 AGGGGAGGCAGGGAGAGGAGAGG 0: 1
1: 11
2: 100
3: 964
4: 6189
932313836_932313844 0 Left 932313836 2:70767160-70767182 CCTCCGGGACCGGGGATGGCCTC 0: 1
1: 0
2: 0
3: 5
4: 102
Right 932313844 2:70767183-70767205 CGCCCCGGCTGCAGAAAGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 110
932313836_932313847 2 Left 932313836 2:70767160-70767182 CCTCCGGGACCGGGGATGGCCTC 0: 1
1: 0
2: 0
3: 5
4: 102
Right 932313847 2:70767185-70767207 CCCCGGCTGCAGAAAGGGAGGGG 0: 1
1: 1
2: 2
3: 26
4: 277
932313836_932313850 5 Left 932313836 2:70767160-70767182 CCTCCGGGACCGGGGATGGCCTC 0: 1
1: 0
2: 0
3: 5
4: 102
Right 932313850 2:70767188-70767210 CGGCTGCAGAAAGGGAGGGGAGG 0: 1
1: 0
2: 2
3: 53
4: 513
932313836_932313855 21 Left 932313836 2:70767160-70767182 CCTCCGGGACCGGGGATGGCCTC 0: 1
1: 0
2: 0
3: 5
4: 102
Right 932313855 2:70767204-70767226 GGGGAGGCAGGGAGAGGAGAGGG 0: 2
1: 4
2: 91
3: 801
4: 5694
932313836_932313856 28 Left 932313836 2:70767160-70767182 CCTCCGGGACCGGGGATGGCCTC 0: 1
1: 0
2: 0
3: 5
4: 102
Right 932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG 0: 1
1: 1
2: 29
3: 403
4: 3100
932313836_932313851 9 Left 932313836 2:70767160-70767182 CCTCCGGGACCGGGGATGGCCTC 0: 1
1: 0
2: 0
3: 5
4: 102
Right 932313851 2:70767192-70767214 TGCAGAAAGGGAGGGGAGGCAGG 0: 1
1: 0
2: 13
3: 130
4: 1129
932313836_932313845 1 Left 932313836 2:70767160-70767182 CCTCCGGGACCGGGGATGGCCTC 0: 1
1: 0
2: 0
3: 5
4: 102
Right 932313845 2:70767184-70767206 GCCCCGGCTGCAGAAAGGGAGGG 0: 1
1: 0
2: 3
3: 22
4: 270
932313836_932313842 -3 Left 932313836 2:70767160-70767182 CCTCCGGGACCGGGGATGGCCTC 0: 1
1: 0
2: 0
3: 5
4: 102
Right 932313842 2:70767180-70767202 CTCCGCCCCGGCTGCAGAAAGGG 0: 1
1: 0
2: 2
3: 8
4: 125
932313836_932313841 -4 Left 932313836 2:70767160-70767182 CCTCCGGGACCGGGGATGGCCTC 0: 1
1: 0
2: 0
3: 5
4: 102
Right 932313841 2:70767179-70767201 CCTCCGCCCCGGCTGCAGAAAGG 0: 1
1: 0
2: 0
3: 8
4: 164
932313836_932313853 15 Left 932313836 2:70767160-70767182 CCTCCGGGACCGGGGATGGCCTC 0: 1
1: 0
2: 0
3: 5
4: 102
Right 932313853 2:70767198-70767220 AAGGGAGGGGAGGCAGGGAGAGG 0: 1
1: 9
2: 83
3: 791
4: 4840

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932313836 Original CRISPR GAGGCCATCCCCGGTCCCGG AGG (reversed) Intronic
901668933 1:10842854-10842876 GAGGCCAGCCAGGGTCACGGGGG - Intergenic
901734771 1:11305667-11305689 GGGGCCAGCCCCCGTCCGGGAGG - Intergenic
903690176 1:25167746-25167768 CAGCCCATCCCTGGTCCCAGAGG + Intergenic
904211560 1:28889417-28889439 GAGGCCAGCCCTGGTCTAGGAGG - Intronic
905632730 1:39527582-39527604 GAGGCCCTCCCTGGTCCAGGTGG - Intergenic
905665086 1:39758835-39758857 GAGGCCCTCCCTGGTCCAGGTGG + Exonic
912799096 1:112710243-112710265 GACGCCAGCCACGGTCTCGGGGG + Exonic
1062840200 10:664090-664112 GAGGCCGTCCTCGGTGCCTGCGG - Intronic
1064478807 10:15719740-15719762 GGGGCCAGCCGCGGTCCCCGGGG - Exonic
1066471407 10:35701567-35701589 GGGGCCATCCCATGTCACGGAGG - Intergenic
1067088756 10:43256057-43256079 GAGGCCATCCCCAGCCTAGGGGG + Intronic
1069553710 10:69382780-69382802 CAGGCCCTCACCGGTCCCGTCGG - Exonic
1072916459 10:99540284-99540306 GAGGCACTCCCAGGTCCCCGGGG + Intergenic
1074995705 10:118755303-118755325 GAGGCCCTCGCCGGTTCCTGAGG + Intergenic
1076534918 10:131170768-131170790 GATGCCCTCCCCAGTCCCTGCGG - Intronic
1078053472 11:7987391-7987413 CACGCCAACCCCAGTCCCGGCGG + Exonic
1078057588 11:8019798-8019820 GGGGCCAGCCTCGGTCCCTGCGG - Intronic
1079330215 11:19526938-19526960 GAGGACATCCTAGGTCCCTGGGG + Intronic
1081549126 11:44095991-44096013 GAGGCCACCCCCAGCCCCGCCGG + Intronic
1084598066 11:70128958-70128980 CAGGCCATCCTCAGTCCAGGTGG + Intronic
1088604211 11:111512798-111512820 GAGGACACCCCCGGGCCCAGCGG - Intergenic
1091170561 11:133516436-133516458 GAGTCCAGCCCCAGCCCCGGCGG - Intronic
1091582903 12:1799637-1799659 GAGGCCATCCCTGCTGGCGGTGG - Intronic
1091705152 12:2688651-2688673 GAGACCACCCCCGGTGGCGGGGG + Exonic
1094682716 12:32679774-32679796 GAGGCCGCGCCCGGTCCCAGCGG - Intronic
1099202093 12:79689982-79690004 CCTGCCGTCCCCGGTCCCGGGGG - Exonic
1102924920 12:116819361-116819383 GAGGCCAGACCCGGAGCCGGCGG + Intronic
1103951890 12:124555804-124555826 AAGTCCCTCCCCGGTCCCTGGGG + Intronic
1107569792 13:41644615-41644637 GAGGCCATCCCCCGCCTCGTGGG - Intronic
1113947107 13:114050572-114050594 GAGGCCCTGCCCGGCCCCGAGGG + Intronic
1115849997 14:37583765-37583787 GAAGCCATCCCTGGTGCCCGGGG - Intergenic
1122157582 14:99759447-99759469 GAGGGCAGCCCCGGGCCGGGAGG + Intronic
1122648064 14:103207867-103207889 GGGGCCCTGCCCGTTCCCGGGGG + Intergenic
1122658665 14:103279601-103279623 GGGGCGCTCCCCGTTCCCGGAGG + Intergenic
1126379465 15:48031195-48031217 CAGCCCATCCCAGGTACCGGTGG + Intergenic
1128736492 15:70056680-70056702 GAGGCCACCCCAGGTCCAGGAGG + Intronic
1129539326 15:76338104-76338126 GCGGGCATTCCCGGGCCCGGGGG - Intronic
1136778983 16:32885573-32885595 GGGGCCCTCCCCGGTGCCGCCGG - Intergenic
1136891635 16:33975945-33975967 GGGGCCCTCCCCGGTGCCGCCGG + Intergenic
1203081394 16_KI270728v1_random:1147662-1147684 GGGGCCCTCCCCGGTGCCGCCGG - Intergenic
1152190578 17:78885155-78885177 GAGGCCTTCCTGGGTCCCTGTGG + Intronic
1152245757 17:79183847-79183869 GAGGGCTGCCCCGGTGCCGGCGG - Intronic
1152311088 17:79550210-79550232 GAGGGCATCCCAGCTCCCAGGGG + Intergenic
1152594636 17:81232314-81232336 GGGGCCATTCCAGGTCCCCGAGG - Intronic
1152899639 17:82933013-82933035 GAGGCCCACCCCTGGCCCGGTGG - Intronic
1154172162 18:12060291-12060313 GAGGCCACCCGCAGTCCCGTAGG - Intergenic
1160907806 19:1460015-1460037 GAGGCCATACCGGCTCCTGGAGG + Intronic
1161566765 19:5006842-5006864 GAGGCCGTCCCAAGTCCCAGAGG - Intronic
1161576924 19:5059486-5059508 GAGCCCAGCCCGGGTCCCCGAGG + Intronic
1163311049 19:16514790-16514812 GGGGCCATCACCTGTCCCTGTGG + Intronic
1163687080 19:18717747-18717769 GAGGCCCTCCCATGTCCCTGCGG - Intronic
1163699435 19:18779931-18779953 GAGGCCCGCCCAGGTCCAGGAGG - Exonic
1164428494 19:28166350-28166372 GAGGCCATCGCAGGTGCAGGTGG + Intergenic
1164678210 19:30117314-30117336 GAGGCCATTCCTGGGGCCGGTGG - Intergenic
1168459010 19:56538697-56538719 GAGGCCACGCCCGGTTCCGGCGG + Intergenic
926018288 2:9473765-9473787 GAGGCCGACCCCGCTCCCTGGGG - Intronic
926331027 2:11825328-11825350 GAGGCCAGGCCTGGACCCGGTGG - Intronic
927424170 2:22962726-22962748 GAGCCCATGCCCAGTCCCTGAGG - Intergenic
931036626 2:58251478-58251500 CACGCCAGCCCCAGTCCCGGCGG + Intergenic
931602452 2:64018712-64018734 GCTGCCAGCCCCGATCCCGGAGG + Intronic
932313836 2:70767160-70767182 GAGGCCATCCCCGGTCCCGGAGG - Intronic
933337641 2:80979058-80979080 GAGGCCATACACGTTCCAGGAGG + Intergenic
933791449 2:85887061-85887083 GAGTCCATTCCAGGTCCTGGAGG - Intronic
942248124 2:174025807-174025829 GAGGCCTCCCCCGGACCCCGAGG - Intergenic
944357256 2:198805913-198805935 GAGGGCATCCAATGTCCCGGAGG + Intergenic
1170570288 20:17628703-17628725 GAGGCCAGCACAGGGCCCGGAGG - Intronic
1170665478 20:18382620-18382642 GAGGCCCTCCCTGCTCCCTGAGG + Intergenic
1171245648 20:23607881-23607903 GAGGCCATCCCAGGCCACTGGGG - Intergenic
1172525915 20:35600621-35600643 GACGCCAGCCCCGGTGCCGAGGG - Intergenic
1173221378 20:41135776-41135798 GAGGACACCCACGGTCGCGGTGG - Intergenic
1175985104 20:62760714-62760736 GAGTCCAGCCCCAGTCCCGCAGG + Exonic
1176557709 21:8260574-8260596 GAGGCCATCGCCCGTCCCTTCGG - Intergenic
1176568743 21:8399379-8399401 GAGGCCATCGCCCGTCCCTTCGG - Intergenic
1176576657 21:8443614-8443636 GAGGCCATCGCCCGTCCCTTCGG - Intergenic
1178514750 21:33237045-33237067 GAAGCCATCCCCTGGCCCAGAGG + Intronic
1185418057 22:50720744-50720766 GTGGGCAGCCCCGGTCCCGGCGG + Intergenic
1203254707 22_KI270733v1_random:132671-132693 GAGGCCATCGCCCGTCCCTTCGG - Intergenic
1203262763 22_KI270733v1_random:177750-177772 GAGGCCATCGCCCGTCCCTTCGG - Intergenic
963133212 3:141876936-141876958 GGGGCCGGCCTCGGTCCCGGGGG + Intronic
969394177 4:6909911-6909933 GACGCCATCCCCGGGACCCGTGG - Exonic
985783885 5:1884165-1884187 GGGGCGAGTCCCGGTCCCGGAGG - Intronic
991939650 5:71838434-71838456 GAGGTCATTCCCTGTCCTGGAGG - Intergenic
995623861 5:114056057-114056079 GAGGGAGTCCCCAGTCCCGGCGG + Intergenic
1004515324 6:16317610-16317632 AAGGCCATCCCTGGGCGCGGTGG - Intronic
1009975618 6:70667918-70667940 GAGTCCGCCCGCGGTCCCGGCGG + Exonic
1017170442 6:151450454-151450476 GGGGCCAGCCCCCGTCCGGGAGG + Intronic
1018065040 6:160118790-160118812 GAGGCCTTCCCAGGCCCCTGAGG + Intergenic
1018862758 6:167722907-167722929 AAGGCCGACCCAGGTCCCGGTGG - Intergenic
1019398158 7:834488-834510 GAGGCCAGCCCAGGACCAGGAGG - Intronic
1019501734 7:1368284-1368306 GAGGCCGTCCCCAGCCCCAGAGG + Intergenic
1019937436 7:4265656-4265678 GAGGTCCTCCCAGGCCCCGGAGG - Exonic
1020116221 7:5477982-5478004 GAGCCCAGCCCCGGTCCCCTGGG + Intronic
1029195782 7:98804410-98804432 GAGGCCACCCCTGGGCCTGGGGG + Intergenic
1029422307 7:100477878-100477900 GAGCCCAGCCCCGATCCGGGGGG - Exonic
1032016195 7:128381757-128381779 AAGGCCATTCCCGGCCCCCGAGG + Intergenic
1033727497 7:144134470-144134492 CAGGCCATCCCAGATCCCAGAGG + Intergenic
1036122810 8:6036420-6036442 GAGGCTCTTCCCGTTCCCGGTGG + Intergenic
1040671022 8:49691060-49691082 GATGCCAGCACCTGTCCCGGTGG + Intergenic
1048278352 8:133084755-133084777 GAGGCCTTCCCAGGCCCCTGTGG - Intronic
1057572989 9:96218339-96218361 GCGGCCATCCCCTGCCCCGCCGG + Intergenic
1061590091 9:131592495-131592517 GAGGCCAACTCTGGTCCCAGCGG + Intronic
1061955583 9:133959702-133959724 GAGGCCATCCCAGGTTAGGGTGG + Intronic
1062062288 9:134502937-134502959 GAGGCCATCCTGGGGCCCAGGGG + Intergenic
1203471108 Un_GL000220v1:115816-115838 GAGGCCATCGCCCGTCCCTTCGG - Intergenic
1203478929 Un_GL000220v1:159788-159810 GAGGCCATCGCCCGTCCCTTCGG - Intergenic
1189391647 X:40581293-40581315 CAGCCCAGCCCCGGCCCCGGCGG - Intronic
1200100822 X:153688481-153688503 GGGGCCCTCCCCGGTGCCGCCGG + Exonic
1200121971 X:153795347-153795369 GCAGCCAGCCCCGGGCCCGGGGG + Intronic