ID: 932313839

View in Genome Browser
Species Human (GRCh38)
Location 2:70767169-70767191
Sequence GCCGGGGCGGAGGCCATCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 211}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932313839_932313844 -9 Left 932313839 2:70767169-70767191 CCGGGGATGGCCTCCGCCCCGGC 0: 1
1: 0
2: 2
3: 11
4: 211
Right 932313844 2:70767183-70767205 CGCCCCGGCTGCAGAAAGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 110
932313839_932313854 11 Left 932313839 2:70767169-70767191 CCGGGGATGGCCTCCGCCCCGGC 0: 1
1: 0
2: 2
3: 11
4: 211
Right 932313854 2:70767203-70767225 AGGGGAGGCAGGGAGAGGAGAGG 0: 1
1: 11
2: 100
3: 964
4: 6189
932313839_932313852 1 Left 932313839 2:70767169-70767191 CCGGGGATGGCCTCCGCCCCGGC 0: 1
1: 0
2: 2
3: 11
4: 211
Right 932313852 2:70767193-70767215 GCAGAAAGGGAGGGGAGGCAGGG 0: 1
1: 0
2: 11
3: 203
4: 1864
932313839_932313847 -7 Left 932313839 2:70767169-70767191 CCGGGGATGGCCTCCGCCCCGGC 0: 1
1: 0
2: 2
3: 11
4: 211
Right 932313847 2:70767185-70767207 CCCCGGCTGCAGAAAGGGAGGGG 0: 1
1: 1
2: 2
3: 26
4: 277
932313839_932313845 -8 Left 932313839 2:70767169-70767191 CCGGGGATGGCCTCCGCCCCGGC 0: 1
1: 0
2: 2
3: 11
4: 211
Right 932313845 2:70767184-70767206 GCCCCGGCTGCAGAAAGGGAGGG 0: 1
1: 0
2: 3
3: 22
4: 270
932313839_932313850 -4 Left 932313839 2:70767169-70767191 CCGGGGATGGCCTCCGCCCCGGC 0: 1
1: 0
2: 2
3: 11
4: 211
Right 932313850 2:70767188-70767210 CGGCTGCAGAAAGGGAGGGGAGG 0: 1
1: 0
2: 2
3: 53
4: 513
932313839_932313856 19 Left 932313839 2:70767169-70767191 CCGGGGATGGCCTCCGCCCCGGC 0: 1
1: 0
2: 2
3: 11
4: 211
Right 932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG 0: 1
1: 1
2: 29
3: 403
4: 3100
932313839_932313851 0 Left 932313839 2:70767169-70767191 CCGGGGATGGCCTCCGCCCCGGC 0: 1
1: 0
2: 2
3: 11
4: 211
Right 932313851 2:70767192-70767214 TGCAGAAAGGGAGGGGAGGCAGG 0: 1
1: 0
2: 13
3: 130
4: 1129
932313839_932313853 6 Left 932313839 2:70767169-70767191 CCGGGGATGGCCTCCGCCCCGGC 0: 1
1: 0
2: 2
3: 11
4: 211
Right 932313853 2:70767198-70767220 AAGGGAGGGGAGGCAGGGAGAGG 0: 1
1: 9
2: 83
3: 791
4: 4840
932313839_932313855 12 Left 932313839 2:70767169-70767191 CCGGGGATGGCCTCCGCCCCGGC 0: 1
1: 0
2: 2
3: 11
4: 211
Right 932313855 2:70767204-70767226 GGGGAGGCAGGGAGAGGAGAGGG 0: 2
1: 4
2: 91
3: 801
4: 5694

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932313839 Original CRISPR GCCGGGGCGGAGGCCATCCC CGG (reversed) Intronic
900177449 1:1297212-1297234 CGCGGGGCAGGGGCCATCCCCGG + Intronic
900177476 1:1297300-1297322 CGCGGGGCAGGGGCCATCCCCGG + Intronic
900177515 1:1297438-1297460 CGCGGGGCAGGGGCCATCCCCGG + Intronic
900177542 1:1297526-1297548 CGCGGGGCAGGGGCCATCCCCGG + Intronic
900177581 1:1297664-1297686 CGCGGGGCAGGGGCCATCCCCGG + Intronic
900177595 1:1297704-1297726 CACGGGGCAGGGGCCATCCCCGG + Intronic
900177608 1:1297750-1297772 CGCGGGGCAGGGGCCATCCCCGG + Intronic
900329130 1:2125462-2125484 GGTGGGGCGGAGGACATCCTGGG + Intronic
901098457 1:6701513-6701535 GCTGGGGCGGAGGCTGGCCCCGG + Intronic
901634253 1:10663313-10663335 GCCGGGTCCCAGGCCCTCCCCGG - Intronic
902451491 1:16499334-16499356 GCCGGGGCGGAGGCGAGGCCGGG + Intergenic
904089173 1:27932531-27932553 GCTGGGGAGGAGGGTATCCCAGG - Intergenic
905922848 1:41730668-41730690 GCCGGTGTGGGGGCCATCACAGG + Intronic
909493529 1:76252136-76252158 GGAGGGCCAGAGGCCATCCCTGG + Intronic
915246236 1:154558291-154558313 GCCGGGGCGGGGGCCGCGCCCGG - Exonic
915511288 1:156388378-156388400 TGCGGGGCGGTGGCCGTCCCGGG + Intergenic
915954065 1:160208459-160208481 GTCTGGGCGGAGGCCATTCTTGG - Intronic
922234545 1:223712951-223712973 GCTGGGGCGGGGGGCAGCCCGGG + Intronic
923171415 1:231421361-231421383 GCCGGGGCTCAGCGCATCCCCGG + Exonic
924436886 1:244049464-244049486 GCGGGGGAGGGGGCCCTCCCGGG + Intronic
1064645362 10:17454288-17454310 GCCGGGGCGAAGCACAGCCCGGG + Exonic
1065390337 10:25175744-25175766 GCCGGGGAAGTGGCCAGCCCTGG + Exonic
1067694200 10:48523732-48523754 GCCGGCGCCGCGGCCAGCCCCGG + Intronic
1073266393 10:102230751-102230773 GCCTGGGCGGGGGCCCCCCCGGG - Exonic
1075144609 10:119872610-119872632 GACCGGGCGGAGGCGATCCGCGG + Exonic
1076082935 10:127599930-127599952 CCCGGGGTGGAGGACATCACTGG - Intergenic
1076370471 10:129949653-129949675 GCCTGGGCTGGGGCCATCCGAGG - Intronic
1076513007 10:131025562-131025584 GTAGAGGCTGAGGCCATCCCCGG + Intergenic
1076864396 10:133160008-133160030 GCCGCTGCAGAGGCCACCCCGGG + Intergenic
1076936954 10:133572096-133572118 GCGGGGACGGAGGCTCTCCCAGG - Intergenic
1077010420 11:376894-376916 GCCCGGGCGCAGGCCACCCAAGG + Exonic
1077227727 11:1445677-1445699 GCCGGGCTGGAGGCCACCCCTGG - Intronic
1077514240 11:2992142-2992164 GGCGCGGCGGCGGCCATCTCTGG - Intronic
1081491875 11:43575601-43575623 GCCGAGGCGGGCGCCACCCCAGG - Intronic
1082076865 11:47981254-47981276 GCCCGCGCGGAGGCTTTCCCCGG - Intronic
1083232682 11:61333112-61333134 GCCGGGGCGCGGGGCATCACGGG + Exonic
1083257937 11:61508245-61508267 GGCGGGGCGGAGCCAAGCCCTGG + Intergenic
1084001153 11:66296013-66296035 ACCGGGGCTGAGGCCATGCTGGG + Exonic
1089365667 11:117919495-117919517 GCCGAGGCCCAGGCCACCCCAGG - Intronic
1089567272 11:119378394-119378416 GGAGGGGAGGAGGCCAGCCCAGG - Intronic
1090964232 11:131584411-131584433 GCAGGGGCGGAGGCCATGAGAGG + Intronic
1091233576 11:134003628-134003650 GCCGGGACTGTGGTCATCCCTGG - Intergenic
1091266681 11:134276785-134276807 GCCGGGGTGGTGGGCAGCCCGGG - Intronic
1091319685 11:134640748-134640770 GCAGGGGCGCAGGCACTCCCAGG + Intergenic
1091823414 12:3492382-3492404 GCAGGGGCGGACGCTGTCCCTGG - Intronic
1096424874 12:51492521-51492543 GGCGCGGCAGTGGCCATCCCTGG + Intronic
1098318419 12:69215916-69215938 GCCAGGGCGGAGGCCAGGCATGG - Intergenic
1103764547 12:123271314-123271336 GCCGGCGCGGGGGTCACCCCGGG + Intronic
1104422178 12:128645272-128645294 GCCTGGGTGGTGCCCATCCCTGG - Intronic
1104713799 12:131003922-131003944 GCTGGGGCGGAGGGCGCCCCAGG + Intronic
1104858774 12:131914089-131914111 GCCGGGGCCCTGGCCATTCCTGG - Intronic
1104896785 12:132168688-132168710 GCCGGGGCTGAGGCTGTCCCTGG + Intergenic
1105353043 13:19633391-19633413 GTTGGGGCGGAGGGCGTCCCAGG - Intergenic
1107708073 13:43126533-43126555 GCTGGTGCAGAGGCCATCTCAGG + Intergenic
1112494785 13:99896096-99896118 GCCGGGGCCGAGGCCGGGCCAGG + Exonic
1113577120 13:111402686-111402708 GCCGAGGCGGATGCCAGCACAGG - Intergenic
1114736667 14:25049827-25049849 GTCAGGGCGGAGGCCAAGCCCGG - Intronic
1118774801 14:68967080-68967102 GCAGGGGCTGAGGTCATCCTAGG + Intronic
1121027545 14:90627584-90627606 GCCTGGGCCGTGGCCGTCCCGGG + Intronic
1121565720 14:94908061-94908083 GGCGGCGCGGGGGCCTTCCCTGG - Intergenic
1122544865 14:102516831-102516853 GCAGGGGCGGAGGTGTTCCCTGG + Intergenic
1122959969 14:105089868-105089890 GTCAGGGCGGAGGCCATACGGGG - Intergenic
1123008022 14:105333738-105333760 GCCGGGCCGGTTGCCAGCCCTGG - Intronic
1125603846 15:40929194-40929216 GCGGGGGCGGAGGCCCCCTCCGG + Intergenic
1126215212 15:46146395-46146417 CCCAGGCCTGAGGCCATCCCTGG - Intergenic
1128075666 15:64823926-64823948 GCTCGGGCGGAGGCCGGCCCGGG + Exonic
1131277417 15:90994083-90994105 GCCTGGGTGGAGGCCGCCCCGGG + Intronic
1132553328 16:562117-562139 GCTGGGGCGGTGGACAGCCCAGG + Intronic
1132618710 16:854540-854562 GCCCGGGCAGAGGCCACCCACGG + Exonic
1132763912 16:1524965-1524987 GGCGGGGTGGGGGCCGTCCCGGG - Intronic
1132896244 16:2230643-2230665 GCCGTGGCGGAGGCCAACCCGGG + Intronic
1133222227 16:4323676-4323698 GACGGGCCGGAGGGCTTCCCTGG - Intronic
1134684740 16:16150559-16150581 GCCGGGGCGGGAGCCTTACCGGG + Exonic
1136487343 16:30582102-30582124 GGGGGGGCGGAGCTCATCCCAGG - Exonic
1136522417 16:30805663-30805685 GCCGGCCCGGACGCCAGCCCGGG - Intergenic
1137426682 16:48385791-48385813 GCCGCGGCGGCGGCCAGCCTGGG - Intronic
1141535782 16:84678803-84678825 CCCTGGGAGGAGGGCATCCCTGG - Intergenic
1141695512 16:85617263-85617285 GCTGGGGCGGAGTCCAGGCCTGG + Intronic
1142077747 16:88130234-88130256 GCCGGGGTCGAGGCCATCTGGGG + Intergenic
1146283628 17:31560128-31560150 GCCGGAGCGCACGCCAGCCCGGG - Intergenic
1151323034 17:73362928-73362950 GCCGGGGCCGGCGCCATCACTGG - Intronic
1151675766 17:75596600-75596622 GCCCAGGCAGAGGCCATCCTTGG + Intergenic
1152231122 17:79114624-79114646 GCCGGGGCGGTGCCACTCCCGGG + Intronic
1152273798 17:79341993-79342015 GCCGGGGAGGGGGCCAGCCATGG - Intronic
1152730371 17:81967032-81967054 GCTGGGGCGCAGGGCAGCCCAGG - Intergenic
1152758602 17:82097366-82097388 GAGGGGGCGGAGGCCAGCGCTGG + Intronic
1154214833 18:12408216-12408238 GCCGGGGGAGAGGCCGTACCCGG - Intronic
1154326287 18:13393162-13393184 GCGGGGGCTGAGGGCATCCGTGG - Intronic
1160024881 18:75209096-75209118 GCCCGGGCGGGGGCCGACCCCGG - Exonic
1160765303 19:804952-804974 GCCAGGGCGGGCGCCGTCCCGGG - Intronic
1160869247 19:1269516-1269538 GGCGGGGCGGACTCCACCCCGGG - Intronic
1160871467 19:1279733-1279755 GTCTGGGCGGAGTCCAGCCCTGG + Intergenic
1161010158 19:1956009-1956031 GCTGGGGTGAAGGCCAGCCCGGG - Intronic
1161059925 19:2209799-2209821 GCCGGGTTGGAGCCCAGCCCTGG - Intronic
1161456999 19:4374602-4374624 GCCAGGGAGGAGGCTGTCCCGGG - Intronic
1161632417 19:5364908-5364930 GCCGGGGCGGAGCCTGGCCCAGG + Intergenic
1161817652 19:6509686-6509708 GCCAGGGTGGAGCCCAGCCCTGG + Intergenic
1161998883 19:7730939-7730961 GCCGGGGCGGAGGCCTGCGGCGG - Intronic
1162038783 19:7956884-7956906 GCAGGGATGGAAGCCATCCCTGG + Intergenic
1162118247 19:8445203-8445225 GCCGGGGCCGAGGCCGCGCCGGG - Intronic
1162917455 19:13882033-13882055 GACAGGAAGGAGGCCATCCCAGG - Intergenic
1163361077 19:16846790-16846812 GCCGGGGCTCAGGCCATGCTGGG + Intronic
1164624061 19:29715085-29715107 GCCGGGGCGGGGCGCCTCCCAGG - Intronic
1164877628 19:31702738-31702760 GCTGGGGCTGGAGCCATCCCAGG + Intergenic
1165092183 19:33393178-33393200 GGCGTGGGGGAGGCCGTCCCGGG + Intronic
1165329104 19:35131569-35131591 GCCGGGTCGCAGCCCCTCCCTGG - Intronic
1165797779 19:38528741-38528763 GCTGGGGCGGAGGCCACCCTTGG + Intronic
1166365892 19:42278283-42278305 GCTGGGAGGGAGGCCATACCAGG - Intronic
1166379858 19:42350272-42350294 GCCAGGGCGGAGCCCATTGCGGG + Exonic
1166984139 19:46649565-46649587 GCCGGGGGGCGGGCCAGCCCCGG - Exonic
1168505722 19:56933142-56933164 GCCAGGGCGGAGGCTGTGCCTGG + Intergenic
929188703 2:39120723-39120745 GCCGCGGCAGAGGGCAGCCCGGG - Intronic
931916540 2:66962769-66962791 GAGGGGGTGGAGGCCAGCCCTGG - Intergenic
932313839 2:70767169-70767191 GCCGGGGCGGAGGCCATCCCCGG - Intronic
934556217 2:95288388-95288410 GCCGGGGCAGAGGCCATGCCTGG - Intronic
935216987 2:100982389-100982411 GCAGGGACAGAGGCCAGCCCGGG - Intronic
937858517 2:126690263-126690285 GTGGAGGCAGAGGCCATCCCCGG - Exonic
942868069 2:180699685-180699707 CCCAGGGTGCAGGCCATCCCTGG + Intergenic
946301707 2:218828074-218828096 GGCGGGGAGGAGGTCAGCCCGGG + Intronic
947536496 2:230943178-230943200 GCCCCAGCAGAGGCCATCCCGGG + Intronic
947749440 2:232524946-232524968 GCTGGGGCAGAGGCGACCCCAGG - Intronic
947800878 2:232928027-232928049 GCCGGGTCGGGGGCCACGCCGGG + Intronic
947801086 2:232928683-232928705 GCCGGCGCGGAGGTCTTTCCCGG + Intronic
947846740 2:233250943-233250965 GCCGGAGGGGAGGCTATCTCTGG + Intronic
948560384 2:238847864-238847886 CCCGGCGCGGAGGGCATCCCGGG - Intergenic
948655776 2:239475946-239475968 GCCAGGGAGGGGGCCATACCGGG - Intergenic
948673679 2:239584621-239584643 GCCTGGGCGGGGGCCACCCATGG - Exonic
1169405272 20:5316755-5316777 CCCGGGGCGGAGTCCAGCGCGGG - Intergenic
1171310785 20:24143174-24143196 GCCAGGGAGGAGGGCAGCCCAGG - Intergenic
1171797757 20:29579675-29579697 ACCAGAGGGGAGGCCATCCCAGG + Intergenic
1171850489 20:30304486-30304508 ACCAGAGGGGAGGCCATCCCAGG - Intergenic
1172037251 20:32018966-32018988 GCCGGCGTGGATGCCAGCCCAGG + Exonic
1172408111 20:34704228-34704250 GGCGGGGCGGCGGCCAATCCCGG - Intronic
1172457927 20:35092533-35092555 GCCGGGGAAGAGGCCTTTCCAGG - Intronic
1172776487 20:37410292-37410314 GCCTGGGCGAATGCCATGCCGGG + Intergenic
1172902275 20:38343974-38343996 GCAGGGGTGGAGGCCAGGCCTGG + Intergenic
1172937334 20:38629593-38629615 GCAGAGGAGCAGGCCATCCCGGG + Exonic
1175514368 20:59559563-59559585 CCCGGGGCTTAGGCCACCCCAGG - Intergenic
1176130854 20:63496223-63496245 GCAGGTGCGGAGGCCGGCCCTGG - Intronic
1176414631 21:6467579-6467601 GCGGGGGCGGAGGCCGGCGCCGG + Intergenic
1176705780 21:10119389-10119411 GTCGGGGCTGAGACCAGCCCCGG - Intergenic
1179690129 21:43075901-43075923 GCGGGGGCGGAGGCCGGCGCCGG + Exonic
1180699521 22:17774021-17774043 GGAGGGGCCGAGGCCAGCCCCGG - Intronic
1181155512 22:20917647-20917669 GCCGCAGCGGAGGCCACCCCGGG - Exonic
1181478874 22:23185050-23185072 GAGGGGGCTGAAGCCATCCCTGG + Intronic
1182459343 22:30472849-30472871 GCTGGGGCCGAGGCTAGCCCGGG - Intergenic
1183504645 22:38202388-38202410 GACGGGGCCGAGGCCAGCTCGGG + Intronic
1184127735 22:42500213-42500235 GGTGGGGCGGAGGCCTTCCGGGG + Intergenic
1184465777 22:44668463-44668485 GCCGGGGCAGGGGGCGTCCCGGG - Intergenic
1184549233 22:45195671-45195693 GAGGGGGAGGAGGGCATCCCAGG + Intronic
1184669849 22:46006897-46006919 GCCGGCGCGGAGGCCCGCTCGGG + Intergenic
950006193 3:9692571-9692593 GCCGAGGCCGAGGCCATGCAAGG - Intronic
952344038 3:32467832-32467854 CGCTGGGCGGAGGCCCTCCCTGG + Intronic
954101010 3:48372597-48372619 GCCGGGGTGGAGGTCAGCCCGGG + Intronic
956414581 3:69013271-69013293 GCCGGGGCGGAGCCGCTCCCCGG - Intronic
961754853 3:129121667-129121689 GCCGGGGCGGGAGCCAGCCGGGG - Exonic
966870322 3:184286167-184286189 GCCGGGGAGAAGGGCATTCCAGG + Intronic
967998904 3:195187775-195187797 CCCGGGGCTGAGGACATGCCTGG + Intronic
968079416 3:195835900-195835922 GCCCTGGTGGAGGCCATCCCTGG - Intergenic
968479190 4:826268-826290 GCGGGGGCGGAGGCGGACCCGGG + Intergenic
969338887 4:6528163-6528185 GCAGGGGCCGAGGACTTCCCAGG - Intronic
969589795 4:8115222-8115244 GCCAGGGTGGATGACATCCCAGG - Intronic
969640846 4:8397502-8397524 GCAGGGGCGGAGTCCATTACAGG + Intronic
972751173 4:41990658-41990680 GCCGCGGCGGCGGCCAAGCCGGG - Exonic
985129296 4:186724677-186724699 CCGGGCGCGGAGCCCATCCCCGG + Intronic
985546807 5:514060-514082 GCCGGGGCTGGGGCCTTGCCAGG - Intronic
985646108 5:1085487-1085509 GCCGGTCGGGAGGCCGTCCCCGG + Intronic
985783042 5:1880935-1880957 GCCGGGGCGTAGGGCTGCCCAGG - Intronic
988992714 5:36687113-36687135 GCCAGGCAGGAGGCCATTCCAGG + Exonic
991033673 5:62106768-62106790 GCAGGGGCGGAGGTTATGCCTGG + Intergenic
997583745 5:135033065-135033087 GCCGGGGCGGGGGCCAGAGCCGG + Intronic
998401369 5:141850642-141850664 GGCGGGGCGGGGGCCCTTCCCGG + Intergenic
1002100088 5:176853311-176853333 GCCGGGGCGGAGGACAGGCCTGG + Intronic
1002425254 5:179171236-179171258 GCCAGGGGAGAGGCCATCCTGGG - Intronic
1002632577 5:180591194-180591216 GCCGGGATGGAGGCCGCCCCTGG - Intronic
1003058268 6:2841928-2841950 GGCGGGGCGGCGGCCCTTCCCGG + Exonic
1007777651 6:44232775-44232797 GCCTGGGCTGAGGCCCTGCCTGG + Intronic
1013422338 6:109978340-109978362 GCCGGGGAGGAGGCAAGCGCGGG - Exonic
1013634499 6:112016286-112016308 GCAGGGGCTGATGCCGTCCCAGG + Intergenic
1015251872 6:131135663-131135685 GCCGAGGCGGAGGCCAGGGCGGG - Exonic
1016990138 6:149922881-149922903 AGCGGGGCGGAGGCCAACCGTGG - Intronic
1018774415 6:166999646-166999668 GGCAGGACGGAGGCCATGCCGGG - Intronic
1018870576 6:167779335-167779357 CCCGGGGGAGAGGCCTTCCCTGG + Intergenic
1019217948 6:170455558-170455580 GCTGGAGCCGAGGCCAGCCCTGG - Intergenic
1019359422 7:596989-597011 GCGGGGGCGGCGGCCCACCCGGG - Intronic
1019417810 7:935317-935339 GCCCGGGCTGAGGCCACCCGGGG + Intronic
1019711509 7:2520136-2520158 GGCGGGGCGGGGGGCAGCCCCGG - Exonic
1024216621 7:47254261-47254283 GCGGGGGCGGAGGCGACCCTGGG + Intergenic
1025078769 7:55964770-55964792 GCCGGGGCGGAGACCGGCGCCGG - Intronic
1025959268 7:66205728-66205750 GCCGGGGCGAAGCCGAGCCCGGG - Intronic
1026765159 7:73155442-73155464 GGCGGGGCGGGGGCGCTCCCGGG - Intergenic
1027041632 7:74965197-74965219 GGCGGGGCGGGGGCGCTCCCGGG - Intronic
1027056312 7:75052356-75052378 GCCCTGTCGGAGGCCATCCTTGG - Intronic
1027082010 7:75237172-75237194 GGCGGGGCGGGGGCGCTCCCGGG + Intergenic
1029390593 7:100271717-100271739 GGCGGGGCGGGGGCGCTCCCGGG + Intronic
1029423925 7:100485240-100485262 GCCCGGGGGGCGGCCCTCCCTGG - Exonic
1033613112 7:142984667-142984689 GCCTGGGGGATGGCCATCCCTGG + Intergenic
1035254042 7:157614808-157614830 GCCGTGTCCGAGGCCCTCCCTGG - Intronic
1035622078 8:1042617-1042639 CCCAGGGTGGAGGCCTTCCCTGG - Intergenic
1039467915 8:37797124-37797146 CCCTGGGCGGAGGCGAGCCCCGG - Intronic
1040783668 8:51140516-51140538 GCAGGGGTGGAGGCCATGCAGGG - Intergenic
1045335990 8:101205221-101205243 GCCGGGTCGCAGGCCAGCCGCGG - Exonic
1047739269 8:127794192-127794214 ACCGGGCCGGAGGGAATCCCCGG - Intergenic
1050589790 9:7149371-7149393 GCCGGGGCAGGGGCCTTCCTGGG + Intergenic
1051001719 9:12290589-12290611 GCAGGGGTGGGGGCCTTCCCGGG - Intergenic
1053643061 9:40106506-40106528 GTCGGGGCTGAGACCAGCCCTGG - Intergenic
1053763086 9:41358982-41359004 GTCGGGGCTGAGACCAGCCCTGG + Intergenic
1054323910 9:63703733-63703755 GTCGGGGCTGAGACCAGCCCTGG - Intergenic
1054541696 9:66270097-66270119 GTCGGGGCTGAGACCAGCCCTGG + Intergenic
1056898897 9:90580450-90580472 GCCGGGGCTGTGGCCATCTCAGG + Intergenic
1057488935 9:95507369-95507391 GCCGGGGCCGCGGCCAGCGCCGG - Intronic
1057514550 9:95710508-95710530 GCTGGGGCTGAGGACAGCCCAGG - Intergenic
1057841574 9:98489761-98489783 GCAGGGACGGAGTCCAACCCCGG + Intronic
1060101335 9:120843302-120843324 GCCGCGGCTGAGGCCTCCCCAGG + Intergenic
1061275902 9:129569227-129569249 GCCGGGGCCGGGGCCAGGCCAGG + Intergenic
1061625462 9:131838505-131838527 GGCGGGGCTGAGGCCACCCGCGG - Intergenic
1061747893 9:132753526-132753548 GTGGGGGCTGAAGCCATCCCTGG + Intronic
1062030198 9:134358738-134358760 GCCGGGGCCCAGGCCTGCCCTGG - Intronic
1062212495 9:135372518-135372540 CCCAGGGCCAAGGCCATCCCTGG + Intergenic
1062212996 9:135374529-135374551 GCCAGGGCTGAGGGCACCCCTGG + Intergenic
1202790814 9_KI270719v1_random:89478-89500 GTCGGGGCTGAGACCAGCCCCGG - Intergenic
1203771466 EBV:52008-52030 GCCGTGGCGGCGGCCTTCCTCGG - Intergenic
1185542684 X:916043-916065 GCAGGGGCGGGGGCCCTCTCTGG + Intergenic
1187953938 X:24497170-24497192 GGCAGGGCGGAGGGCATCACTGG + Intronic
1190308602 X:49101221-49101243 GCAGGGGCGGAGGCGCGCCCGGG + Intergenic