ID: 932313848

View in Genome Browser
Species Human (GRCh38)
Location 2:70767186-70767208
Sequence TCCCCTCCCTTTCTGCAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 553
Summary {0: 1, 1: 1, 2: 6, 3: 65, 4: 480}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932313848_932313856 2 Left 932313848 2:70767186-70767208 CCCGGCTGCAGAAAGGGAGGGGA 0: 1
1: 1
2: 6
3: 65
4: 480
Right 932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG 0: 1
1: 1
2: 29
3: 403
4: 3100
932313848_932313857 16 Left 932313848 2:70767186-70767208 CCCGGCTGCAGAAAGGGAGGGGA 0: 1
1: 1
2: 6
3: 65
4: 480
Right 932313857 2:70767225-70767247 GGAAGATGGAAGAAACAGACTGG 0: 1
1: 0
2: 4
3: 57
4: 630
932313848_932313855 -5 Left 932313848 2:70767186-70767208 CCCGGCTGCAGAAAGGGAGGGGA 0: 1
1: 1
2: 6
3: 65
4: 480
Right 932313855 2:70767204-70767226 GGGGAGGCAGGGAGAGGAGAGGG 0: 2
1: 4
2: 91
3: 801
4: 5694
932313848_932313858 30 Left 932313848 2:70767186-70767208 CCCGGCTGCAGAAAGGGAGGGGA 0: 1
1: 1
2: 6
3: 65
4: 480
Right 932313858 2:70767239-70767261 ACAGACTGGCAAGACCCCCTCGG 0: 1
1: 0
2: 1
3: 11
4: 114
932313848_932313854 -6 Left 932313848 2:70767186-70767208 CCCGGCTGCAGAAAGGGAGGGGA 0: 1
1: 1
2: 6
3: 65
4: 480
Right 932313854 2:70767203-70767225 AGGGGAGGCAGGGAGAGGAGAGG 0: 1
1: 11
2: 100
3: 964
4: 6189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932313848 Original CRISPR TCCCCTCCCTTTCTGCAGCC GGG (reversed) Intronic
900101755 1:964917-964939 CCGCATCCCTTCCTGCAGCCAGG + Intronic
900117629 1:1035202-1035224 TCCCATCCCTTTGCCCAGCCTGG - Intronic
900367196 1:2316094-2316116 TCTCCGGCCTATCTGCAGCCAGG - Intergenic
900482507 1:2905899-2905921 GCTCCTCCCTCCCTGCAGCCAGG - Intergenic
900659015 1:3773688-3773710 TCCCATCCCCTGCTGCACCCTGG + Intronic
900709101 1:4101233-4101255 CCCCCTCCCCTGCTGCTGCCTGG + Intergenic
901930930 1:12595768-12595790 TCCCCTCCCCAGCTGCACCCGGG - Intronic
902412470 1:16219456-16219478 TGCTCTCCCTCTCTGGAGCCAGG + Intergenic
902768569 1:18632472-18632494 TCCCAGCCTTTTCTCCAGCCAGG - Intronic
903709668 1:25313665-25313687 CCCCCTCTCTTTCTGCTGCCTGG - Intronic
903717451 1:25378724-25378746 CCCCCTCTCTTTCTGCTGCCTGG + Intronic
903753724 1:25646359-25646381 TCCCCGCACCCTCTGCAGCCTGG - Intronic
904255077 1:29249560-29249582 CACACTCCCTTTCTGCAGCCTGG - Intronic
904290174 1:29479957-29479979 TTCCCTCCCTTTTTCCTGCCTGG + Intergenic
904599520 1:31665842-31665864 TTCCCTGCCTCCCTGCAGCCAGG + Intronic
905775562 1:40665406-40665428 CCCCCTCCCTGTCTGGACCCCGG - Exonic
905855158 1:41306131-41306153 CCTCCCTCCTTTCTGCAGCCAGG - Intergenic
906519355 1:46458141-46458163 TCCCATCCCGTACTGCAGCCAGG + Intergenic
907181424 1:52573623-52573645 TCAGCTCCATTTCTGGAGCCTGG + Intergenic
907918747 1:58894156-58894178 GCCCCTCGCATTCTGCAGCAAGG - Intergenic
908121033 1:60986132-60986154 GCCCCTCCATTACTCCAGCCTGG - Intronic
908664359 1:66473715-66473737 TCCCCAACCTTTCTGCCACCAGG + Intergenic
909994423 1:82261292-82261314 TCACCTCCCTCTGTGCAGCCCGG + Intergenic
910146055 1:84081139-84081161 TCACCTGCCTTTCTGAAGCTTGG - Intronic
911040621 1:93588345-93588367 TCCACTCCACTCCTGCAGCCGGG + Intronic
911365061 1:96928258-96928280 TCCCCTCCTGCTGTGCAGCCCGG - Intergenic
912798127 1:112705119-112705141 CGCCCTCTCTTCCTGCAGCCTGG - Exonic
912950042 1:114114253-114114275 TCCCCTTCCATTCTGCCCCCTGG + Intronic
915084302 1:153374672-153374694 TCCCCTCTCTTTCTGAATCAAGG + Intronic
916314642 1:163435904-163435926 TCCTTTCCCCTTCTCCAGCCAGG + Intergenic
916684077 1:167128580-167128602 CTCCCTCCTTTTCTGCAGCTTGG - Exonic
916836825 1:168554493-168554515 TCACCAACCTTTCTGCTGCCAGG + Intergenic
916853466 1:168726974-168726996 TCCCCACCCCTTCTACAGTCCGG + Intronic
917122339 1:171655530-171655552 TCCATTTCCTTTCTGGAGCCTGG + Intergenic
917637452 1:176950882-176950904 TCCCCTCCCTCCCTACTGCCTGG + Intronic
917981488 1:180272258-180272280 TCCCCTCCCCTCCTGCTGACTGG + Intronic
919678421 1:200409719-200409741 TCCTCCTCCTTTCTTCAGCCAGG - Exonic
919843490 1:201626356-201626378 TTCCCTCCCCATCTCCAGCCTGG + Intronic
919857282 1:201714488-201714510 TCACCTCCCTTTCAGTAGTCAGG - Intronic
920454228 1:206086057-206086079 ATCCCTCCCTTTCCTCAGCCTGG + Intronic
920576285 1:207063241-207063263 TCCCCACCCTTGCAGCAGCCTGG + Intronic
920706234 1:208252597-208252619 TGCCCTGCTTTTCTGAAGCCAGG - Intergenic
920833771 1:209488730-209488752 TCAGATCCCTTTCTGCAGTCTGG + Intergenic
921273583 1:213494134-213494156 TCCCAACCATTTCTGTAGCCGGG - Intergenic
922738880 1:228004875-228004897 TCCCTTCATCTTCTGCAGCCTGG + Intergenic
923085143 1:230697506-230697528 CTCCCTCCCTATCAGCAGCCAGG + Intergenic
923289042 1:232526579-232526601 TCGCCTCCTTCTGTGCAGCCCGG + Intronic
923337206 1:232980762-232980784 TCCCCTCCCTGCACGCAGCCAGG + Exonic
923468643 1:234270318-234270340 TGGCTTCCCTTTCTGAAGCCAGG - Intronic
923519448 1:234724738-234724760 GCCCCTCTCTGTCTGCAGCCAGG - Intergenic
923617340 1:235548711-235548733 TCCCCTCCCTTCCTACAGCAGGG - Exonic
1063417813 10:5888795-5888817 TCACCTCCCTTTCTAGAGCACGG - Intronic
1063575193 10:7255682-7255704 TCAACTTCCTTTCTGCACCCTGG + Intronic
1064808538 10:19166236-19166258 TTGCCTCACTTTCTGCTGCCTGG + Intronic
1064962818 10:20984774-20984796 TCACCTCCTTCTGTGCAGCCCGG - Intronic
1065168918 10:23008965-23008987 ACCCCTCCCTTCCACCAGCCTGG - Intronic
1066379750 10:34891140-34891162 TCCTCTCCCTTCCTGCAGGAAGG - Intergenic
1067758552 10:49025655-49025677 TTCCCTCCCCTGCTGGAGCCAGG - Intronic
1068090595 10:52428468-52428490 TCCCCTACCTTTTTGGTGCCAGG + Intergenic
1068144124 10:53044504-53044526 CCTCCTTCCTTTATGCAGCCTGG + Intergenic
1069552670 10:69375477-69375499 TCCTCTGCCTGGCTGCAGCCAGG + Intronic
1069723670 10:70564506-70564528 TCCCCTCACCTCCTGCATCCAGG - Exonic
1069849890 10:71397712-71397734 TCCCCTCCCCTTCTGAGCCCTGG + Intronic
1069854406 10:71431842-71431864 TCCCATCTCTCCCTGCAGCCCGG - Intronic
1069857539 10:71449810-71449832 TGCCCTCCCATTCTGCTCCCAGG - Intronic
1069959124 10:72069253-72069275 TCTCCTCCCTTTCTTCTCCCTGG + Intronic
1070218074 10:74407723-74407745 TTCCTTCCCGCTCTGCAGCCTGG + Intronic
1070502210 10:77082739-77082761 TCCACCCTCTCTCTGCAGCCTGG + Intronic
1070656949 10:78278193-78278215 TCACCTCCCTTGCTGTGGCCGGG - Intergenic
1070772379 10:79089857-79089879 TCCCCTCCCTTCCGAAAGCCAGG - Intronic
1071398291 10:85244621-85244643 TCCTCTCCTTTGCTGCAGACTGG - Intergenic
1071573756 10:86711593-86711615 TCCCCGCCCTCTCTGACGCCCGG - Intronic
1073679149 10:105683179-105683201 TCCCCTCCCTTGATAAAGCCAGG + Intergenic
1074365556 10:112854914-112854936 TCCCCTCCCTCACTGAGGCCCGG - Intergenic
1074394877 10:113089402-113089424 CCCCCTCCCTTGCTGCACTCAGG + Intronic
1074854087 10:117460577-117460599 TCTCCTCCCTTAATGAAGCCAGG + Intergenic
1074871354 10:117578501-117578523 TTCCCTCCGTTTTTCCAGCCTGG - Intergenic
1075610912 10:123853972-123853994 TCCCCTCCCTCTCCCCACCCTGG + Intronic
1075972390 10:126665712-126665734 TCCCCTCCTAAGCTGCAGCCTGG - Intronic
1076030340 10:127152472-127152494 CCTCCTCCCTTCCTGCTGCCAGG + Intronic
1076523160 10:131093655-131093677 GCCCCTCCCTTGCTGCCACCAGG + Intronic
1077252849 11:1568225-1568247 CCCTCGCCCTCTCTGCAGCCAGG + Intronic
1077545100 11:3165656-3165678 TCCTCTCCCTTCCTGAACCCAGG + Intronic
1078652109 11:13205535-13205557 CCCCCTCCCTCTCTACAGCTTGG - Intergenic
1078799413 11:14627983-14628005 TCACCTCCTGTTGTGCAGCCTGG - Intronic
1079508829 11:21186000-21186022 TTTCCTTCCTTTCTGCATCCTGG - Intronic
1080656100 11:34259614-34259636 TTCTCTCCCTTTCAGCAGCTGGG + Intronic
1080921257 11:36711567-36711589 TCCTGTCCCTTTCTGAAGCAGGG + Intergenic
1081990085 11:47332973-47332995 TCCCCTCCCTCCCTGCCCCCAGG - Exonic
1082770755 11:57205817-57205839 TCCCATCCCTTCCTGAAGGCAGG - Intergenic
1082793493 11:57363784-57363806 TACCCCCTCTGTCTGCAGCCTGG + Intronic
1083622012 11:64053811-64053833 TCCCCTCCCCATCTGCGGGCAGG - Intronic
1083764663 11:64836113-64836135 TCACCTCCCTCTGGGCAGCCCGG + Exonic
1083901163 11:65644225-65644247 CCCCCTCCCTGGCTGCAGCAAGG - Intronic
1084010488 11:66345809-66345831 TCACCTCCCTTTTTACAGACAGG + Exonic
1084148216 11:67276039-67276061 GCCCCTGCCTTTCTGCACCCCGG - Intronic
1084852666 11:71955471-71955493 TCCTCTGCCTTTCTCCAGCATGG - Intronic
1085095608 11:73758513-73758535 CCCCCTCCATTACTGAAGCCTGG - Intronic
1085298295 11:75443282-75443304 GCCCCACCCTCCCTGCAGCCTGG - Exonic
1085515444 11:77109027-77109049 TCCCCTGCGTTTCTGTAACCTGG + Intronic
1085996749 11:81926309-81926331 TCCCCTCCCTGTGTCCAGCATGG - Intergenic
1088894138 11:114065008-114065030 GCCTGTCCCTTTCTGCAGCTTGG + Intronic
1088908876 11:114175718-114175740 TTCCCTCACTTTCTCCAGGCTGG - Intronic
1088920796 11:114258513-114258535 TCCCCTCCCTTCCTGGTGCCAGG - Intronic
1089186067 11:116615471-116615493 TTCACTCCCTTTCTGCAGATGGG - Intergenic
1090156875 11:124448050-124448072 TCCACTCCCTTGCTGCATTCTGG - Intergenic
1090330778 11:125930523-125930545 TCCCCAGCCTTTCTGCCACCAGG - Intergenic
1090600469 11:128364633-128364655 TCCTCTCCATTTCTGCAGCAAGG + Intergenic
1090659051 11:128869007-128869029 TCACCTCCTTCTGTGCAGCCTGG + Intergenic
1090743947 11:129692067-129692089 TCCCCTCACTCTCTGCACCCCGG + Intergenic
1090817942 11:130314933-130314955 TCTCCTCCCCTTCCCCAGCCAGG - Intergenic
1091325792 11:134686496-134686518 ATCCCTCTCTTTCTCCAGCCAGG + Intergenic
1091413389 12:258758-258780 TCCCCTCTCTTTCAGCCCCCTGG - Intronic
1091874725 12:3924495-3924517 TCCCTTCCCTCTCTTCACCCTGG + Intergenic
1091942570 12:4501421-4501443 TCACCTCCCACTATGCAGCCCGG - Intronic
1092290129 12:7155515-7155537 TCACCACCCCTTCTGGAGCCTGG + Intronic
1093661982 12:21767624-21767646 TCCCCAACCTTTTTGGAGCCAGG - Intronic
1093714105 12:22361937-22361959 TCACCTCCTGTTGTGCAGCCTGG - Intronic
1094111894 12:26870778-26870800 GCCCCTCCCTTGCCCCAGCCTGG - Intergenic
1095995971 12:48085049-48085071 TCCCCGCCATCCCTGCAGCCAGG - Intronic
1099304361 12:80936844-80936866 TCCCCGCGCCTTCCGCAGCCTGG + Intronic
1100993710 12:100279364-100279386 TCACCTCCTGCTCTGCAGCCCGG + Intronic
1101802442 12:108034115-108034137 TCCCCTGTCTTTCTGCTGCTTGG + Intergenic
1101860030 12:108475332-108475354 GCCCCTGCCTTTCTGGAGCCTGG - Intergenic
1101968643 12:109297188-109297210 TCACCTCCTTCTGTGCAGCCCGG - Intronic
1101977226 12:109370215-109370237 TCCCCTCCCTGGCTGAAGCCAGG + Intronic
1102974608 12:117197479-117197501 GCCTCTCCCTTGCTGCAGCAAGG + Intergenic
1103017837 12:117509348-117509370 TCCCCTCCAATTCAGGAGCCAGG + Intronic
1103563948 12:121806159-121806181 TCCCCACCCTTCCTGCAGCGTGG + Intronic
1104361243 12:128135267-128135289 TCACCTCCTTTTCTGCAGCCCGG - Intergenic
1104860094 12:131919088-131919110 TACCCTCCCCTGCTGCAGCCCGG - Intronic
1104996446 12:132660783-132660805 TCCCCTCAACTTCTGCATCCAGG - Intronic
1105279417 13:18954508-18954530 GCCCATCCCTCTCTGCAGACTGG + Intergenic
1105476705 13:20734272-20734294 TCCCATCCCTTCTTGCATCCTGG - Intronic
1105733006 13:23238162-23238184 TCCCCTCCCTCATTGCAGCCTGG - Intronic
1106033641 13:26024787-26024809 TCTCCTTTCTTTCTTCAGCCAGG - Exonic
1106128808 13:26922496-26922518 GCCCTTCCCCTTCTCCAGCCTGG + Intergenic
1106327289 13:28705819-28705841 TCTGATCTCTTTCTGCAGCCAGG + Intronic
1106506885 13:30378279-30378301 TCCAACCCTTTTCTGCAGCCAGG - Intergenic
1106609456 13:31264459-31264481 TCCTCTCCCTTTCCTCTGCCAGG + Intronic
1107371067 13:39748686-39748708 TCCCTTCCCTTTCAGCAGAAAGG + Intronic
1107414447 13:40188008-40188030 TCCTTTACCTTTCTGCCGCCAGG - Intergenic
1108456572 13:50620953-50620975 TCCTCTCTCCTCCTGCAGCCTGG + Intronic
1111236126 13:85410627-85410649 TGTCCTCCCTTTCTGCAACTTGG + Intergenic
1111543149 13:89695297-89695319 TACCCTCCCCTTTTGTAGCCAGG + Intergenic
1112117275 13:96369759-96369781 TTCCCTCCCTTTCTTCAGAGGGG - Intronic
1112326854 13:98447290-98447312 ACCCCTCCCCTTCTGCCTCCCGG - Intronic
1112910839 13:104481449-104481471 TTATCTCCCTTCCTGCAGCCAGG + Intergenic
1113117526 13:106889205-106889227 TCACCTCCCACTGTGCAGCCTGG + Intergenic
1113928510 13:113954006-113954028 TCCCCTTTCTCTCTGCAGCCTGG + Intergenic
1113959641 13:114119552-114119574 GCCCCTCCCTCTCTCCAGCCAGG + Intronic
1113959656 13:114119620-114119642 GCCCCTCCCTCTCTCCAGCCAGG + Intronic
1113959664 13:114119654-114119676 TCCCCCCCTTCTCTCCAGCCAGG + Intronic
1113959678 13:114119691-114119713 CCCCCTCCCTCTCTCCAGCCAGG + Intronic
1113959691 13:114119728-114119750 CCCCCTCCCTCTCTCCAGCCAGG + Intronic
1113959712 13:114119797-114119819 GCCCCTCCCTCTCTCCAGCCAGG + Intronic
1113959720 13:114119831-114119853 TCCCCCCCTTCTCTCCAGCCAGG + Intronic
1113959731 13:114119865-114119887 GCCCCTCCCTCTCTCCAGCCAGG + Intronic
1113959765 13:114119970-114119992 GCCCCTCCCTCTCTCCAGCCAGG + Intronic
1113959787 13:114120040-114120062 GCCCCTCCCTCTCTCCAGCCAGG + Intronic
1113959797 13:114120074-114120096 GCCCCTCCCTCTCTCCAGCCAGG + Intronic
1113959843 13:114120214-114120236 GCCCCTCCCTCTCTCCAGCCAGG + Intronic
1113959865 13:114120284-114120306 GCCCCTCCCTCTCTCCAGCCAGG + Intronic
1113959922 13:114120464-114120486 GCCCCTCCCTCTCTCCAGCCAGG + Intronic
1113959944 13:114120534-114120556 GCCCCTCCCTCTCTCCAGCCAGG + Intronic
1113959964 13:114120604-114120626 GCCCCTCCCTCTCTCCAGCCAGG + Intronic
1114487495 14:23071599-23071621 TCCCCTCCCCTGCTGCAGCAAGG - Intronic
1114706657 14:24734267-24734289 TCCCCTGCCTTTCTCCCCCCGGG + Intergenic
1115301734 14:31892901-31892923 TTCCCTCCCTTTATTCTGCCAGG + Intergenic
1115687216 14:35808887-35808909 TCCCTCCACTTTCTGCCGCCGGG - Exonic
1116485029 14:45437280-45437302 TCCCCTTCATTTCAGCTGCCTGG - Intergenic
1116553475 14:46272430-46272452 TCCCTTCCCTTTCTTCATCATGG - Intergenic
1117572951 14:57067055-57067077 TGCCGGCCCTTTCTGCAGCACGG - Intergenic
1117592825 14:57292127-57292149 TCCTTTTCCTTTCAGCAGCCTGG - Exonic
1117981083 14:61342330-61342352 TCCAAGCCTTTTCTGCAGCCAGG - Intronic
1118592171 14:67410091-67410113 TCTCCTCATTTTCTGCACCCTGG + Intronic
1118609518 14:67529212-67529234 TCCCCTCCCCATCCGCTGCCTGG + Intronic
1119175388 14:72564659-72564681 ACCCTGCCCTGTCTGCAGCCTGG - Intronic
1119180997 14:72605209-72605231 TCCCATCCCCTTCTCCAGCATGG - Intergenic
1120700823 14:87697135-87697157 TCCTCTCCGTTTCTGCTGGCTGG - Intergenic
1121250961 14:92498975-92498997 TTCCCTCCTGTTCTGCAACCAGG + Exonic
1121497067 14:94400183-94400205 TCCCCTCCTGCTCTGCAGCCCGG + Intergenic
1121557514 14:94849480-94849502 TCCCCCCCCTTGCAGCAGCCTGG + Intergenic
1121887856 14:97561251-97561273 CACCCACCCTTTCTGCAGGCAGG - Intergenic
1122048579 14:99040203-99040225 GTCCATCCCTGTCTGCAGCCAGG - Intergenic
1122076411 14:99237925-99237947 CCACCTCACTTCCTGCAGCCTGG - Intronic
1122324797 14:100875661-100875683 CCCCCTCCCTTCCTGCAGGAGGG + Intergenic
1122413848 14:101539269-101539291 TCCCCAGGCATTCTGCAGCCAGG + Intergenic
1122655792 14:103258473-103258495 TCCCACCCCTTCCTGCACCCAGG - Intergenic
1123009385 14:105340397-105340419 TCCCCAACCTTTTTGCCGCCAGG + Intronic
1202905558 14_GL000194v1_random:69675-69697 TCCCCTCCCTTGCAGCATGCTGG - Intergenic
1125100707 15:35909171-35909193 GCCCCTCCCTTTCTCAAGCATGG + Intergenic
1125332213 15:38593496-38593518 TTCCCTCCCTTTCTGCTGCCAGG + Intergenic
1125520382 15:40345042-40345064 TGCCCTCCCTCTCTCCACCCGGG + Intergenic
1126949692 15:53867894-53867916 TCCCATGCCTCACTGCAGCCTGG + Intergenic
1127028335 15:54833287-54833309 CTACCTCTCTTTCTGCAGCCTGG - Intergenic
1127328338 15:57916461-57916483 GCCCCTGACTCTCTGCAGCCTGG - Intergenic
1127606377 15:60592048-60592070 TCCCCTTCCTTTCCGAAGCGCGG + Intronic
1127745161 15:61961818-61961840 TGGCAGCCCTTTCTGCAGCCTGG + Exonic
1128185096 15:65638110-65638132 TCCTCTCCCTGTTTGCAGCCGGG + Exonic
1131050876 15:89347018-89347040 TCCCGTCCCTTTCTGCAGTTTGG - Intergenic
1131176875 15:90214915-90214937 TCCCCACCCTTTATGGAACCAGG + Intronic
1131399193 15:92110962-92110984 TCCTCTACCATTCAGCAGCCAGG - Intronic
1131558009 15:93415841-93415863 TCCCTTCCCCTTCCACAGCCTGG - Intergenic
1132313593 15:100875257-100875279 TCTTCTTCCTTTCTGCTGCCTGG - Intergenic
1132342818 15:101088838-101088860 TCCTCTCCCTCACTGAAGCCCGG + Intergenic
1133233747 16:4378373-4378395 TCCCCTCCCACTCTGGAACCTGG + Intronic
1133276411 16:4640801-4640823 GCACCTCCCCTCCTGCAGCCGGG - Intronic
1133640178 16:7709171-7709193 TCCCTTCCCTTTCCCCAGCTGGG + Intronic
1134100445 16:11448086-11448108 GCCCGTCCCTCTCTTCAGCCTGG - Intronic
1134336695 16:13306226-13306248 ACCCCTCCCTTCCTGCAGATTGG - Intergenic
1134537868 16:15041210-15041232 TTTCCTCCCTTTCTGCATCGAGG - Intronic
1135239801 16:20794126-20794148 ATGCCTCCCTTTCTGCTGCCAGG + Intronic
1136621160 16:31429263-31429285 TCCCATCCCCTCCTGCAGCTGGG - Intergenic
1137580934 16:49633029-49633051 GCCTTTCCCTTCCTGCAGCCAGG + Intronic
1138345587 16:56318174-56318196 GCCCCTCCCTCTCTGCAGCTGGG - Intronic
1139231201 16:65284138-65284160 TTCCCTGCCTCTCTACAGCCAGG - Intergenic
1139521309 16:67484088-67484110 TCCCCTCCCTTTCTCCCTCCAGG + Intergenic
1140830110 16:78743011-78743033 TCCCAACCCTTACTGCAGCCGGG + Intronic
1141552515 16:84815624-84815646 TCCCGTCTCCCTCTGCAGCCAGG - Intergenic
1141613701 16:85198266-85198288 TCCTCTCCCCTTTTACAGCCAGG - Intergenic
1141734314 16:85842020-85842042 GCCCCTCCCCTTGTGAAGCCTGG + Intergenic
1141955703 16:87370159-87370181 TCCCCTCCCTCTCAGGGGCCCGG + Intronic
1142253062 16:89001612-89001634 TCCACTCCGAGTCTGCAGCCGGG - Intergenic
1142639740 17:1279141-1279163 TCCCCTTCCCTTCTGGAGTCGGG + Intergenic
1143026466 17:3944529-3944551 GCCCCTCCCTTTCCGCAGACAGG - Intronic
1143620092 17:8075752-8075774 TCCCCTCCCACTCCTCAGCCAGG + Intronic
1143637683 17:8175853-8175875 TCCACTTCCTCTCTGCAGGCTGG - Exonic
1143896634 17:10141566-10141588 TCTCCTCCCTCTTTGGAGCCGGG - Intronic
1144383442 17:14726326-14726348 TACCCTCCCTTTCTTCAGGTGGG + Intergenic
1144789528 17:17849752-17849774 TCCCCTCCCTGTCTGGACCCTGG + Intronic
1145408215 17:22629270-22629292 TCCTTTCCCTTTCTACACCCTGG - Intergenic
1146069534 17:29667410-29667432 TCACCTCCTGTTCTGCTGCCCGG - Intronic
1146445226 17:32927942-32927964 TCCCCTCTCCGTCTGCCGCCCGG + Exonic
1146688124 17:34855457-34855479 TGCCCTCCCTCTCTGAACCCAGG + Intergenic
1147638051 17:41975899-41975921 TCTGCTCCCTTTCTGCATGCAGG - Exonic
1147740953 17:42670701-42670723 TCCGCTCCTCTTCTGCAGCTTGG - Exonic
1148386722 17:47239404-47239426 TCCTCTTCCTTTCTGCACCTTGG + Intergenic
1149347015 17:55749183-55749205 TCTCTTCCCTTTCTGAAACCTGG + Intergenic
1149781796 17:59403438-59403460 TCCCCTCCCTTTCTCCCAGCAGG - Intergenic
1150006045 17:61469640-61469662 TCCACTGCCTTTCTGTACCCAGG + Intronic
1151668382 17:75558366-75558388 CCCCCTCCCTTTCCACAGCTGGG + Intronic
1151691393 17:75688179-75688201 TTCCTCCCCTTTCTGCACCCAGG - Intronic
1152015323 17:77746936-77746958 TCCCCTCCCTCTCAGCCCCCTGG + Intergenic
1152496315 17:80674993-80675015 TCTCCTGCCCTTCTGAAGCCAGG - Intronic
1152556753 17:81057140-81057162 GCCCCGCCCTTTCTGCGGCCTGG + Intronic
1152626225 17:81389036-81389058 GCCCCTCCGCCTCTGCAGCCAGG + Intergenic
1152703581 17:81831877-81831899 TCCCCTCCCTATCTGGAGGGAGG - Intronic
1152720228 17:81919986-81920008 TCGCCTCCAGGTCTGCAGCCTGG + Exonic
1152772537 17:82179149-82179171 TCCGCTCCCTTTCCACTGCCAGG + Exonic
1152874883 17:82781000-82781022 TCCCCACCCCTCTTGCAGCCCGG - Intronic
1152990373 18:358164-358186 TCCCCTACCTTTTTGGAACCAGG - Intronic
1153987544 18:10367021-10367043 GCCCCTTGCTTTCTGCAGCCAGG + Intergenic
1155254558 18:23983320-23983342 TCCCCTTTCTTTCTGCTCCCAGG - Intergenic
1155537575 18:26832990-26833012 GCCCCTCCCACACTGCAGCCTGG + Intergenic
1155711680 18:28888116-28888138 TCCCATCACTTTATGAAGCCAGG - Intergenic
1156665864 18:39406250-39406272 TGCCCTCTCCTTCTGCAGCTTGG + Intergenic
1157532847 18:48436571-48436593 ACCCTTCCCTTTCTCCATCCTGG - Intergenic
1157714449 18:49873795-49873817 CCACCTCCCTTTCTCAAGCCTGG - Intronic
1158537231 18:58319198-58319220 TCCCCTCCCTCTCTGGGCCCAGG - Intronic
1158677593 18:59535533-59535555 TCCCCTCCCATACTTCAGACTGG - Intronic
1159153542 18:64552962-64552984 TCACCTCCCGCTGTGCAGCCTGG - Intergenic
1159665324 18:71151777-71151799 TCCCATTTCTGTCTGCAGCCAGG + Intergenic
1160217017 18:76941106-76941128 TCCCCACCCTTTTTGGAACCAGG - Intronic
1160313843 18:77822009-77822031 TGCACTCCCTCTCTGCAGCTGGG + Intergenic
1160516150 18:79480293-79480315 CTCCCTCTCTTTCTGAAGCCTGG - Intronic
1160871541 19:1280057-1280079 GACCCTCCCTGTCTGCCGCCAGG + Intergenic
1160895316 19:1399643-1399665 GCCGCTCCCTTTCTGCAGGTGGG - Intronic
1161084810 19:2329972-2329994 ACTCCCCCCATTCTGCAGCCAGG + Intronic
1161093368 19:2374836-2374858 TCCCCTCCTTTGCTGCTGTCTGG - Intergenic
1161108629 19:2456440-2456462 GCCCGTCCCTGTCTGCACCCAGG + Intronic
1161326706 19:3667679-3667701 TCCCCTCCCCTCCTCCAGGCAGG - Intronic
1161346099 19:3769554-3769576 TACCCTCCCCGTCTCCAGCCTGG - Exonic
1162199526 19:9010429-9010451 TCACCACCCTCCCTGCAGCCGGG - Intergenic
1162258101 19:9509591-9509613 TCCAATCCCATTCTGCTGCCAGG - Intergenic
1163054121 19:14705676-14705698 TCACCTCCTGCTCTGCAGCCTGG - Intronic
1163357793 19:16825668-16825690 TCCCCTCCCTCTCTGCAGCCTGG + Intergenic
1163457849 19:17419187-17419209 TCCTCTCCCTTCCTGTACCCAGG + Exonic
1163768917 19:19179078-19179100 TCCCCTCCGCTGCTGCTGCCCGG - Intronic
1163784264 19:19266567-19266589 TGTCCTGCCTTTCTGCGGCCTGG - Exonic
1164576572 19:29408775-29408797 TCCCCTCCCTTTGTTCTGCAAGG + Intergenic
1165749935 19:38253415-38253437 TCCCCTCCCTTCCTGTCCCCTGG - Intronic
1165780088 19:38427450-38427472 TCCCCTGCCTTTCTTAAGCAGGG + Intergenic
1166254098 19:41590079-41590101 TTCCCTCCCCAGCTGCAGCCTGG + Intronic
1166409452 19:42546940-42546962 TTCCCTCCCCAGCTGCAGCCTGG - Intronic
1166632474 19:44419210-44419232 GCTCCGCCCTTTCTGCTGCCAGG + Intronic
1166760364 19:45220644-45220666 TCCCCTCCCTGTCTTATGCCTGG - Intronic
1166764633 19:45245468-45245490 ACCCCTCCCTCTCTGGGGCCAGG + Intronic
1167116696 19:47492795-47492817 CCCCCACCCTGTCTTCAGCCTGG - Intronic
1167117997 19:47499207-47499229 ACCCCTCACTTCCTGCAGACAGG - Intronic
1167265088 19:48479105-48479127 ACCCCTCCCCTTCTGCAGGGCGG + Exonic
1167504769 19:49865422-49865444 CTCCCTCTCTTTCTGCAGCTGGG - Exonic
1167609503 19:50500486-50500508 CCCTCTCCCTTTCTGCAGCCTGG + Intergenic
1167616965 19:50540258-50540280 TCACCTCCTTCTGTGCAGCCTGG - Intronic
1168369106 19:55816624-55816646 TCCCCTACATTTCTGTAGCTGGG + Intronic
925352371 2:3210385-3210407 TCCCCAGCCTCTCTGCAGCCTGG - Intronic
925794260 2:7525915-7525937 TCCCCTTTCATTCTGCTGCCTGG + Intergenic
927044732 2:19265471-19265493 TTTCCTCCCTTTCTGCTGTCTGG - Intergenic
927193346 2:20531899-20531921 TCCCCTCCTGTTCTGGAGACGGG - Intergenic
927395967 2:22651566-22651588 GCCCCAGCCTTTCTTCAGCCTGG - Intergenic
927490552 2:23518411-23518433 TCCCCCCTCTCTTTGCAGCCAGG - Intronic
927567646 2:24127107-24127129 TCCCCTCCCTCTCTGGCTCCTGG + Intronic
927765493 2:25803554-25803576 TCCCCAACCTTTCTGCATCAGGG + Intronic
928367839 2:30716309-30716331 TCACCTGCTTTGCTGCAGCCGGG + Intergenic
928425484 2:31174488-31174510 TCCCTTCCCTTTCTGCATGCTGG + Intronic
929868376 2:45737342-45737364 TCCCCACCCTGCCTGAAGCCAGG + Intronic
932313848 2:70767186-70767208 TCCCCTCCCTTTCTGCAGCCGGG - Intronic
932581200 2:72993749-72993771 CCCCCTACCTCTCTCCAGCCTGG + Intronic
933739624 2:85523336-85523358 TCACCTCCCAATGTGCAGCCTGG + Intergenic
934610992 2:95736189-95736211 TCCCCACCCATTCTGTTGCCTGG + Intergenic
935112306 2:100104764-100104786 TCCCCTCCCTCGCGGCGGCCCGG + Intronic
935429683 2:102961758-102961780 TCCCCTATCTTCCTGCAACCTGG + Intergenic
936049084 2:109209500-109209522 TCGCCTCCCTTGCTGTACCCAGG - Intronic
937902771 2:127034619-127034641 TCCCCAGCCTTTCTGGCGCCCGG - Intergenic
938501651 2:131833841-131833863 TCCCCTCCCTTCTTGCAGAGCGG + Intergenic
938939364 2:136155545-136155567 TCCTCTCTCTTTCTGCTACCTGG - Intergenic
940044369 2:149393325-149393347 TCCCATCATTTTCGGCAGCCAGG + Intronic
940312340 2:152291909-152291931 TCACCTCCCTTTGTGCCACCTGG - Intergenic
940910318 2:159204495-159204517 ACATCTCCCTCTCTGCAGCCTGG + Intronic
940918415 2:159283225-159283247 TCCCCACCTTTTCGGCAGCAGGG + Intronic
941002736 2:160218751-160218773 TCACCTCCTGCTCTGCAGCCTGG - Intronic
941327206 2:164131212-164131234 TCACCTCCCACTGTGCAGCCTGG - Intergenic
941622376 2:167792772-167792794 TGACCTCCCTGTCTGCAGGCTGG - Intergenic
941987540 2:171523226-171523248 TCCCCTCCTCATCTGCAGCCTGG - Intronic
942208802 2:173650117-173650139 TCCCCTTCCTCCCTGCACCCTGG - Intergenic
942728057 2:179032205-179032227 TCCCCATCCTTTCTGCTGCTTGG - Intronic
942877985 2:180825781-180825803 TCCCTTTCCTTTCTGCTGGCTGG + Intergenic
944901295 2:204219314-204219336 TCACCTCCTTCTGTGCAGCCTGG - Intergenic
945918578 2:215731130-215731152 TCCTCTGCCTTTCTGGAACCTGG - Intergenic
946166007 2:217864197-217864219 TCCCCACCCTTACTGCTCCCAGG + Intronic
946228864 2:218279446-218279468 AACCCTCCCTAGCTGCAGCCTGG + Intronic
947024133 2:225717224-225717246 TTCCCTCACTCTCTGCAGCTGGG + Intergenic
947561725 2:231160007-231160029 TCACCTCCTGCTCTGCAGCCAGG + Intronic
947615998 2:231557289-231557311 TCTCCTCCCTGCCTGAAGCCTGG - Intergenic
948073027 2:235142780-235142802 TCCCCGCCCTTTCTGAAAGCTGG + Intergenic
948086865 2:235257932-235257954 TCCCCAACCTTTTTGCCGCCAGG + Intergenic
948542911 2:238702854-238702876 TCCCATCCCACTCTGCTGCCCGG + Intergenic
948632276 2:239309888-239309910 CCCCCTCCCATGCTGCTGCCTGG + Intronic
948665335 2:239531171-239531193 TGCACTGCCTTTCTGCAGCCTGG - Intergenic
1168808159 20:684993-685015 CCCCCTCCCCCTCTGCAGCTAGG - Intergenic
1169043461 20:2516317-2516339 TCCCCTCCCTTTTTGAAGACAGG - Intronic
1170190183 20:13638272-13638294 TCCCCTCCCCTACAGAAGCCAGG + Intronic
1170895094 20:20405730-20405752 TCCCCTGCCTTTCTCCACACCGG + Intronic
1171303217 20:24082282-24082304 TTCCCTCACATTCTGCATCCAGG + Intergenic
1171845956 20:30274872-30274894 CCCCCTGCCTTTCTTCATCCCGG - Intergenic
1172227224 20:33313109-33313131 TCCCCTTCATTTCTGCAAACTGG - Intergenic
1173443272 20:43096286-43096308 TCCCATCCCTGTCTGAAGTCAGG - Intronic
1174400843 20:50275062-50275084 TGCCCATCCTGTCTGCAGCCGGG + Intergenic
1174703836 20:52635966-52635988 TCCTTTCTCTTTCTGCTGCCTGG + Intergenic
1175015887 20:55790259-55790281 TGCCCTCTTTCTCTGCAGCCTGG - Intergenic
1175152945 20:56949384-56949406 CCCCCTCCCTGTATGCAGCTGGG - Intergenic
1175390701 20:58625634-58625656 TGCCCTCCCCCTCTGCAGCCCGG + Intergenic
1175514433 20:59559941-59559963 TTCCCTCCCTTCCTCCAGCTGGG + Intergenic
1175743335 20:61435961-61435983 TCCCCTCGCCTTCTCCAGTCTGG + Intronic
1175816131 20:61884122-61884144 TCCCCTCTCACTCTACAGCCAGG - Intronic
1176095627 20:63342996-63343018 TACACTCCCTGTCTGCAGACAGG - Intergenic
1176112023 20:63415302-63415324 TCCCCTCCCTCCCTCCCGCCGGG - Intronic
1176112078 20:63415424-63415446 TCCCCTCCCTCCCTCCCGCCGGG - Intronic
1176112096 20:63415465-63415487 TCCCCTCCCTCCCTCCCGCCGGG - Intronic
1176112114 20:63415506-63415528 TCCCCTCCCTCCCTCCCGCCGGG - Intronic
1176112128 20:63415547-63415569 TCCCCTCCCTCCCTCCCGCCGGG - Intronic
1176868870 21:14071690-14071712 CCCCCTCCCATTCTGCCGCAGGG - Intergenic
1178780536 21:35598870-35598892 TCTCCTCCCTCCTTGCAGCCTGG + Intronic
1179413354 21:41179037-41179059 TCACCTCCCTGGCTGCAGCCTGG - Intronic
1179427020 21:41289648-41289670 TCACCTCCTTCTGTGCAGCCTGG + Intergenic
1179492833 21:41752462-41752484 GGCCCTCCTTCTCTGCAGCCAGG + Intronic
1180107794 21:45631249-45631271 GCCCCTCCCTTTGTCCAGCTGGG + Intergenic
1180131494 21:45829822-45829844 TCCCCTGACATTCTGCTGCCAGG + Intronic
1180801159 22:18632561-18632583 GCCCCTCCACCTCTGCAGCCTGG - Intergenic
1180895820 22:19331402-19331424 GCCCTGCCCTTGCTGCAGCCAGG + Exonic
1182509771 22:30810574-30810596 TCACCTCACCCTCTGCAGCCAGG - Intronic
1183194007 22:36340789-36340811 TCCCCACCCCTTCTCCAGACTGG - Intronic
1183314630 22:37130091-37130113 TCCGCCCCCTTTCTGCAACCAGG + Intronic
1183464491 22:37972894-37972916 CCCCCTCCCTTTCTGAAGGCAGG - Exonic
1183991620 22:41600804-41600826 GCCCCTCCCTTTCTCCAGTGTGG + Exonic
1184024930 22:41848513-41848535 GCCCCACCCTTGCTGCAGCCAGG - Intronic
1184118209 22:42434212-42434234 TCCCCTCTCCTTCTTGAGCCTGG + Intergenic
1184890597 22:47376651-47376673 TGCCTTTCCTTTCTGCAGCCTGG - Intergenic
1185137338 22:49080300-49080322 GCCCCTCCCTATCTGGGGCCTGG - Intergenic
950102640 3:10367356-10367378 TCCCTTCTGTTTCTGCAGCGCGG + Intronic
950481580 3:13247544-13247566 TCTCCTTCTTTTCTTCAGCCTGG + Intergenic
952952872 3:38538753-38538775 TCCTCACCCTTCCTGCACCCTGG + Intronic
953309672 3:41864296-41864318 TCCCCGCCCTAGCAGCAGCCTGG - Intronic
953350197 3:42209745-42209767 TCCCTTCCCTTTCTCCTGCAAGG + Exonic
954297404 3:49681869-49681891 TCCGCTCCCTGTCTGCAGGGGGG + Exonic
954702363 3:52456808-52456830 TCCCCCTCCTCTCTGCAGCATGG - Intronic
954841606 3:53516425-53516447 TCCCTTCCCTTTCCTCAGCAAGG + Intronic
954914821 3:54139802-54139824 TCTCCTCCCTGCCTCCAGCCTGG - Intronic
955999880 3:64717971-64717993 TCCCGGTCCTTTCTCCAGCCTGG + Intergenic
956755313 3:72380358-72380380 TCCAGTCCCTTTCTCCATCCTGG - Intronic
956808562 3:72841904-72841926 TCACCTCCTGTTGTGCAGCCAGG + Intronic
958867742 3:99520750-99520772 TCCTCTTGCTCTCTGCAGCCAGG + Intergenic
961440088 3:126947604-126947626 TCCCACCCCGTTCTGCAGACGGG - Intronic
961488748 3:127236038-127236060 TCACCTCCTGTTGTGCAGCCCGG - Intergenic
961532495 3:127547875-127547897 CCCCCTCCCCTTCCGGAGCCCGG + Intergenic
962053220 3:131841420-131841442 TCACCTCCTGCTCTGCAGCCTGG - Intronic
962367888 3:134797743-134797765 TGGCTTCCCTTGCTGCAGCCTGG + Intronic
964837097 3:160950934-160950956 TCCCTTCCCTTTCTGAATCTTGG - Intronic
964992840 3:162835529-162835551 TCCCTTCCCTTTCCTCAGGCAGG + Intergenic
965367636 3:167820247-167820269 CTCCCTCCCTTGCTGTAGCCGGG - Intronic
966812101 3:183856027-183856049 TCACCTCCTGCTCTGCAGCCCGG + Intronic
968234921 3:197025911-197025933 GCCCCTCCCTCTCTGGAGCAGGG - Intronic
968532099 4:1097685-1097707 TTCCCTCACTTTCCCCAGCCAGG + Intronic
969315543 4:6379593-6379615 TCCGATCTCTTTCTGCAGCTTGG + Intronic
969612118 4:8233202-8233224 ACCCCACCCTCTCAGCAGCCCGG + Intronic
970561069 4:17282829-17282851 TCCCCTTCCTTGCTCCACCCTGG - Intergenic
971416876 4:26439818-26439840 TCCCTTGCCTTTCGTCAGCCTGG - Intergenic
973018116 4:45166763-45166785 TCACCTCCTGTTGTGCAGCCTGG + Intergenic
975526780 4:75359738-75359760 TCCCCTTGCTTTCTGAAGCCTGG + Intergenic
975924423 4:79432033-79432055 TCCCCTCCCTTTCTGTCCCAGGG + Intergenic
976323867 4:83749186-83749208 TTCCATGACTTTCTGCAGCCAGG + Intergenic
978488929 4:109289681-109289703 TTCCCTCCCTTTCTCTAGCATGG - Intronic
978501250 4:109412168-109412190 AGCCTTCCCTTTCTGCAGCTTGG - Intergenic
980508282 4:133752357-133752379 TCACCTCCTGCTCTGCAGCCTGG - Intergenic
980550592 4:134328906-134328928 TCCTCTTCCTTCCTCCAGCCAGG + Intergenic
980705695 4:136490265-136490287 TCCCTTCCCTGTCTACATCCTGG - Intergenic
983248140 4:165312170-165312192 TCACCTCCTGTTGTGCAGCCCGG + Intronic
983947366 4:173601139-173601161 TTTCCTCCATTTCTGAAGCCTGG - Intergenic
984944041 4:184957417-184957439 TCACCTCCTGCTCTGCAGCCTGG + Intergenic
985399800 4:189583086-189583108 TCCCCTCCATTTCCCCTGCCCGG - Intergenic
985853745 5:2409138-2409160 TCCCTTTGCTCTCTGCAGCCTGG + Intergenic
986069018 5:4264291-4264313 TGCCCTTCCTTCCTGGAGCCTGG - Intergenic
986212629 5:5688769-5688791 CCACATCACTTTCTGCAGCCAGG + Intergenic
986328891 5:6703010-6703032 TCCCCTCTCTTTTTCCAGACAGG + Intergenic
987377778 5:17252461-17252483 TTCCATCCCTTTCTGCTGCATGG - Intronic
989298589 5:39860938-39860960 TCTTCTCCCTTTCTTCAGGCTGG - Intergenic
991622482 5:68559227-68559249 TCACCTCCCGCTGTGCAGCCTGG - Intergenic
991984439 5:72269348-72269370 CCTCCTCCCTTTCTCCAGCAGGG - Intronic
992203080 5:74403045-74403067 TTGCCTCCCTTTCTGCAGCCAGG + Intergenic
992586310 5:78243779-78243801 TCCCCTCACTTACTCCAGTCTGG - Intronic
993847695 5:92966145-92966167 TCACCTCCTGCTCTGCAGCCTGG - Intergenic
997141519 5:131386316-131386338 TCACCTCCTGTTGTGCAGCCCGG + Intronic
998897650 5:146817058-146817080 TCCCCTCCCTGTATGCAGGCAGG + Intronic
999823236 5:155249363-155249385 ACCCCTCCCTTCCTGCTTCCAGG - Intergenic
1000052923 5:157577411-157577433 GCACCACCCTTTCTGCAGCTTGG - Intergenic
1001033038 5:168276613-168276635 TCCCTCCCCTTGCTGTAGCCTGG - Intergenic
1001127975 5:169037708-169037730 TCCCCTCTCACTCAGCAGCCTGG - Intronic
1001192456 5:169643617-169643639 TCACCTCCTGCTCTGCAGCCCGG + Intronic
1001349342 5:170942253-170942275 TCCCCTACCTTTTTGGTGCCAGG - Intronic
1002057343 5:176606063-176606085 TCCTCTCCCTGGGTGCAGCCCGG + Intronic
1002994888 6:2273315-2273337 TCTTCTCCCTTTTTGCAGTCTGG - Intergenic
1003199618 6:3947072-3947094 TCTCCTCCCTTTCTCCAGAATGG - Intergenic
1003253695 6:4456064-4456086 TGCCCTACCTTCTTGCAGCCTGG - Intergenic
1003411049 6:5863224-5863246 TTCACTGCCTCTCTGCAGCCAGG + Intergenic
1004063973 6:12225097-12225119 TCCCCTCACTCTTTGCAGCTAGG + Intergenic
1004632671 6:17436793-17436815 TCACCTCCTGCTCTGCAGCCTGG - Intronic
1005673650 6:28132473-28132495 TCCCCAACCTTTCTGGAACCAGG + Intergenic
1006034722 6:31202462-31202484 CTCCTTCCCTTCCTGCAGCCGGG - Exonic
1006678310 6:35779300-35779322 TCCCCATCCTTCCTGCATCCTGG + Intronic
1006699756 6:35962489-35962511 TGCCCTCCCCTTCCTCAGCCAGG + Intronic
1006886973 6:37390074-37390096 TCCCCTCCCTCTCTGAACACAGG + Intronic
1007114730 6:39335596-39335618 GCCCCTCCCTGGCTGCAGCTGGG + Exonic
1007423812 6:41734751-41734773 TCCCGTCCCTTCCTCCAGCTCGG - Intronic
1008050641 6:46897390-46897412 ACCTCTCCCTTTCTGAAGCCTGG - Intronic
1008666960 6:53726039-53726061 TCCCCTGCCTTCCCGCAGCAAGG + Intergenic
1011074240 6:83421007-83421029 CCCCCTCCCTGTCTGCATACAGG - Intronic
1011194756 6:84769250-84769272 TCCCCTTCCTTTCTCCAAGCTGG - Intergenic
1014469079 6:121792969-121792991 TCACCTCCTGTTGTGCAGCCTGG + Intergenic
1016940705 6:149481032-149481054 TCCCCTTCCTTTATGGAGTCTGG - Intronic
1017249120 6:152260941-152260963 ACCCATACCTGTCTGCAGCCTGG + Intronic
1018665150 6:166128300-166128322 GGACCTGCCTTTCTGCAGCCTGG + Intergenic
1019325666 7:436986-437008 TCCCATCTCTATCTCCAGCCTGG + Intergenic
1019834098 7:3363792-3363814 TCCCCTCCTGCTGTGCAGCCTGG + Intronic
1020105868 7:5422093-5422115 TCCCCCCCCTTTCTCCCCCCGGG + Intronic
1021448682 7:20760587-20760609 TCACCTCCTGCTCTGCAGCCCGG - Intronic
1022998016 7:35778381-35778403 TCCACTCCATTCTTGCAGCCTGG - Intergenic
1023612113 7:41981673-41981695 TCCCTTCCCTGTCAGCAGCGAGG - Intronic
1023980727 7:45068561-45068583 TCACCTTGCTCTCTGCAGCCAGG - Exonic
1025017078 7:55448643-55448665 TCCCTTCCCTTTCTGGAGCCTGG - Intronic
1026641793 7:72132863-72132885 TCACCTCCTGCTCTGCAGCCCGG - Intronic
1027228249 7:76258267-76258289 TCCCCTCCTTTCCTCCAGCCCGG - Intronic
1027443668 7:78246821-78246843 ACCCCTTCTTTTCTGGAGCCAGG + Intronic
1028159987 7:87475123-87475145 TCCCTTCCCTTTGTGCAGGGGGG - Intronic
1029125866 7:98294962-98294984 TCCACTCCCTGTGTGCAGGCAGG - Intronic
1029531058 7:101125620-101125642 TCACCTCCTGTTATGCAGCCTGG - Intergenic
1031006451 7:116478344-116478366 TACCCTCCCTTTGTGGAGCGGGG + Intronic
1032081811 7:128862892-128862914 TCCCCGCCATCCCTGCAGCCGGG - Exonic
1032531396 7:132623617-132623639 TCCTCTCCTTGTCTTCAGCCAGG - Intronic
1033235253 7:139633227-139633249 TTCCTACCCTTTCTGCAGCCTGG + Intronic
1033456905 7:141511365-141511387 TCCACTCCATCACTGCAGCCTGG - Intergenic
1034098910 7:148435392-148435414 TCCCCTCCCCTTGTGCTGGCTGG - Intergenic
1034869638 7:154672855-154672877 TCATCTCCCTTACTGCAGCATGG + Intronic
1034875390 7:154720596-154720618 ACCCCTGCCATGCTGCAGCCGGG - Intronic
1035681835 8:1494024-1494046 TGCCCTCCCATTCTGCATCGGGG + Intergenic
1035700065 8:1631639-1631661 TGCCAACTCTTTCTGCAGCCTGG + Intronic
1035986067 8:4433320-4433342 TCCCCAACCTTTCTGGTGCCAGG - Intronic
1038415693 8:27393609-27393631 TGTCCTCCCATTCCGCAGCCTGG - Intronic
1039037343 8:33374034-33374056 TCACCTCCTGCTCTGCAGCCCGG - Intronic
1039608630 8:38901853-38901875 TCTCCTCCCCTCCCGCAGCCCGG - Intronic
1039892738 8:41695872-41695894 TCCACTCCCTTGAAGCAGCCTGG - Intronic
1039904021 8:41773199-41773221 TGCCATCCCTTACTCCAGCCAGG - Intronic
1039971789 8:42326564-42326586 CCTCCTGCCTTTCTGCTGCCAGG + Intronic
1040470669 8:47733657-47733679 TCCCCTCCAGTCCAGCAGCCTGG + Intronic
1041179528 8:55233197-55233219 GTTCCTCCCTTTCTGAAGCCAGG - Intronic
1041352992 8:56967689-56967711 TCCCCTCCCTTGCTGCCACCAGG - Intronic
1042333593 8:67608055-67608077 TTCCTTCCTCTTCTGCAGCCTGG - Intronic
1044545714 8:93456900-93456922 TCACCTCCAGTTGTGCAGCCTGG + Intergenic
1044819161 8:96144476-96144498 TCCTCCGCCTCTCTGCAGCCAGG + Exonic
1044845262 8:96373930-96373952 TCCCCTCCCAATCTGCAGCCAGG - Intergenic
1046870582 8:119201114-119201136 ACCACTCCCTGTCTTCAGCCTGG - Intronic
1047015346 8:120718101-120718123 TACCTTCCCCTTCTGCACCCTGG + Intronic
1047073139 8:121370499-121370521 GCCACTCCTCTTCTGCAGCCAGG - Intergenic
1047520385 8:125591511-125591533 GCTCATCCCTTTGTGCAGCCTGG + Intergenic
1048317910 8:133375547-133375569 TGCCCTCCCCTTCTCCAGCCTGG - Intergenic
1049686029 8:143939669-143939691 TCCCCTCCCTGGCGGCGGCCTGG - Intronic
1049689598 8:143952869-143952891 TCCCCTCCCTCCCACCAGCCAGG + Intronic
1049791307 8:144473898-144473920 TCCCCTCCCGTGCTCCAGGCTGG - Exonic
1049867033 8:144946010-144946032 TGCCCTCACTATCAGCAGCCAGG - Exonic
1050088635 9:1993082-1993104 TCCCCTCCTGATGTGCAGCCTGG + Intergenic
1051665482 9:19464237-19464259 TCACCTCCGTCTGTGCAGCCCGG + Intergenic
1053000893 9:34576921-34576943 CTCCTGCCCTTTCTGCAGCCAGG - Intronic
1053406077 9:37877267-37877289 TCACCTCCTTCTGTGCAGCCTGG + Intronic
1054162122 9:61680970-61680992 CCCCCTGCCTTTCTTCATCCTGG + Intergenic
1056630333 9:88288152-88288174 CCTCCTCCCTTGCTGCAGCCTGG + Intergenic
1057207981 9:93184689-93184711 GCCCGTCCCTCTCCGCAGCCTGG + Intergenic
1057824733 9:98363745-98363767 TCCCATTCCTCTTTGCAGCCTGG + Intronic
1057950010 9:99362254-99362276 TCACCTGCCTTTATACAGCCAGG + Intergenic
1058805399 9:108586207-108586229 TGCACTCCTTTCCTGCAGCCTGG + Intergenic
1058938503 9:109791525-109791547 TTCCCTTGCTTTCTGAAGCCTGG - Intronic
1058999444 9:110333198-110333220 TCACCTCCCGTTGTGCAGCCTGG - Intronic
1059112327 9:111569165-111569187 TCCCATCTCTATCTCCAGCCTGG - Intronic
1060069009 9:120530321-120530343 TCCCCTGCCTGCCTCCAGCCTGG + Intronic
1060701128 9:125748869-125748891 CCCCCTCCCCGCCTGCAGCCAGG - Intronic
1061054686 9:128216037-128216059 CCCCCTCCCTCTGTGCCGCCTGG + Intronic
1061059890 9:128245042-128245064 ACCCCTCCCTTCCTGCCGGCCGG - Intronic
1061604203 9:131696212-131696234 TCCCCTCCCTCTCTGGATCAGGG - Intronic
1062022952 9:134327643-134327665 TGCCCACCCTCCCTGCAGCCTGG + Intronic
1186170269 X:6869399-6869421 TCCCCTCACTTTCTTGCGCCTGG + Intergenic
1186353732 X:8768175-8768197 GCCCCTCTCTTTCTGCAGGAGGG - Intergenic
1187296637 X:18008469-18008491 TTCCCTCCTTTACTGCAGCCTGG + Intergenic
1188261589 X:28030842-28030864 TCCCCACCCTGTCTGCACGCTGG - Intergenic
1188753344 X:33930275-33930297 TCCCCACCCTTTTTGGAACCAGG - Intergenic
1189338100 X:40183059-40183081 TTCCCTGCTTTTCTGCAGACTGG - Intergenic
1190258933 X:48786175-48786197 TCCCTTCTCTCCCTGCAGCCAGG + Intergenic
1191943608 X:66505149-66505171 TTCCCTCCCTTTCCACAGGCAGG - Intergenic
1192763285 X:74118720-74118742 TCCCCACCCTTACTGCCCCCAGG + Intergenic
1193869118 X:86775321-86775343 TCCCCTCCTGTTGTGTAGCCTGG - Intronic
1194590289 X:95792119-95792141 TCCCATCTCTCTCTCCAGCCTGG - Intergenic
1195330302 X:103792301-103792323 TCTCCTCCTTCTATGCAGCCTGG - Exonic
1197753287 X:129980084-129980106 ACCCCCCCCTTCCTGGAGCCAGG + Intergenic
1198004879 X:132482819-132482841 TCTGCTCGCTTTCTGAAGCCAGG - Intronic
1198188776 X:134282857-134282879 TCACCTCCTGCTCTGCAGCCTGG - Intergenic
1198871521 X:141180720-141180742 TCCATTCCCTTTCTCCAACCAGG - Intergenic
1199183793 X:144891202-144891224 TCCCCTATCTTTCTAAAGCCTGG + Intergenic
1200080703 X:153575078-153575100 CCCCTGCCCTTTCTGCTGCCTGG - Intronic
1200112927 X:153752036-153752058 TCACCTCCTGCTCTGCAGCCCGG - Intergenic
1200754988 Y:6982756-6982778 TCACCTCCTGTTGTGCAGCCTGG - Intronic
1201052429 Y:9950727-9950749 TCACCACCTGTTCTGCAGCCGGG + Intergenic
1202187187 Y:22197621-22197643 TCACCACCTGTTCTGCAGCCAGG + Intergenic
1202204173 Y:22388775-22388797 TCACCACCTGTTCTGCAGCCAGG - Intronic
1202241072 Y:22770598-22770620 TCACCACCTGTTCTGCAGCCAGG - Intergenic
1202394058 Y:24404341-24404363 TCACCACCTGTTCTGCAGCCAGG - Intergenic
1202476727 Y:25265751-25265773 TCACCACCTGTTCTGCAGCCAGG + Intergenic