ID: 932313843

View in Genome Browser
Species Human (GRCh38)
Location 2:70767182-70767204
Sequence CTCCCTTTCTGCAGCCGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 183}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932313843_932313854 -2 Left 932313843 2:70767182-70767204 CCGCCCCGGCTGCAGAAAGGGAG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 932313854 2:70767203-70767225 AGGGGAGGCAGGGAGAGGAGAGG 0: 1
1: 11
2: 100
3: 964
4: 6189
932313843_932313853 -7 Left 932313843 2:70767182-70767204 CCGCCCCGGCTGCAGAAAGGGAG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 932313853 2:70767198-70767220 AAGGGAGGGGAGGCAGGGAGAGG 0: 1
1: 9
2: 83
3: 791
4: 4840
932313843_932313856 6 Left 932313843 2:70767182-70767204 CCGCCCCGGCTGCAGAAAGGGAG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG 0: 1
1: 1
2: 29
3: 403
4: 3100
932313843_932313857 20 Left 932313843 2:70767182-70767204 CCGCCCCGGCTGCAGAAAGGGAG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 932313857 2:70767225-70767247 GGAAGATGGAAGAAACAGACTGG 0: 1
1: 0
2: 4
3: 57
4: 630
932313843_932313855 -1 Left 932313843 2:70767182-70767204 CCGCCCCGGCTGCAGAAAGGGAG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 932313855 2:70767204-70767226 GGGGAGGCAGGGAGAGGAGAGGG 0: 2
1: 4
2: 91
3: 801
4: 5694

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932313843 Original CRISPR CTCCCTTTCTGCAGCCGGGG CGG (reversed) Intronic
902617580 1:17632226-17632248 CTCCCTTTCTGCACCATGGGAGG + Intronic
904559162 1:31385316-31385338 TGTCCTTTCTGCAGCCTGGGTGG + Intergenic
904883501 1:33718203-33718225 CTCTCTTTCTGTAGCCTGAGAGG - Intronic
905400759 1:37701380-37701402 CTCCCTTCCTGGGGCCTGGGAGG - Intronic
905474098 1:38213797-38213819 CTCCCTGCCTGCAGCCAGAGCGG + Intergenic
905990519 1:42334391-42334413 CTCCATTTTTGCAGCTGGTGAGG - Intronic
906194218 1:43920032-43920054 CTCCCTATCTGCAGCAGCTGAGG - Intronic
907430129 1:54406620-54406642 CTCTCTTTCTGTCGCCGGGGCGG + Intronic
915141077 1:153769032-153769054 CTCCCTGTCTGCAGGCCTGGAGG - Intronic
915469151 1:156115336-156115358 CTCCCTTCCTGCGGCCGGCCAGG - Intronic
916656831 1:166884239-166884261 CCCGCTTTCTGCAGGCGGCGGGG - Intergenic
917720862 1:177785272-177785294 CTGCCTTTGTGCAGCAGGAGAGG - Intergenic
919031828 1:192251993-192252015 TTCCCCTGCTGCAGCCAGGGAGG - Intergenic
920833772 1:209488734-209488756 ATCCCTTTCTGCAGTCTGGAAGG + Intergenic
1062905404 10:1176224-1176246 CTCCAATGCTGCAGCCGGAGGGG - Intergenic
1064986377 10:21214941-21214963 CTCCCTTTTCCCTGCCGGGGAGG + Intergenic
1065048615 10:21767143-21767165 CTTCCTTTCTGCAACCTGGAAGG + Intronic
1065079022 10:22109857-22109879 CCCACTTTCTGCAGCTGGGCAGG - Intergenic
1066447338 10:35495673-35495695 CTCCCTTCCTGCAGCACAGGAGG + Intronic
1067432549 10:46253508-46253530 CTCCCCTTCAGCAGCAGGAGGGG + Intergenic
1067440710 10:46307939-46307961 CTCCCCTTCAGCAGCAGGAGGGG - Intronic
1067524516 10:47030108-47030130 CTCCCTTTCTGAAGGAGGGTTGG + Intergenic
1069919367 10:71807262-71807284 CTGCCTTTCTGCAGAGGGAGGGG - Exonic
1070806919 10:79276125-79276147 GTCCCTCCCTGCAGCCTGGGAGG + Intronic
1076022596 10:127086237-127086259 TTCCCTTCCTGCACCGGGGGTGG - Intronic
1076767530 10:132644699-132644721 CTCTCTGTCTGGTGCCGGGGTGG - Intronic
1077210646 11:1369649-1369671 CTCCCTTCCTGCAGCCCTGGAGG - Intergenic
1079759466 11:24310589-24310611 CTACCTTTCTGCAGTCTGGAGGG - Intergenic
1079875197 11:25847558-25847580 CTGCCTTTCGGCAGCAGGAGGGG - Intergenic
1083164537 11:60875398-60875420 CTGCCTTTCTGCAGATGAGGTGG - Intronic
1083901160 11:65644222-65644244 CATCCTTGCTGCAGCCAGGGAGG + Intronic
1084904242 11:72333861-72333883 CTCCCTTTCTGCCTCCGTTGTGG - Intronic
1087755115 11:102047328-102047350 CTCCCTCCCTGCACCCGCGGCGG + Intergenic
1088256547 11:107908676-107908698 CTCCTCTGCTGCAGCAGGGGCGG - Intronic
1089566475 11:119374390-119374412 CTCCAGTCCTGCAGCTGGGGAGG + Intronic
1090213590 11:124940835-124940857 GTTCCTTTCTGGAGCCTGGGGGG - Intergenic
1090611340 11:128473770-128473792 CTCACTCTCTGCAGCAGGGGAGG + Intronic
1091993826 12:4977338-4977360 CTCCCTTTCTGCAGGCTGCCTGG - Intergenic
1092733503 12:11557083-11557105 CTGCCTTTCTGCAGACCAGGTGG - Intergenic
1100595666 12:96069697-96069719 ATCCCTTTCTGCACACTGGGTGG + Intergenic
1102112335 12:110373920-110373942 CTCCCCTGCTCCAGCCAGGGAGG - Exonic
1102112336 12:110373921-110373943 CTCCCTGGCTGGAGCAGGGGAGG + Exonic
1102314431 12:111875533-111875555 CTCCCTTTCTGCAGGCTTGCAGG - Intronic
1107881182 13:44833368-44833390 CTCCCTCTCTCCAGCCTGGAGGG - Intergenic
1108434103 13:50384903-50384925 TCCCCTCTCTGCAGCAGGGGTGG - Intronic
1108815660 13:54287156-54287178 TTCCCTTGCTGGAGCCAGGGAGG - Intergenic
1111836368 13:93393389-93393411 ATCACTTTCTGCGGCCGAGGTGG - Intronic
1112602781 13:100873126-100873148 CTCCCACTCAGCAGCCTGGGAGG - Intergenic
1113113399 13:106848647-106848669 CTGCCTTTCTGCAGAGGGTGGGG - Intergenic
1117234039 14:53752638-53752660 TTCCCTTTCTGCAGGCAGAGGGG - Intergenic
1117621875 14:57595511-57595533 CTCACTTTCTGGAGTCGGGGAGG + Intronic
1118530666 14:66701946-66701968 CTCCCCTCCTGGAGCCAGGGAGG + Intronic
1121250965 14:92498979-92499001 CTCCTGTTCTGCAACCAGGGTGG + Exonic
1121426951 14:93859163-93859185 CTCCCGTCCTGCAGCAGGGCTGG - Intergenic
1121685449 14:95832050-95832072 CGCCCTTTCTGCAGCCCCAGGGG - Intergenic
1121693326 14:95893248-95893270 CTTCCTTTTTGCAGCATGGGAGG + Intergenic
1123115698 14:105893084-105893106 CTCCCAGTCTGCAGCCGGCCTGG + Intergenic
1123119937 14:105911800-105911822 CTCCCAGTCTGCAGCCGGCCTGG + Intergenic
1123125006 14:105940250-105940272 CTGCAGTTCTGCAGCGGGGGAGG + Intergenic
1124700419 15:31907606-31907628 CTCCCTCTCTCCAGCAGGGGCGG + Intergenic
1125363098 15:38885419-38885441 CTCCCATTGTGCAGCTGGGGTGG - Intergenic
1126357589 15:47812711-47812733 CTCCCATTCTGCAGAGGGGGAGG - Intergenic
1132365342 15:101252368-101252390 CGCCCTTCCTGCCGCCGGGCCGG + Intergenic
1132577045 16:668924-668946 CTCCCTCCCTCCTGCCGGGGTGG + Intronic
1133031238 16:3012266-3012288 CTCGGTTTCAGCAGCAGGGGTGG + Intergenic
1134446483 16:14335146-14335168 CACCCTTTCTGCAGCAGTGTTGG - Intergenic
1134982092 16:18619638-18619660 CTCCCTTTCTGCGGAGGAGGTGG - Intergenic
1135359230 16:21797159-21797181 CTGTCTTTCTGCAGCCGCTGGGG + Intergenic
1135821854 16:25692276-25692298 GTCGCTTCATGCAGCCGGGGCGG + Exonic
1136146935 16:28321395-28321417 GTCCCTTTCTGTACCCAGGGTGG - Exonic
1139402966 16:66696723-66696745 CTCCCTTTCCGCTGCCGAGGCGG - Intergenic
1142029569 16:87831806-87831828 TTCCCTCTCTGCAGGCGGGTGGG + Exonic
1142372667 16:89691723-89691745 GTCCCCTCCTGCAGCAGGGGAGG + Intronic
1142608454 17:1095258-1095280 TTCCCCTTTTGCAGACGGGGTGG - Intronic
1144329694 17:14212562-14212584 CTGCCTTTGTGCAGCCTGGCTGG + Intergenic
1146471336 17:33127316-33127338 CCCCCATTCTGCATCCTGGGAGG - Intronic
1147006225 17:37406517-37406539 TTCCCTTGCTGCAACAGGGGTGG + Intronic
1148564839 17:48626678-48626700 CCCCCTTCCTGCAGCGGGAGGGG - Intronic
1148736266 17:49866764-49866786 GTCCTTTTCTGCAGCAGGAGGGG - Intergenic
1149992799 17:61392158-61392180 CTCCCCTCCTCCAGCAGGGGAGG - Exonic
1150096661 17:62381925-62381947 CTCCTCTGCTGCAGCGGGGGTGG - Intronic
1150652487 17:67018996-67019018 CTCCCTGGCTGCTGCCAGGGAGG - Intronic
1150652488 17:67018997-67019019 CTCCCTGGCAGCAGCCAGGGAGG + Intronic
1151662583 17:75526354-75526376 CGGCCTTTCTCCAGCTGGGGCGG + Intronic
1152668453 17:81586200-81586222 CTCACTTCCTGCAGGAGGGGAGG - Intronic
1153003412 18:476586-476608 CTCCCTTTCTGCACTGGGGCGGG - Intronic
1153622713 18:6994746-6994768 CTCCCCTTCTGCAGATGGTGAGG - Intronic
1155283544 18:24265760-24265782 GTCCATGTCTGCAGCCTGGGTGG + Intronic
1158377207 18:56884620-56884642 CTGGCTTGCTGCAGCCGTGGTGG - Intronic
1160283193 18:77512602-77512624 CTGCCTTTCTCCAGCCTTGGCGG - Intergenic
1160818457 19:1047040-1047062 CACCCATTCTGCAGCCGGGCAGG - Intronic
1162018057 19:7856335-7856357 CCCCGTCTGTGCAGCCGGGGAGG - Intronic
1162752627 19:12838334-12838356 CGCCCCTTCTCCCGCCGGGGTGG + Intronic
1162782054 19:13011600-13011622 CTAACTTTCTCCAGCCGGGCTGG - Intronic
1163023407 19:14495829-14495851 CTCCCTTCCTGCTGGCGGGCAGG - Intronic
1165771506 19:38383239-38383261 CTCCTTTCCTGCAGCGAGGGTGG + Exonic
1166254102 19:41590083-41590105 CTCCCCAGCTGCAGCCTGGGTGG + Intronic
926692972 2:15749932-15749954 CTACTTTTCTGCAACCAGGGAGG + Intergenic
929410134 2:41689779-41689801 CTCCCTTGCTGCAGGCAGAGAGG + Intergenic
932313843 2:70767182-70767204 CTCCCTTTCTGCAGCCGGGGCGG - Intronic
932335215 2:70927274-70927296 CTCCCCTCCTGCAGCTGGGCTGG + Intronic
932374870 2:71226827-71226849 CTCCCTTTCTGCCGCCGTCGGGG - Intronic
932714643 2:74092496-74092518 CTTCCTGTCTGTAGCCTGGGAGG + Intronic
933896986 2:86820734-86820756 CATCCTTTCTGCAGCCTGAGTGG + Intronic
934746567 2:96763408-96763430 CTCACTTCCTTCAGCCTGGGAGG - Intronic
934775114 2:96932377-96932399 GTCCCTATCAGCAGCCGTGGAGG + Intronic
937368936 2:121284776-121284798 CACCCTCTCTGCCGCCTGGGAGG + Intronic
938371259 2:130769758-130769780 CTCCTTTTCTCCAGCCCTGGTGG + Intergenic
941951632 2:171161428-171161450 TTCCCATTCTGCAGACGGGGAGG - Intronic
944495951 2:200307137-200307159 CTTCCTTTCTCCAGCCGGCGCGG + Intronic
948096350 2:235337300-235337322 CTAGCTTTCTGCAGCCCAGGTGG - Intergenic
1168865904 20:1086361-1086383 CTCTTTTTGTGCAGCCGAGGAGG + Intergenic
1169263699 20:4155150-4155172 CACCCTTCCTCCAGCCAGGGCGG + Intronic
1171303221 20:24082286-24082308 CTCACATTCTGCATCCAGGGAGG + Intergenic
1172833018 20:37852675-37852697 CTCCCCTCCTGCAGTCAGGGTGG + Intronic
1173633163 20:44531782-44531804 GTCCCCTTCCGCAGCCGCGGAGG - Intronic
1173903059 20:46604963-46604985 ATTCCTTTATGCAGCCAGGGTGG + Intronic
1176241916 20:64079346-64079368 CGCCCCTTCGGCAGCCAGGGTGG - Exonic
1177282843 21:19006872-19006894 CTCCCTTCCTGCAGGAGGAGGGG + Intergenic
1179281974 21:39941451-39941473 ATGCCTCTCTGCAGCCAGGGTGG - Intergenic
1179472343 21:41620103-41620125 CTCCCGTTCTGCCACCGGGGAGG - Intergenic
1179545886 21:42111945-42111967 CTCCCTGTCTGCAGCAGCTGGGG + Intronic
1180127835 21:45804121-45804143 CTCCCTCTCTGCTGCCCGCGTGG + Intronic
1181785007 22:25220682-25220704 CCCCCTTCCTGCAGAAGGGGTGG - Intronic
1182830659 22:33302278-33302300 CTCCATTTCTGCAGCCTGGTGGG + Intronic
1183005369 22:34896944-34896966 CTCCATTACTGCATCTGGGGAGG + Intergenic
1183464487 22:37972890-37972912 CTCCCTTTCTGAAGGCAGGAAGG - Exonic
1183954786 22:41372942-41372964 CTTGCTTTCTGCAGCCATGGTGG - Intronic
1184246807 22:43239955-43239977 CTGCGTTTCTGCAGGCTGGGGGG + Intronic
1184653064 22:45928028-45928050 CTCCCTCTAGGCAGCAGGGGAGG - Intronic
1185137333 22:49080296-49080318 CTCCCTATCTGGGGCCTGGGCGG - Intergenic
1185263489 22:49884741-49884763 CTTCCTTGCTGCCGCCGGAGGGG + Exonic
1185317198 22:50184335-50184357 CTCCCTTCCTGGAGCCTGGAAGG + Intergenic
949119957 3:373462-373484 CTCCCCTGCTGGAGCCAGGGAGG - Intronic
950111470 3:10421397-10421419 CTCTCTTCCTGCAGCAGAGGAGG + Intronic
950131747 3:10552111-10552133 CAGCATTTCTGCAGCCGGAGAGG + Intronic
952882801 3:37995730-37995752 CTCCCTTCCTGTAGCTGAGGTGG - Exonic
953382857 3:42487115-42487137 CTCCCTTCCTGCAGCCTGCTAGG + Intergenic
955192819 3:56777682-56777704 CTTCCTTTTTGCAGCCAGAGTGG + Intronic
956848024 3:73201912-73201934 CTGCCATTCTGCAGCTGGGAAGG - Intergenic
957268874 3:78003277-78003299 TTCCCTTGCTGGAGCCAGGGAGG - Intergenic
958173928 3:89971420-89971442 CTCCCAATATGCAGCAGGGGTGG + Intergenic
960451714 3:117817845-117817867 CTTCCTTTCTATAGCCTGGGCGG + Intergenic
962393153 3:134991272-134991294 CTCCCTTTCTGTAACTGTGGAGG + Intronic
966250521 3:177860288-177860310 TTCCCTTGCTGGAGCCAGGGAGG - Intergenic
969271751 4:6107946-6107968 CTGACTTTCTGCATCAGGGGTGG + Intronic
969398601 4:6938907-6938929 CTCCACTCCTGCAGCCGGGACGG - Intronic
972692040 4:41408339-41408361 CTCCCTTTGTGCAGTCTGTGTGG + Intronic
981162635 4:141517036-141517058 CTCCCTTGCTCCTGCTGGGGAGG - Intergenic
981370107 4:143950143-143950165 CTCCCTTTCTGAAGGCGCAGGGG - Intergenic
983947363 4:173601135-173601157 CTCCATTTCTGAAGCCTGGTGGG - Intergenic
985641132 5:1063967-1063989 CTCCCTGTCTGCAGGTGTGGAGG - Exonic
986588572 5:9345141-9345163 CTACCTTTCTGAAACAGGGGTGG - Intronic
986588873 5:9347920-9347942 CTACCTTTCTGAAACAGGGGTGG + Intronic
987224076 5:15821473-15821495 CTGCCATTCAGCAGCAGGGGTGG - Intronic
989676697 5:43981576-43981598 TTCCCTTACTGGAGCCAGGGAGG - Intergenic
993838536 5:92846722-92846744 CTCTTTTTCTGCAGGGGGGGTGG - Intergenic
995080657 5:108047595-108047617 TTCCCTTGCTGGAGCCAGGGAGG + Intronic
996527255 5:124492223-124492245 TTCCCTTGATGCAGCTGGGGAGG - Intergenic
998128911 5:139641337-139641359 CGCTCTTGCTGCAGCCTGGGAGG - Intergenic
1001639324 5:173233979-173234001 GCCCCTTTCTGCAGCGGGGCCGG + Intronic
1002542163 5:179913547-179913569 CACCCTTTCAGCAGCCAAGGCGG + Intronic
1002637115 5:180613982-180614004 GTCCCTTACTCCAGCAGGGGCGG + Intronic
1003426857 6:6003488-6003510 CTCACTTTCAGCAGCAGGGCTGG - Intronic
1005871367 6:29976393-29976415 CTCCCTTTCTGGGGCAGGGGAGG + Intergenic
1007114734 6:39335600-39335622 CTCCCTGGCTGCAGCTGGGTTGG + Exonic
1008773668 6:55009232-55009254 TTCCCCTTCTGGAGCCAGGGAGG - Intergenic
1010952029 6:82048483-82048505 CTTCCTTTCTGAAGCAGGTGTGG + Intergenic
1015586786 6:134784538-134784560 CTCCCTGTCTCCAGTTGGGGAGG + Intergenic
1016965882 6:149718169-149718191 CTCCCTCGCAGCAGCCGGGCGGG - Exonic
1018436570 6:163764784-163764806 CACCCTTCCTGCAGCCAGTGAGG - Intergenic
1019890150 7:3940068-3940090 GTCAGTTTCTGCAGCCAGGGTGG - Intronic
1019890161 7:3940137-3940159 GTCAGTTTCTGCAGCCAGGGTGG - Intronic
1019890172 7:3940206-3940228 GTCAGTTTCTGCAGCCAGGGTGG - Intronic
1020138310 7:5598743-5598765 CATCCTTTCTGCTGCTGGGGTGG + Intronic
1021380783 7:19963363-19963385 CTCCTTTGCTGCAGCTGGGAAGG - Intergenic
1023914026 7:44575005-44575027 CTCCCTTCCTCCAGCAAGGGTGG - Intronic
1027181801 7:75945965-75945987 CTCCCTTTCAGAAGCTGGTGAGG + Intronic
1029209840 7:98898000-98898022 GTCCTTCTCTGCAGCCTGGGAGG + Intronic
1032515569 7:132503895-132503917 CTGGCTTTCTCCAGCCTGGGTGG - Intronic
1034567371 7:151926224-151926246 CTCCCACTCTGCATCCGGGCTGG + Intergenic
1035681841 8:1494028-1494050 CTCCCATTCTGCATCGGGGGGGG + Intergenic
1038415691 8:27393605-27393627 CTCCCATTCCGCAGCCTGGCTGG - Intronic
1038644342 8:29350332-29350354 GCCCCTTTCTGCAGCCTAGGCGG - Exonic
1040614204 8:49018392-49018414 TTCCCTTGCTGGAGCCGGGCAGG - Intergenic
1047073136 8:121370495-121370517 CTCCTCTTCTGCAGCCAGGGTGG - Intergenic
1047520387 8:125591515-125591537 ATCCCTTTGTGCAGCCTGGGTGG + Intergenic
1049788996 8:144464504-144464526 CTGCCTTGCTGGAGCCTGGGTGG - Exonic
1049851855 8:144836843-144836865 CTCCCTCGCTGCAGACTGGGTGG - Intronic
1050472399 9:6007470-6007492 CCCCCTTTCTGCAGCCCTTGGGG - Exonic
1055397298 9:75889720-75889742 CTGCCTTCCTGGAGCGGGGGTGG - Intergenic
1057841035 9:98485795-98485817 CACCCTCACTGCAGCCGGGCGGG - Intronic
1057979796 9:99649746-99649768 CACCCTTTCTGCAGTTGTGGAGG - Intergenic
1060428729 9:123528670-123528692 TTCCCTTTCTGGAGGCAGGGAGG - Intronic
1060602414 9:124886996-124887018 CTCCCTGCCTGCAGCCATGGAGG - Intronic
1060731949 9:126044290-126044312 CTGCCTTTCAGCAGCCAGGTGGG - Intergenic
1061120824 9:128641257-128641279 CTCCCTTTCTGAAGATGCGGAGG + Intronic
1062730443 9:138105466-138105488 CTACTTTTCTGCAGCCAGGAGGG + Intronic
1186353727 X:8768171-8768193 CTCTCTTTCTGCAGGAGGGAGGG - Intergenic
1187669216 X:21651771-21651793 CTCCCTTTCTGTAGCACTGGGGG - Intronic
1189160389 X:38804114-38804136 GGCCCTTTCTACAGCGGGGGCGG - Exonic
1190984887 X:55491220-55491242 CACCCTTTATGCAGGCAGGGAGG + Intergenic
1197602162 X:128543470-128543492 TTCCCCTGCTGCAGCCAGGGAGG - Intergenic