ID: 932313846

View in Genome Browser
Species Human (GRCh38)
Location 2:70767185-70767207
Sequence CCCCTCCCTTTCTGCAGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 272}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932313846_932313855 -4 Left 932313846 2:70767185-70767207 CCCCGGCTGCAGAAAGGGAGGGG 0: 1
1: 0
2: 2
3: 37
4: 272
Right 932313855 2:70767204-70767226 GGGGAGGCAGGGAGAGGAGAGGG 0: 2
1: 4
2: 91
3: 801
4: 5694
932313846_932313857 17 Left 932313846 2:70767185-70767207 CCCCGGCTGCAGAAAGGGAGGGG 0: 1
1: 0
2: 2
3: 37
4: 272
Right 932313857 2:70767225-70767247 GGAAGATGGAAGAAACAGACTGG 0: 1
1: 0
2: 4
3: 57
4: 630
932313846_932313854 -5 Left 932313846 2:70767185-70767207 CCCCGGCTGCAGAAAGGGAGGGG 0: 1
1: 0
2: 2
3: 37
4: 272
Right 932313854 2:70767203-70767225 AGGGGAGGCAGGGAGAGGAGAGG 0: 1
1: 11
2: 100
3: 964
4: 6189
932313846_932313856 3 Left 932313846 2:70767185-70767207 CCCCGGCTGCAGAAAGGGAGGGG 0: 1
1: 0
2: 2
3: 37
4: 272
Right 932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG 0: 1
1: 1
2: 29
3: 403
4: 3100
932313846_932313853 -10 Left 932313846 2:70767185-70767207 CCCCGGCTGCAGAAAGGGAGGGG 0: 1
1: 0
2: 2
3: 37
4: 272
Right 932313853 2:70767198-70767220 AAGGGAGGGGAGGCAGGGAGAGG 0: 1
1: 9
2: 83
3: 791
4: 4840

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932313846 Original CRISPR CCCCTCCCTTTCTGCAGCCG GGG (reversed) Intronic
900101756 1:964918-964940 CGCATCCCTTCCTGCAGCCAGGG + Intronic
900352679 1:2243376-2243398 GCCTGCCCTTTCTGCAGCTGTGG + Intronic
901490812 1:9595419-9595441 GCGCACCCTTTCTGCAGCCCAGG + Intronic
901763608 1:11486391-11486413 CCCCTTCCCTTCTTTAGCCGGGG + Intronic
903664487 1:24997984-24998006 CCCCTCCCCTACGGCAGCCCTGG + Intergenic
904255076 1:29249559-29249581 ACACTCCCTTTCTGCAGCCTGGG - Intronic
906210209 1:44008618-44008640 CCCCTCCCCTCCTGCAGGAGTGG - Exonic
908121031 1:60986131-60986153 CCCCTCCATTACTCCAGCCTGGG - Intronic
908565642 1:65353199-65353221 CCCCTCACTTTCTGGAGTTGAGG + Intronic
910635413 1:89402482-89402504 CCCCTCACTTTGTGAGGCCGAGG - Intergenic
911040623 1:93588346-93588368 CCACTCCACTCCTGCAGCCGGGG + Intronic
912798126 1:112705118-112705140 GCCCTCTCTTCCTGCAGCCTGGG - Exonic
915512679 1:156394981-156395003 CCACTCCCCTACTGCAGCTGGGG - Intergenic
915741125 1:158119040-158119062 CCCCTCCCACTCTGCAGTCAAGG - Intergenic
916773423 1:167936078-167936100 CTCCTCCCTCTCTCCTGCCGGGG - Intronic
919823476 1:201487632-201487654 CCCCTCCCATTTTGCAGCCTTGG + Intronic
919916988 1:202144831-202144853 CTCCTCCCTCGCTGGAGCCGGGG + Intergenic
921067603 1:211633595-211633617 CCCCTCCCTATGTGCTGCCAAGG - Intergenic
921273581 1:213494133-213494155 CCCAACCATTTCTGTAGCCGGGG - Intergenic
922603269 1:226872775-226872797 CCCCCGCCTTTCCGCAGCTGTGG - Intronic
923519446 1:234724737-234724759 CCCCTCTCTGTCTGCAGCCAGGG - Intergenic
924744742 1:246821447-246821469 CCCCTCTCTTTCAGCAACAGTGG - Intergenic
1063138692 10:3238369-3238391 CATCTCCTTCTCTGCAGCCGGGG - Intergenic
1063288010 10:4711704-4711726 CCCCTTCCTCTCTGCAGGCCTGG + Intergenic
1064737813 10:18400890-18400912 TCCGTCCCTTTCTGCCTCCGGGG - Intronic
1067939079 10:50637390-50637412 CCCCTCTCTTTCTGCCTCCCTGG - Intergenic
1068096627 10:52499455-52499477 CCCATCCCTCCCAGCAGCCGCGG - Intergenic
1070160763 10:73865546-73865568 CCTCTGCTTTTTTGCAGCCGTGG - Intronic
1070994741 10:80767089-80767111 CCCCTTCCTTTTGGCATCCGTGG + Intergenic
1072523742 10:96253455-96253477 CCCCTCCCTCTCTGCCCCTGAGG - Intronic
1073527107 10:104193969-104193991 ATCCTCCCTCTCTGCAGCCGTGG - Exonic
1074394879 10:113089403-113089425 CCCCTCCCTTGCTGCACTCAGGG + Intronic
1075427345 10:122352216-122352238 CCCCTCTCTGTCTGCTGCCAAGG - Intergenic
1076141626 10:128083726-128083748 CCCCTCCCGTTCTGCCACAGCGG + Exonic
1076880602 10:133237582-133237604 CTCCTACCTTCCTGCAGCCTCGG + Exonic
1077210648 11:1369652-1369674 TGCCTCCCTTCCTGCAGCCCTGG - Intergenic
1077252851 11:1568226-1568248 CCTCGCCCTCTCTGCAGCCAGGG + Intronic
1077356354 11:2120674-2120696 CCCCCACCTTTCTCCTGCCGAGG - Intergenic
1077401292 11:2359088-2359110 TCCCTCCCTGTCTGCACCTGTGG + Intergenic
1077540078 11:3142518-3142540 CCCCTCCCTTTTTACAGATGAGG + Intronic
1078547483 11:12256636-12256658 CCCCTCCCTCTTTGCTGCAGTGG + Intronic
1079209720 11:18450228-18450250 TCCCTCCATTCCTGCAGCCAAGG - Intronic
1080657993 11:34273151-34273173 CCCCTCCCTTTCTGGGACCCAGG - Intronic
1081766974 11:45618144-45618166 CACCTCCCTTTATGCAGCAGAGG - Intergenic
1083689187 11:64396466-64396488 CCACTCCGTCTCTGCAGCAGTGG + Intergenic
1084913706 11:72411828-72411850 CCCCTCCCCAGCTGCAGCTGAGG - Intronic
1085637632 11:78170647-78170669 CCCTTCCCCTTGTGCAGCTGTGG + Intergenic
1086454423 11:86947276-86947298 CCCTTCCCTAACTGCAGCTGTGG + Exonic
1087847249 11:102987439-102987461 CCCAGCACTTTGTGCAGCCGAGG + Intergenic
1088894140 11:114065009-114065031 CCTGTCCCTTTCTGCAGCTTGGG + Intronic
1088920794 11:114258512-114258534 CCCCTCCCTTCCTGGTGCCAGGG - Intronic
1090252080 11:125258744-125258766 CCCCTCCCCTGCTGCCGCCCTGG + Intronic
1091400468 12:177802-177824 CCCTGCCCTGTCTGCTGCCGTGG - Exonic
1091663024 12:2398681-2398703 CCCCTCTCTTTCTGCAGCTTTGG - Intronic
1091906772 12:4195443-4195465 CCCCTCCCTTTCCACAGATGTGG + Intergenic
1094111892 12:26870777-26870799 CCCCTCCCTTGCCCCAGCCTGGG - Intergenic
1096738954 12:53677542-53677564 CCCCTCCCTTTCAGGAGCTCAGG - Intergenic
1096771144 12:53936774-53936796 CGCCTGCCTTTTTCCAGCCGCGG - Intergenic
1096850767 12:54434476-54434498 CCCAGCACTTTCGGCAGCCGAGG - Intergenic
1098226772 12:68332411-68332433 CCCCGCCCTTTTTGGAGCCTAGG + Intergenic
1098762769 12:74446142-74446164 CCCATCACTTTCGGCGGCCGAGG + Intergenic
1100741424 12:97597516-97597538 TCCTCCCCTTTCTGCAGTCGTGG + Intergenic
1101977228 12:109370216-109370238 CCCCTCCCTGGCTGAAGCCAGGG + Intronic
1102029432 12:109731464-109731486 CGCCTCCCATTCTCCAGCAGGGG - Intronic
1102199900 12:111049990-111050012 CACCTCCCATTCTGCAGAGGAGG + Intronic
1103189595 12:118989919-118989941 CACCTCTCTTTCTGCAGAAGTGG - Intronic
1103563950 12:121806160-121806182 CCCCACCCTTCCTGCAGCGTGGG + Intronic
1104462757 12:128968908-128968930 CCCCTTCCCTGCTGCTGCCGTGG + Intronic
1104735231 12:131132304-131132326 CCCCGCCCCTTCTCCAGGCGGGG - Intronic
1104860093 12:131919087-131919109 ACCCTCCCCTGCTGCAGCCCGGG - Intronic
1105573941 13:21632051-21632073 CCCCTCCCTTTGTGCGGGCTAGG + Intergenic
1110284462 13:73733309-73733331 CCCCTCCCTTCCTTTAGCCCTGG + Intronic
1110782396 13:79481362-79481384 CGCCTCCGTTCCTGCAGCCGCGG - Exonic
1111836370 13:93393392-93393414 CCCATCACTTTCTGCGGCCGAGG - Intronic
1112117274 13:96369758-96369780 TCCCTCCCTTTCTTCAGAGGGGG - Intronic
1112326852 13:98447289-98447311 CCCCTCCCCTTCTGCCTCCCGGG - Intronic
1113655543 13:112066392-112066414 CCCCTCCTTTTCAGCACTCGGGG + Intergenic
1113767875 13:112892247-112892269 CCCCTCCTTTTCCGCAGCCACGG + Intergenic
1114259015 14:21024614-21024636 CCTCTCCCTTTCTCCACTCGTGG - Exonic
1116329295 14:43576404-43576426 CCCATCCCTTTATGCTGCCTTGG - Intergenic
1116777702 14:49200749-49200771 CCTCTCCCTTTCTCCAGCAGAGG - Intergenic
1118615402 14:67571717-67571739 CCCCTCCCTCACTGCAGCTCAGG - Intronic
1118640896 14:67791673-67791695 CTCCTCCTTTTCTTGAGCCGTGG - Intronic
1118751096 14:68808341-68808363 CCCCTCCCTGTCTGGAGTGGTGG - Intergenic
1119229366 14:72968338-72968360 AGACCCCCTTTCTGCAGCCGTGG - Intergenic
1119229372 14:72968370-72968392 CTCAGACCTTTCTGCAGCCGGGG - Intergenic
1119475106 14:74922685-74922707 CCCTTCCCTTCCCGCAGCCACGG - Intronic
1119955989 14:78798912-78798934 CCCCTCGCTGTGTGCAGCCTAGG - Intronic
1122790391 14:104181896-104181918 CCCCTCCCTGGCTCCAGGCGGGG + Intergenic
1122886163 14:104711363-104711385 CCCCTTCCTTCCTGCAGCACTGG + Intronic
1124879291 15:33626662-33626684 CCCCTTGCTTTGTGCAGCCTAGG + Intronic
1125332214 15:38593497-38593519 TCCCTCCCTTTCTGCTGCCAGGG + Intergenic
1125520383 15:40345043-40345065 GCCCTCCCTCTCTCCACCCGGGG + Intergenic
1125754234 15:42051553-42051575 CCCCTCTCTTTCTGAGGCTGTGG + Intergenic
1125971242 15:43913437-43913459 CCCCTCCCTTTCTGCCACAGTGG + Intronic
1127028334 15:54833286-54833308 TACCTCTCTTTCTGCAGCCTGGG - Intergenic
1127328336 15:57916460-57916482 CCCCTGACTCTCTGCAGCCTGGG - Intergenic
1128565831 15:68699985-68700007 CCCCTCCCAGGCTGCAGCGGGGG - Intronic
1132004313 15:98212921-98212943 CCCCTCCCTTCCTGCATTCATGG - Intergenic
1132571773 16:647400-647422 CTCCTCCCTTCCTGCAGTCCAGG + Exonic
1132592891 16:734053-734075 CCCTTCCTCTTCTGCAGCAGAGG - Intronic
1132757950 16:1495086-1495108 CCCCTCCCCTGCTGCTGACGCGG - Intronic
1133117346 16:3585014-3585036 CCCTTCCCTGTCTGGAGCAGGGG + Intronic
1133276410 16:4640800-4640822 CACCTCCCCTCCTGCAGCCGGGG - Intronic
1133781171 16:8940554-8940576 CCTCTCCCTTTCTGATGCAGGGG - Intronic
1134045523 16:11098333-11098355 CCTGTCCCTTTCTGCATCCTCGG - Intronic
1134339706 16:13333770-13333792 CCCCTCCCTTTTTGCTGCTAAGG - Intergenic
1136102447 16:28006015-28006037 TCCCTCTCTTCCTGCAGCTGGGG - Intronic
1136621158 16:31429262-31429284 CCCATCCCCTCCTGCAGCTGGGG - Intergenic
1138114242 16:54347828-54347850 ACCGTTGCTTTCTGCAGCCGGGG + Intergenic
1139068131 16:63344884-63344906 CCCCACCCTGTCTGCAGCAGAGG + Intergenic
1139402969 16:66696726-66696748 TCCCTCCCTTTCCGCTGCCGAGG - Intergenic
1140479559 16:75255227-75255249 CCCCTCCCCTCCTGAAGCCTCGG + Intronic
1141881191 16:86860749-86860771 CACCTTCCTGTCTGCAGCCGTGG + Intergenic
1141912661 16:87070717-87070739 TTCCTCCATTTCTGCAGCCAAGG + Intergenic
1141998412 16:87649118-87649140 CCCGCCCCTCTCTGCAGCAGAGG - Intronic
1142155511 16:88531196-88531218 CCCTTCCCTGTCTTCAGCCAAGG + Intronic
1143712105 17:8742269-8742291 CCTCTCCCTTTCAGAAGCTGGGG + Intronic
1144635851 17:16908534-16908556 CCTCTGCCTTCCTTCAGCCGGGG + Intergenic
1144789530 17:17849753-17849775 CCCCTCCCTGTCTGGACCCTGGG + Intronic
1144825555 17:18103784-18103806 CGCCTCCCTCTTTGCAGCTGCGG + Exonic
1146179221 17:30686705-30686727 CCATTTCCTTTCGGCAGCCGCGG - Intergenic
1146594626 17:34157659-34157681 CCCCTCGCTGTCTGCATCAGAGG - Intronic
1146748310 17:35352174-35352196 CCCAACCCTTTCAGCAGCGGTGG - Exonic
1148821896 17:50364671-50364693 CCCTTCCCTGCCTGCAGCCCAGG - Intergenic
1149092769 17:52804131-52804153 CCCCCCCATTTCTACAGCAGAGG + Intergenic
1149550803 17:57537978-57538000 CCACTCCCTTTCTGCTTCCGTGG - Intronic
1151153957 17:72111459-72111481 CCCCTCCCCTTCTACAGGAGGGG + Intergenic
1151632249 17:75318930-75318952 CCCCTCCCTATATGCACCCCTGG - Exonic
1151668384 17:75558367-75558389 CCCCTCCCTTTCCACAGCTGGGG + Intronic
1151987836 17:77555637-77555659 CCCCTCCCTCTCGGCTGCAGGGG - Intergenic
1152322897 17:79618237-79618259 ACCGTCAATTTCTGCAGCCGGGG + Intergenic
1152740056 17:82014848-82014870 CCCCTCCCTAGCTGCCGCCCAGG - Intronic
1152742289 17:82023585-82023607 CGGCTCCCTTTCAGCAGCTGCGG + Exonic
1154076144 18:11203670-11203692 CTCCTCCAATTCTGCAGCCCAGG - Intergenic
1155537577 18:26832991-26833013 CCCCTCCCACACTGCAGCCTGGG + Intergenic
1156549345 18:37999170-37999192 CCTCTCAGGTTCTGCAGCCGGGG - Intergenic
1156860254 18:41827873-41827895 CCCCTGCCATTCTGCTGCTGTGG - Intergenic
1157282227 18:46353719-46353741 CCCCTCCCATGCTGCTGCCTCGG + Intronic
1158591944 18:58785272-58785294 GCTCTCCCTTCCTGCAGCAGGGG - Intergenic
1159255279 18:65937124-65937146 CCCATTCCTTTGTGCAGCCAAGG - Intergenic
1160516149 18:79480292-79480314 TCCCTCTCTTTCTGAAGCCTGGG - Intronic
1160871542 19:1280058-1280080 ACCCTCCCTGTCTGCCGCCAGGG + Intergenic
1160895314 19:1399642-1399664 CCGCTCCCTTTCTGCAGGTGGGG - Intronic
1161091036 19:2360195-2360217 CCCCTCCCTTCCTCCAGCCCCGG + Intergenic
1161108631 19:2456441-2456463 CCCGTCCCTGTCTGCACCCAGGG + Intronic
1161809599 19:6464427-6464449 CCCCTTCCTTTCCCCAGCCCAGG + Intronic
1162180609 19:8866179-8866201 CTCCTCCCCTCCTGCAGCCATGG - Exonic
1162199525 19:9010428-9010450 CACCACCCTCCCTGCAGCCGGGG - Intergenic
1162361374 19:10222624-10222646 CCCCTCCCCACCTCCAGCCGTGG + Intronic
1162421175 19:10566945-10566967 CTCCTCCCCTACTGCAGCAGTGG + Exonic
1163020874 19:14480192-14480214 CCCTTCCCTTTCGGCAGGCCAGG + Intronic
1163357795 19:16825669-16825691 CCCCTCCCTCTCTGCAGCCTGGG + Intergenic
1164470840 19:28530435-28530457 CTCCTCCTTTTCTGCAGTCTTGG - Intergenic
1165089174 19:33373743-33373765 CTCCGCCCGTTCCGCAGCCGCGG - Exonic
1165177151 19:33938839-33938861 TCCATCTCTTGCTGCAGCCGCGG + Intergenic
1165750339 19:38255816-38255838 CCCCACTCTTTCTCCAGACGTGG + Intronic
1166764635 19:45245469-45245491 CCCCTCCCTCTCTGGGGCCAGGG + Intronic
1167609505 19:50500487-50500509 CCTCTCCCTTTCTGCAGCCTGGG + Intergenic
1168294107 19:55370368-55370390 CCCTTCCCTGTCCGCTGCCGGGG + Exonic
925904737 2:8533745-8533767 GCTCTGCCTTTCTCCAGCCGTGG + Intergenic
927501372 2:23585621-23585643 CTCCTCCCTTTCTGCCCCCCAGG + Intronic
927965265 2:27264077-27264099 CCCCTCCCATTCTACAGTGGCGG - Intronic
928850863 2:35744018-35744040 CTCCTTCCTTTCTGAAGCAGTGG + Intergenic
929531474 2:42755717-42755739 CCGCTCCCTTTCTGGGGCCATGG + Exonic
930023385 2:47014773-47014795 AGCCTCCCTTTCTGCAACCCAGG - Intronic
932313846 2:70767185-70767207 CCCCTCCCTTTCTGCAGCCGGGG - Intronic
932429969 2:71668355-71668377 CTCCTCCCTCTCTGCAAGCGAGG - Intronic
934716823 2:96549467-96549489 CCCCTCCCTGCCTGCACCCCAGG - Intronic
935111037 2:100094557-100094579 CACCTCCCACTCTGCAGCCCAGG + Intronic
935620963 2:105129123-105129145 ACCCTCCATTTCTGCTGCCTTGG + Intergenic
936123939 2:109770605-109770627 CACCTCCCACTCTGCAGCCCAGG - Intergenic
936220750 2:110600859-110600881 CACCTCCCACTCTGCAGCCCAGG + Intergenic
937226535 2:120373641-120373663 CCCCTCCCTCTGGGCAGCTGGGG - Intergenic
938085283 2:128395882-128395904 GCCCTGCCTTTCTCCAGCCCTGG + Intergenic
938369826 2:130762149-130762171 CCCCTCCCTGGCTGCAGCCACGG - Exonic
938371256 2:130769755-130769777 TCCCTCCTTTTCTCCAGCCCTGG + Intergenic
940910319 2:159204496-159204518 CATCTCCCTCTCTGCAGCCTGGG + Intronic
941048093 2:160699046-160699068 CCCCTCACTTGCAGCAGCCCTGG + Intergenic
943687745 2:190836937-190836959 CCCAACCCTCTCTGCAGCTGTGG + Intergenic
946313888 2:218897288-218897310 CCCTCCCCTTTCTGCTGCCTCGG - Intronic
946580158 2:221119509-221119531 CCCCTCTCATGCTGCAGCAGAGG - Intergenic
948362505 2:237432910-237432932 CCCCTCCCGGTCTGTGGCCGAGG - Intergenic
948665334 2:239531170-239531192 GCACTGCCTTTCTGCAGCCTGGG - Intergenic
948746234 2:240095935-240095957 CCCCTCCCTGTCTGCTGCAAAGG - Intergenic
1169043459 20:2516316-2516338 CCCCTCCCTTTTTGAAGACAGGG - Intronic
1171845954 20:30274871-30274893 CCCCTGCCTTTCTTCATCCCGGG - Intergenic
1173147846 20:40540589-40540611 CCCTTCCCTGTCTGCAGCTGTGG - Intergenic
1173381630 20:42549710-42549732 CCCCTCCCATTCACCAGCTGTGG - Intronic
1173633164 20:44531785-44531807 CGCGTCCCCTTCCGCAGCCGCGG - Intronic
1173730552 20:45325468-45325490 ACCCTCCCTTGCTGCACCAGTGG - Exonic
1173845601 20:46186551-46186573 CCCCTCCCTTCTTGCATCCTAGG + Intronic
1174429209 20:50455882-50455904 CCCCTCCCTTACTGGGGCTGAGG - Intergenic
1175380207 20:58557544-58557566 CCCCCACCTTCCTGCAGCCCAGG - Intergenic
1175405423 20:58722934-58722956 CCTCTCCTTTTCAGCAGCAGTGG - Intergenic
1176107308 20:63395546-63395568 CCCCTCCTTCCCTCCAGCCGGGG - Intergenic
1176308182 21:5135324-5135346 CCCTTCCCTCGCTGCAGCTGCGG + Intronic
1176381342 21:6114694-6114716 CTCCTCCCTTTCTTCAGTTGGGG + Intronic
1178124176 21:29499483-29499505 CCCCACCCTGTCTGCAACCTTGG + Intronic
1178582071 21:33845937-33845959 CCCATCCCTTCCTGCTGACGTGG - Intronic
1179411802 21:41168200-41168222 CCCGTCCCGTCCGGCAGCCGCGG - Exonic
1179413353 21:41179036-41179058 CACCTCCCTGGCTGCAGCCTGGG - Intronic
1179742130 21:43423546-43423568 CTCCTCCCTTTCTTCAGTTGGGG - Intronic
1179848878 21:44126708-44126730 CCCTTCCCTCGCTGCAGCTGCGG - Intronic
1180072871 21:45445560-45445582 CACGTCCCTTCCTGCAGCCTTGG + Intronic
1180107796 21:45631250-45631272 CCCCTCCCTTTGTCCAGCTGGGG + Intergenic
1180742104 22:18061048-18061070 CCCCTCCCTTTTTCCATCCTAGG + Intergenic
1180895822 22:19331403-19331425 CCCTGCCCTTGCTGCAGCCAGGG + Exonic
1181343710 22:22201870-22201892 GCCCTCCCTGTCTGCATCCCCGG + Intergenic
1181816046 22:25437604-25437626 GCCCTCCCTCTCTGCAACCCCGG - Intergenic
1182035708 22:27196703-27196725 CCCCACCCTCTCTGCAACTGAGG + Intergenic
1184024928 22:41848512-41848534 CCCCACCCTTGCTGCAGCCAGGG - Intronic
1184421884 22:44386930-44386952 CCCCTCCCTTGCTGACCCCGAGG + Intergenic
1184754218 22:46507380-46507402 TGCCTCCCCTTCAGCAGCCGAGG + Intronic
1184834668 22:47014172-47014194 CCCCTGGCTTTCTGCAGCGGTGG + Intronic
1185137336 22:49080299-49080321 CCCCTCCCTATCTGGGGCCTGGG - Intergenic
1203238653 22_KI270732v1_random:31663-31685 GCCCTGGCTTTCTGCCGCCGCGG + Intergenic
950095892 3:10330203-10330225 CTCCTCCCATTCTTCAGCGGAGG - Intronic
950116016 3:10450717-10450739 CCCGTCCCTCTCTGGAGCCCAGG + Intronic
950666170 3:14496450-14496472 CTCCTCCATTTCTGCAGGAGAGG + Exonic
950677988 3:14566016-14566038 CTCCTCCCTTTCTTCATCTGAGG - Intergenic
952936370 3:38401487-38401509 CCCTTTCCTTTCTGCAGTTGTGG - Intronic
953369806 3:42377838-42377860 CTCCTGCCTTTCTCCAGCCTTGG - Intergenic
953518870 3:43622255-43622277 CCCCTCCCTTTCTCCCGGCCTGG - Intronic
954152568 3:48664817-48664839 CCCCTGCCTGTCTGCCTCCGTGG - Intergenic
956060321 3:65342197-65342219 CTCTTCCCTTTCTGCAGCCCTGG - Intergenic
961440086 3:126947603-126947625 CCCACCCCGTTCTGCAGACGGGG - Intronic
961626107 3:128264813-128264835 CCCCTCCCTTGCTGCCAGCGAGG - Intronic
962254502 3:133861107-133861129 CCCTTCCCCTTCTGCAGGCCTGG - Intronic
965367635 3:167820246-167820268 TCCCTCCCTTGCTGTAGCCGGGG - Intronic
968782425 4:2593201-2593223 CACTTCCCTTCCTGCAGCCCTGG + Intronic
968957206 4:3725508-3725530 CCTCTTCCTTGCTGCAGCCGAGG - Intergenic
969581978 4:8071076-8071098 CTCCTCCCTTTATGCAGCCCTGG + Intronic
969612120 4:8233203-8233225 CCCCACCCTCTCAGCAGCCCGGG + Intronic
969649246 4:8454055-8454077 CCCCTCCTCTTCTGCAGGCTTGG + Intronic
971326894 4:25652167-25652189 CCCCTCTCTTGCAGCAGCTGCGG + Intergenic
972406703 4:38753101-38753123 CCCCTCCCTTTCACAGGCCGAGG - Intergenic
975385984 4:73760886-73760908 CCCAGCCCTTTGGGCAGCCGAGG + Intergenic
978761161 4:112357447-112357469 TCCCTCGCTTTCTGCTGCAGTGG - Intronic
982462699 4:155690753-155690775 CCCTCCCCTTTTTGCAGCAGAGG + Intronic
985641135 5:1063970-1063992 GCCCTCCCTGTCTGCAGGTGTGG - Exonic
986212630 5:5688770-5688792 CACATCACTTTCTGCAGCCAGGG + Intergenic
986683411 5:10253636-10253658 CCCCTCCTTGTCTGCAGATGGGG + Intronic
990147896 5:52783528-52783550 ACCCTCCCCTGCTGCAGCCCTGG + Intergenic
991984438 5:72269347-72269369 CTCCTCCCTTTCTCCAGCAGGGG - Intronic
992203081 5:74403046-74403068 TGCCTCCCTTTCTGCAGCCAGGG + Intergenic
996045735 5:118871504-118871526 CAACGTCCTTTCTGCAGCCGTGG - Intronic
997415535 5:133725450-133725472 CCACTCCCTTTCTTCAGGAGAGG + Intergenic
998132646 5:139659202-139659224 CCCCTACCCGTCTGCAGCAGAGG - Intronic
1001032412 5:168272405-168272427 CCCTTCACTTTCTGCAGAGGTGG + Intergenic
1001546983 5:172576321-172576343 CCTCTCACTTTCTGGAGCCCTGG - Intergenic
1001650166 5:173310406-173310428 CCCATCCCTTTCAACAGCCAAGG - Intergenic
1002709194 5:181184096-181184118 CCCCTCTCCTCCTGCAGCCCTGG + Intergenic
1002964232 6:1946727-1946749 CTCCTCCTTTTCTGCAGCCAAGG - Intronic
1004369240 6:15037928-15037950 CAGCTCCCTTTCTGTAGGCGAGG - Intergenic
1004497891 6:16181624-16181646 CAGCTCCCTTTCTGCAGCTGCGG - Intergenic
1005705432 6:28447049-28447071 CGCTACCCTCTCTGCAGCCGTGG - Intergenic
1005871364 6:29976390-29976412 TCCCTCCCTTTCTGGGGCAGGGG + Intergenic
1007005483 6:38358495-38358517 CCCCTCCCGTTTTGCTGCTGCGG - Intronic
1007774874 6:44219448-44219470 CCCGTCCCTTTCCGGAGCCTCGG + Intergenic
1008288872 6:49687883-49687905 CCCCTCCCCTGATGCAGCAGAGG + Intergenic
1009267871 6:61579028-61579050 TCCCTCTCTTTCTGCTGCAGGGG - Intergenic
1011074238 6:83421006-83421028 CCCCTCCCTGTCTGCATACAGGG - Intronic
1017249122 6:152260942-152260964 CCCATACCTGTCTGCAGCCTGGG + Intronic
1018434900 6:163750973-163750995 CCTTTCCCTTTTTGCAGCCATGG - Intergenic
1018898675 6:168039504-168039526 CCCTTCCCTTGCTGCCTCCGGGG - Intronic
1019125605 6:169838459-169838481 CACCTCGCGTCCTGCAGCCGGGG - Intergenic
1020105870 7:5422094-5422116 CCCCCCCCTTTCTCCCCCCGGGG + Intronic
1022285968 7:28956540-28956562 CCCCTCCGTCGCTGCCGCCGCGG - Exonic
1022339163 7:29452313-29452335 CCCTTCCCTTCCTTCACCCGAGG - Intronic
1022719601 7:32931030-32931052 CCTGTTCCTTTCTGCAGCTGAGG + Intergenic
1025017076 7:55448642-55448664 CCCTTCCCTTTCTGGAGCCTGGG - Intronic
1032823637 7:135548314-135548336 TCCCTCCCTTGCCGCAGCCCTGG - Intergenic
1034875388 7:154720595-154720617 CCCCTGCCATGCTGCAGCCGGGG - Intronic
1035681836 8:1494025-1494047 GCCCTCCCATTCTGCATCGGGGG + Intergenic
1037510314 8:19575979-19576001 CCCCTTCCTTTCTGCAGAGCAGG + Intronic
1038644344 8:29350335-29350357 CCCGCCCCTTTCTGCAGCCTAGG - Exonic
1039790282 8:40870287-40870309 CCTCTTCCTTTCTGTAGCCCAGG + Intronic
1039857163 8:41425388-41425410 CCCCCCCCCTTCTGCTACCGTGG + Intergenic
1041352990 8:56967688-56967710 CCCCTCCCTTGCTGCCACCAGGG - Intronic
1043132087 8:76474250-76474272 CCTATTCCTTTCTGCAGCCCAGG - Intergenic
1044845260 8:96373929-96373951 CCCCTCCCAATCTGCAGCCAGGG - Intergenic
1047073137 8:121370498-121370520 CCACTCCTCTTCTGCAGCCAGGG - Intergenic
1047520386 8:125591512-125591534 CTCATCCCTTTGTGCAGCCTGGG + Intergenic
1049385018 8:142338806-142338828 CCATGCCCTGTCTGCAGCCGTGG - Intronic
1053505434 9:38639016-38639038 CCTCTCCCTTCCTGTAGCCCTGG + Intergenic
1054162124 9:61680971-61680993 CCCCTGCCTTTCTTCATCCTGGG + Intergenic
1057207983 9:93184690-93184712 CCCGTCCCTCTCCGCAGCCTGGG + Intergenic
1057603974 9:96485434-96485456 CCCCTGCCTAACTGCAGACGTGG + Intronic
1057955124 9:99401212-99401234 CACCTCCCTTTCTGTACCAGAGG - Intergenic
1059918358 9:119129482-119129504 CCACTCCCTTTCCCCAGCAGGGG - Intergenic
1060678786 9:125542875-125542897 CCAGTCCCTTTCTGAGGCCGAGG + Intronic
1060701126 9:125748868-125748890 CCCCTCCCCGCCTGCAGCCAGGG - Intronic
1061370398 9:130194453-130194475 GCCCTCCCCTTCTGCAGCTCTGG + Intronic
1062401240 9:136373608-136373630 CTCCTCCCTCCCTGCAGCCCCGG - Exonic
1187296638 X:18008470-18008492 TCCCTCCTTTACTGCAGCCTGGG + Intergenic
1189160391 X:38804117-38804139 CCCGGCCCTTTCTACAGCGGGGG - Exonic
1190491048 X:50983129-50983151 CCCCTGCTTTTCAGTAGCCGTGG - Intergenic
1190690119 X:52907169-52907191 CACCTCCTTTTCTGGACCCGAGG + Exonic
1190695864 X:52948623-52948645 CACCTCCTTTTCTGGACCCGAGG - Exonic
1190751952 X:53369843-53369865 CCTCTCCCTTTCTGCTGGGGTGG + Intergenic
1191105399 X:56769138-56769160 TCCCTCCCTCTCTGGAGCCCAGG + Intergenic
1191106392 X:56774540-56774562 TCCCTCCCTCTCTGGAGCCCAGG + Intergenic
1191107385 X:56779942-56779964 TCCCTCCCTCTCTGGAGCCCAGG + Intergenic
1192043097 X:67643846-67643868 ACACTCCCTTTCTGGGGCCGAGG - Intronic
1195196057 X:102498966-102498988 CCCCTTGCTTTGTGCAGCCTAGG + Intergenic
1196316650 X:114234103-114234125 CCCCTCCCTTACCCCAGCCCTGG + Intergenic
1196639293 X:118039494-118039516 CCCCTCCTTTCCTGAAGCAGAGG - Intronic
1196819649 X:119692777-119692799 CGCCTCCCTCGCTGCAGCTGCGG - Intronic
1197753289 X:129980085-129980107 CCCCCCCCTTCCTGGAGCCAGGG + Intergenic
1200047641 X:153411256-153411278 CCCGTCCCCTTCAGGAGCCGCGG + Intergenic
1200062266 X:153488870-153488892 CCCCTGCCCTCCTGCAGCTGAGG - Intronic