ID: 932313837

View in Genome Browser
Species Human (GRCh38)
Location 2:70767163-70767185
Sequence GCGGAGGCCATCCCCGGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 95}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932313837_932313850 2 Left 932313837 2:70767163-70767185 CCGGGACCGGGGATGGCCTCCGC 0: 1
1: 0
2: 1
3: 7
4: 95
Right 932313850 2:70767188-70767210 CGGCTGCAGAAAGGGAGGGGAGG 0: 1
1: 0
2: 2
3: 53
4: 513
932313837_932313852 7 Left 932313837 2:70767163-70767185 CCGGGACCGGGGATGGCCTCCGC 0: 1
1: 0
2: 1
3: 7
4: 95
Right 932313852 2:70767193-70767215 GCAGAAAGGGAGGGGAGGCAGGG 0: 1
1: 0
2: 11
3: 203
4: 1864
932313837_932313844 -3 Left 932313837 2:70767163-70767185 CCGGGACCGGGGATGGCCTCCGC 0: 1
1: 0
2: 1
3: 7
4: 95
Right 932313844 2:70767183-70767205 CGCCCCGGCTGCAGAAAGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 110
932313837_932313845 -2 Left 932313837 2:70767163-70767185 CCGGGACCGGGGATGGCCTCCGC 0: 1
1: 0
2: 1
3: 7
4: 95
Right 932313845 2:70767184-70767206 GCCCCGGCTGCAGAAAGGGAGGG 0: 1
1: 0
2: 3
3: 22
4: 270
932313837_932313856 25 Left 932313837 2:70767163-70767185 CCGGGACCGGGGATGGCCTCCGC 0: 1
1: 0
2: 1
3: 7
4: 95
Right 932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG 0: 1
1: 1
2: 29
3: 403
4: 3100
932313837_932313841 -7 Left 932313837 2:70767163-70767185 CCGGGACCGGGGATGGCCTCCGC 0: 1
1: 0
2: 1
3: 7
4: 95
Right 932313841 2:70767179-70767201 CCTCCGCCCCGGCTGCAGAAAGG 0: 1
1: 0
2: 0
3: 8
4: 164
932313837_932313851 6 Left 932313837 2:70767163-70767185 CCGGGACCGGGGATGGCCTCCGC 0: 1
1: 0
2: 1
3: 7
4: 95
Right 932313851 2:70767192-70767214 TGCAGAAAGGGAGGGGAGGCAGG 0: 1
1: 0
2: 13
3: 130
4: 1129
932313837_932313853 12 Left 932313837 2:70767163-70767185 CCGGGACCGGGGATGGCCTCCGC 0: 1
1: 0
2: 1
3: 7
4: 95
Right 932313853 2:70767198-70767220 AAGGGAGGGGAGGCAGGGAGAGG 0: 1
1: 9
2: 83
3: 791
4: 4840
932313837_932313842 -6 Left 932313837 2:70767163-70767185 CCGGGACCGGGGATGGCCTCCGC 0: 1
1: 0
2: 1
3: 7
4: 95
Right 932313842 2:70767180-70767202 CTCCGCCCCGGCTGCAGAAAGGG 0: 1
1: 0
2: 2
3: 8
4: 125
932313837_932313854 17 Left 932313837 2:70767163-70767185 CCGGGACCGGGGATGGCCTCCGC 0: 1
1: 0
2: 1
3: 7
4: 95
Right 932313854 2:70767203-70767225 AGGGGAGGCAGGGAGAGGAGAGG 0: 1
1: 11
2: 100
3: 964
4: 6189
932313837_932313847 -1 Left 932313837 2:70767163-70767185 CCGGGACCGGGGATGGCCTCCGC 0: 1
1: 0
2: 1
3: 7
4: 95
Right 932313847 2:70767185-70767207 CCCCGGCTGCAGAAAGGGAGGGG 0: 1
1: 1
2: 2
3: 26
4: 277
932313837_932313855 18 Left 932313837 2:70767163-70767185 CCGGGACCGGGGATGGCCTCCGC 0: 1
1: 0
2: 1
3: 7
4: 95
Right 932313855 2:70767204-70767226 GGGGAGGCAGGGAGAGGAGAGGG 0: 2
1: 4
2: 91
3: 801
4: 5694

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932313837 Original CRISPR GCGGAGGCCATCCCCGGTCC CGG (reversed) Intronic
900117278 1:1034038-1034060 GCGGAGGCCGCGCCGGGTCCCGG - Intronic
901109947 1:6785902-6785924 GCGGCGGGGATGCCCGGTCCGGG - Intronic
901196945 1:7445530-7445552 GCTGAGCCCCTCCCCCGTCCAGG - Intronic
901734772 1:11305670-11305692 GTGGGGGCCAGCCCCCGTCCGGG - Intergenic
901923037 1:12549415-12549437 CCGGAGGCCACCCCAGGGCCAGG - Intergenic
903324791 1:22563624-22563646 GCGGGGGCCATGGCCGGGCCGGG - Exonic
904303611 1:29572500-29572522 GCCGAGGCCATCCTCGTTCCAGG - Intergenic
904745270 1:32706889-32706911 CACGAGGCCATCCCCAGTCCCGG - Intergenic
905442679 1:38005252-38005274 GCTGAGGCCAGCCGCGGCCCCGG - Intronic
905632731 1:39527585-39527607 ATGGAGGCCCTCCCTGGTCCAGG - Intergenic
905665085 1:39758832-39758854 ATGGAGGCCCTCCCTGGTCCAGG + Exonic
905990903 1:42335783-42335805 GCGGAGGCCTTTCCCGTGCCTGG + Intronic
907871321 1:58446030-58446052 TCACAGGACATCCCCGGTCCCGG + Intronic
913274201 1:117121808-117121830 GCGGCGGCCCTCGCCGCTCCGGG + Intronic
915740921 1:158117911-158117933 GAGGAGACCAACCCCGCTCCTGG - Intergenic
916211744 1:162365298-162365320 GTGGAGGGCATCTCTGGTCCCGG + Intronic
1067750204 10:48966645-48966667 GCTGAGGCCCTCCCAGGTCACGG + Exonic
1071520724 10:86330156-86330178 GCTGAGGCCCTCCCCGGGGCTGG - Intronic
1073045793 10:100637590-100637612 GAGGAGGCCACCCCCAGTTCTGG - Intergenic
1076624107 10:131811086-131811108 GCAGAGGCCATTCCAGCTCCTGG + Intergenic
1078241071 11:9531191-9531213 GTGGTGGCCATCCCCACTCCAGG + Intergenic
1080551354 11:33376274-33376296 GCGGCCGCCACCCCCGTTCCCGG + Intergenic
1080875141 11:36267962-36267984 GCAGAGGCCATCCCCTGAGCTGG + Intergenic
1083159909 11:60848492-60848514 GCGGGGGCCATCCACGTTGCTGG - Intronic
1084192339 11:67504797-67504819 GCGGAGGAGATTACCGGTCCCGG - Intronic
1085472867 11:76769267-76769289 GCGGAGGCCATCTCCACCCCTGG - Intergenic
1089567271 11:119378388-119378410 GAGGAGGCCAGCCCAGGCCCTGG - Intronic
1102745083 12:115243208-115243230 GCTGAGGTCTTCCCAGGTCCTGG - Intergenic
1103971235 12:124674141-124674163 GCGGAGTCCAACCCCAGCCCTGG + Intergenic
1122151899 14:99730238-99730260 GGGGACGCCAGCCCCGCTCCCGG + Intergenic
1128075667 15:64823932-64823954 GCGGAGGCCGGCCCGGGACCCGG + Exonic
1128736491 15:70056677-70056699 GAGGAGGCCACCCCAGGTCCAGG + Intronic
1128943159 15:71804989-71805011 GCGGGGGCCCTGCCCTGTCCTGG - Intronic
1132624226 16:882649-882671 GCAGAGGCCATCACAGGACCAGG + Intronic
1132624270 16:882852-882874 GCGGAGCCCATCGCAGGACCAGG + Intronic
1132624280 16:882893-882915 GCGGAGCCCATCGCAGGACCAGG + Intronic
1132624303 16:883032-883054 GCGGAGCCCATCGCAGGACCAGG + Intronic
1132896247 16:2230649-2230671 GCGGAGGCCAACCCGGGGCCTGG + Intronic
1132939919 16:2501492-2501514 GCGGACCCCACCCCCTGTCCTGG + Exonic
1136284535 16:29233323-29233345 GGGGAGGCCAGGCCAGGTCCCGG + Intergenic
1140091938 16:71846021-71846043 GCCGCCGCCATCCCCGGCCCCGG - Exonic
1144955609 17:19017477-19017499 GAGGAGGCCATCGCAGGGCCGGG + Intronic
1150255480 17:63741386-63741408 GTGGCGGCCGACCCCGGTCCTGG - Intronic
1151696812 17:75722063-75722085 GCAGACGCCATCCCGGCTCCAGG + Intronic
1152309452 17:79540690-79540712 GCGGAGGCCACACCGGCTCCAGG - Intergenic
1152781607 17:82229417-82229439 CCGGCGGCCAAGCCCGGTCCGGG + Intronic
1152809893 17:82376391-82376413 GGGGAGGCCATGCAGGGTCCGGG - Intergenic
1153006067 18:500025-500047 ACGGAGAACATCCCCAGTCCCGG + Intronic
1159051197 18:63422564-63422586 GCGCAGGCCCTCCCTGGGCCGGG + Intergenic
1160409974 18:78668577-78668599 GAGGATGCCAGCCCCGGGCCTGG - Intergenic
1160691134 19:461081-461103 GCGGATGACATCACCGGGCCGGG - Intergenic
1164428493 19:28166347-28166369 GAGGAGGCCATCGCAGGTGCAGG + Intergenic
1164834857 19:31350148-31350170 GGGGACGCCAGCCCCGGCCCGGG - Intergenic
1165062836 19:33213120-33213142 CCAGAGGCCAGCACCGGTCCAGG + Intronic
1165476210 19:36032481-36032503 GCGGAGGCCACCCGGGGCCCTGG - Intronic
1165947347 19:39452143-39452165 GAGGAGGCCATCACAGGTCTAGG + Intronic
1166747288 19:45147338-45147360 GTGGAGGCCATCACAGCTCCTGG + Intronic
1167785027 19:51629500-51629522 GCTGAGGGCATTCCCCGTCCAGG + Exonic
1167787128 19:51645924-51645946 GCTGAGGGCATTCCCCGTCCAGG + Exonic
1168075393 19:53978531-53978553 GCGGTGGCCAATCCCAGTCCGGG - Intronic
1168100507 19:54138561-54138583 GCGGAGGGCGGCCTCGGTCCTGG - Intronic
1168459008 19:56538694-56538716 GCCGAGGCCACGCCCGGTTCCGG + Intergenic
928094533 2:28395521-28395543 GCGGAGGCAATTCCCGGTTTTGG + Intronic
932313837 2:70767163-70767185 GCGGAGGCCATCCCCGGTCCCGG - Intronic
933811134 2:86033421-86033443 GCGGAGGCCTGCCCCGGGGCTGG + Intronic
937858516 2:126690257-126690279 GCAGAGGCCATCCCCGGATCAGG - Exonic
948560380 2:238847858-238847880 GCGGAGGGCATCCCGGGGGCCGG - Intergenic
948871402 2:240800464-240800486 GCGGAGGCCAGCTCCCGTCTTGG - Intronic
1176138124 20:63533946-63533968 CAGGAGACCATCCCCGGGCCTGG - Intronic
1176258785 20:64167987-64168009 GCGGGACCCATCCCCGCTCCAGG + Intronic
1183370253 22:37427871-37427893 GCGGAGGCCGGACCCGGACCCGG - Intergenic
1185008571 22:48300072-48300094 CCGGCGACCATCCCCGGTGCAGG + Intergenic
1185418055 22:50720741-50720763 GCCGTGGGCAGCCCCGGTCCCGG + Intergenic
954130192 3:48556767-48556789 GGGGACGCCATCCCGGGGCCGGG + Exonic
954442832 3:50531057-50531079 GGGCAGGCCATCCTCGTTCCTGG + Intergenic
968092786 3:195909022-195909044 GCGGGGGCCTTCCCCGGACTCGG + Intronic
971756830 4:30718088-30718110 GCGGAGCCCACCCCCGCCCCCGG + Intergenic
976303387 4:83536186-83536208 ACGGAGGCCCTCCCCGAGCCAGG - Intronic
978885253 4:113761058-113761080 GTCGAAGCCATCCTCGGTCCGGG + Exonic
985129298 4:186724683-186724705 GCGGAGCCCATCCCCGGTGCGGG + Intronic
985488028 5:162821-162843 GCAGAGGCCTTCCCCGGGGCAGG + Exonic
985665927 5:1181533-1181555 GCCGAGCCCCTCCCCAGTCCTGG + Intergenic
986168874 5:5299362-5299384 GCAGAGGCCAGCCCTGGTCTGGG - Intronic
990952366 5:61311004-61311026 GCAGAGGCCAGCCCCAGTCCAGG - Intergenic
1002381580 5:178833163-178833185 GTGGTGGCTATCCCTGGTCCTGG - Intergenic
1002405040 5:179023957-179023979 GCAGAGGCCAGCCCTCGTCCTGG - Intronic
1017170441 6:151450451-151450473 GGGGGGGCCAGCCCCCGTCCGGG + Intronic
1018206604 6:161442605-161442627 GCGAAGGCCACCCTTGGTCCAGG - Intronic
1018940820 6:168308094-168308116 GCGGAGGCCAGCCCTGGCCTGGG - Exonic
1020076406 7:5261702-5261724 CCTGAGGCCATTCCCGGTGCAGG - Intergenic
1022943778 7:35262236-35262258 CCTGAGGCCACCGCCGGTCCCGG + Intergenic
1027200870 7:76063184-76063206 GTGGAGGCCCCCCCCGGGCCTGG - Intronic
1029195779 7:98804407-98804429 GTGGAGGCCACCCCTGGGCCTGG + Intergenic
1029422310 7:100477881-100477903 GGGGAGCCCAGCCCCGATCCGGG - Exonic
1029478912 7:100801386-100801408 GCTGGGGCCCTTCCCGGTCCAGG - Intergenic
1034899078 7:154896333-154896355 GCAGAGGCCATGCCTGGCCCCGG - Intergenic
1037588837 8:20296225-20296247 GCTGAGGCCATCCCCGCCCAAGG - Intronic
1039476705 8:37842600-37842622 ACGGAGGCCTTCCCCGTTCCTGG - Exonic
1053003541 9:34590519-34590541 GCAGGGTCCATCCCCGGTCAAGG - Intergenic
1056569654 9:87804132-87804154 GAGGAGACCATCCACGGTCTGGG + Intergenic
1061208377 9:129177163-129177185 GCGGACGCCAGGCCCGGTCCCGG + Exonic
1062212497 9:135372524-135372546 GCCAAGGCCATCCCTGGTCACGG + Intergenic
1062597423 9:137305553-137305575 GCGGCGTCCATCCCAGGCCCAGG - Intergenic
1200310293 X:155071194-155071216 GCGGTGGCCGGCCGCGGTCCGGG - Exonic