ID: 932313849

View in Genome Browser
Species Human (GRCh38)
Location 2:70767187-70767209
Sequence CTCCCCTCCCTTTCTGCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 511
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 469}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932313849_932313857 15 Left 932313849 2:70767187-70767209 CCGGCTGCAGAAAGGGAGGGGAG 0: 1
1: 0
2: 2
3: 39
4: 469
Right 932313857 2:70767225-70767247 GGAAGATGGAAGAAACAGACTGG 0: 1
1: 0
2: 4
3: 57
4: 630
932313849_932313856 1 Left 932313849 2:70767187-70767209 CCGGCTGCAGAAAGGGAGGGGAG 0: 1
1: 0
2: 2
3: 39
4: 469
Right 932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG 0: 1
1: 1
2: 29
3: 403
4: 3100
932313849_932313855 -6 Left 932313849 2:70767187-70767209 CCGGCTGCAGAAAGGGAGGGGAG 0: 1
1: 0
2: 2
3: 39
4: 469
Right 932313855 2:70767204-70767226 GGGGAGGCAGGGAGAGGAGAGGG 0: 2
1: 4
2: 91
3: 801
4: 5694
932313849_932313859 30 Left 932313849 2:70767187-70767209 CCGGCTGCAGAAAGGGAGGGGAG 0: 1
1: 0
2: 2
3: 39
4: 469
Right 932313859 2:70767240-70767262 CAGACTGGCAAGACCCCCTCGGG 0: 1
1: 0
2: 1
3: 12
4: 126
932313849_932313858 29 Left 932313849 2:70767187-70767209 CCGGCTGCAGAAAGGGAGGGGAG 0: 1
1: 0
2: 2
3: 39
4: 469
Right 932313858 2:70767239-70767261 ACAGACTGGCAAGACCCCCTCGG 0: 1
1: 0
2: 1
3: 11
4: 114
932313849_932313854 -7 Left 932313849 2:70767187-70767209 CCGGCTGCAGAAAGGGAGGGGAG 0: 1
1: 0
2: 2
3: 39
4: 469
Right 932313854 2:70767203-70767225 AGGGGAGGCAGGGAGAGGAGAGG 0: 1
1: 11
2: 100
3: 964
4: 6189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932313849 Original CRISPR CTCCCCTCCCTTTCTGCAGC CGG (reversed) Intronic
900310252 1:2030007-2030029 CTCTTCTCCCTCTCTGCTGCCGG + Exonic
900347172 1:2215344-2215366 CACCCCTCCCCATCAGCAGCAGG - Intergenic
900807244 1:4775587-4775609 CTCCCCTCTCTGACTGCAGCTGG - Intronic
901408669 1:9067452-9067474 TTTCCATTCCTTTCTGCAGCTGG + Intronic
901798344 1:11692935-11692957 CTCCCCTCCCTTCCTCCACAGGG - Intronic
902454561 1:16523231-16523253 GTCCTCTCACTGTCTGCAGCGGG - Intergenic
902623609 1:17664428-17664450 CTCCCCTCTCTCCCTGCAGGAGG + Exonic
903131863 1:21284730-21284752 CTCCCCACCCTTTCTGCTCCCGG - Intronic
903855728 1:26336729-26336751 CGCCCCGCCCTTCCTGCAGGTGG - Exonic
903923389 1:26817288-26817310 CTCCGCTTCATATCTGCAGCTGG - Intergenic
904321079 1:29698200-29698222 CTCCACTCCCTCCCTGCGGCTGG - Intergenic
904540471 1:31229482-31229504 CTCCCCTCCGCTTCAGTAGCTGG + Intronic
904602471 1:31681125-31681147 CTACACCCCTTTTCTGCAGCAGG - Intronic
904780301 1:32941642-32941664 CTACTCTCCCTTCCTGAAGCAGG + Intronic
904794789 1:33051158-33051180 CTCCGCTTCATATCTGCAGCTGG - Intronic
906436893 1:45803884-45803906 CTCCGCTTCATATCTGCAGCTGG - Exonic
906486619 1:46240319-46240341 CTCCGCTTCATATCTGCAGCTGG - Intergenic
906519692 1:46459704-46459726 CTCACATCCCATTCTGCTGCTGG - Intergenic
906636896 1:47416107-47416129 CGCCCCTCCCTTTCTGCCTTTGG - Exonic
907898377 1:58714810-58714832 CATCTCTCCCTTTCTGCATCAGG + Intergenic
908500165 1:64734917-64734939 CTCCCATCCCATTTTCCAGCTGG - Intergenic
909973239 1:82016089-82016111 CTCCCCAGCCTTTTTGCAGTTGG + Intergenic
910101664 1:83583793-83583815 CACACCTCCCCTGCTGCAGCTGG + Intergenic
911040620 1:93588344-93588366 CTCCACTCCACTCCTGCAGCCGG + Intronic
912094352 1:106120676-106120698 CCCCACTCCCATTCTGCAGCTGG - Intergenic
913032720 1:114926928-114926950 TTTCAATCCCTTTCTGCAGCAGG - Intronic
913665459 1:121044125-121044147 CTCCACCCGCTTTCTGTAGCTGG + Intergenic
914016854 1:143827394-143827416 CTCCACCCGCTTTCTGTAGCTGG + Intergenic
914160932 1:145133617-145133639 CTCCACCCGCTTTCTGTAGCTGG - Intergenic
914655464 1:149735935-149735957 CTCCACCCGCTTTCTGTAGCTGG + Intergenic
914844506 1:151274476-151274498 CTCCCTTCCCTTCCTGCCTCTGG - Intergenic
915140226 1:153763345-153763367 CCCACCTCCCCTTCTGTAGCTGG - Exonic
917608489 1:176661410-176661432 CCCACCTCCCTTTCTGTAGCAGG - Intronic
919838367 1:201592086-201592108 CTCTCCTCTCTTCCTGAAGCAGG + Intergenic
920825845 1:209423777-209423799 CTCCCCTTTCTATCTTCAGCAGG + Intergenic
921414482 1:214870600-214870622 CTCCGCTTCATATCTGCAGCTGG + Intergenic
921767058 1:218984023-218984045 CACACCTCCCCTGCTGCAGCTGG + Intergenic
923339043 1:232992442-232992464 CTGCCCTCCATCTGTGCAGCTGG - Intronic
923617341 1:235548712-235548734 CTCCCCTCCCTTCCTACAGCAGG - Exonic
924179112 1:241423963-241423985 CTCCCCCACCCTCCTGCAGCAGG + Intergenic
924257533 1:242197189-242197211 CTCCCCTTCCTTACTGCCACTGG + Intronic
924880183 1:248152480-248152502 CCCCCATCCCTTACAGCAGCAGG - Intergenic
1062839804 10:661502-661524 CTCCCCTCGCTGCCTCCAGCTGG + Intronic
1063978209 10:11433714-11433736 CGCCCCTTCCTGTCTGCAGAAGG - Intergenic
1065505707 10:26428255-26428277 CACTCCTCTCTTTCTGCTGCTGG + Intergenic
1066242770 10:33554049-33554071 TTCCCCTCCCTCTCTGCCGAAGG + Intergenic
1067334884 10:45352848-45352870 TTCTCCTCCCTTTATGCTGCGGG - Intergenic
1067539882 10:47143747-47143769 CTCCCTATCCTTCCTGCAGCAGG - Intergenic
1068474299 10:57506553-57506575 TGCTCCTCCCTTGCTGCAGCTGG - Intergenic
1068581104 10:58740802-58740824 CACCCATCCCTTTCTCCATCTGG - Intronic
1069799468 10:71073111-71073133 CTCCCCTCCCTCTCTGCCTTGGG + Intergenic
1069989875 10:72308648-72308670 CTCCCTTCCCTCTGTGGAGCTGG - Intergenic
1070628136 10:78065846-78065868 CACCCCTCCCCCTCTGCAGGTGG - Intergenic
1070656950 10:78278194-78278216 CTCACCTCCCTTGCTGTGGCCGG - Intergenic
1070724231 10:78777504-78777526 TTCCCCTCCCTGTCTGAACCCGG + Intergenic
1070779078 10:79127105-79127127 GTCCCCTCCCTGTCCCCAGCAGG - Intronic
1072929645 10:99650805-99650827 CCCCTCTCCCTTTTTGGAGCAGG + Intergenic
1072950157 10:99840283-99840305 CTCCGCTTCATATCTGCAGCTGG + Intronic
1073401098 10:103258333-103258355 CTCCCCTCCCTTACTGCACAAGG + Intergenic
1074031704 10:109695478-109695500 CTGCTCTGACTTTCTGCAGCTGG - Intergenic
1075612000 10:123861949-123861971 CTCCAGGCCCTTTCTGTAGCAGG - Intronic
1076324241 10:129609032-129609054 CTCTCCTCTCTTACTGCTGCTGG + Intronic
1076808838 10:132876167-132876189 CTCCCCTCAATATCAGCAGCCGG - Intronic
1076815027 10:132910363-132910385 CACCCCTCCCCCACTGCAGCTGG + Intronic
1076853216 10:133103135-133103157 CTGCCCTCCACATCTGCAGCTGG + Intronic
1077213069 11:1382458-1382480 ACCCCGTTCCTTTCTGCAGCAGG + Intergenic
1077395834 11:2320748-2320770 CTCCCCTCCATGTCTGCCTCAGG + Intergenic
1077614810 11:3667121-3667143 CCCCTCTCACTTTCTGCAGTGGG + Intronic
1077645772 11:3922607-3922629 TTTCCCTCCCTTTGTGAAGCAGG - Intronic
1078544865 11:12240143-12240165 CTCCCCTCTCTCCCTGCACCAGG + Intronic
1080573915 11:33580954-33580976 CCTCCCTCCCTTTCTTCAGGTGG - Intronic
1080656099 11:34259613-34259635 TTTCTCTCCCTTTCAGCAGCTGG + Intronic
1080921256 11:36711566-36711588 TTCCTGTCCCTTTCTGAAGCAGG + Intergenic
1081127541 11:39340285-39340307 CTGCCCACCATTTCTGCAGGGGG + Intergenic
1081767520 11:45621785-45621807 TGCACCTCCCCTTCTGCAGCTGG + Intergenic
1082215379 11:49561442-49561464 GTCCCCCCTCTTCCTGCAGCAGG - Intergenic
1082778678 11:57269044-57269066 CTCCGCTCTCATTCTGCAGTAGG + Intergenic
1083185012 11:61012466-61012488 CTCCCCTCTCTGTCTGCAAATGG - Intronic
1083276445 11:61599696-61599718 CTCCCCTCCCCGTCTGTAGATGG - Intergenic
1084484082 11:69437984-69438006 CTCCCCTCTCTTGCTGCACTGGG + Intergenic
1085054998 11:73398286-73398308 GTCCCCGGCCTGTCTGCAGCAGG + Intergenic
1085150941 11:74252490-74252512 TTCCCCTCCCTTTCCGAAGCTGG + Intronic
1085379188 11:76097305-76097327 CTCTCCTCCCTGTCTCCACCAGG + Intronic
1085457628 11:76674189-76674211 CTCCCCTCCCTTTCTCCCTAGGG + Intergenic
1085555069 11:77412111-77412133 CTCCCCACCCAGTCTCCAGCAGG + Intronic
1086634194 11:89063036-89063058 GTCCCCCCTCTTCCTGCAGCAGG + Intronic
1088288126 11:108207874-108207896 CACACCTCCCGTGCTGCAGCCGG + Intronic
1088579247 11:111299704-111299726 ACCCCCTCCCTTTCTGGGGCAGG - Exonic
1088581548 11:111321254-111321276 CTACTCTCCCTTCCTGCTGCAGG - Intergenic
1089186068 11:116615472-116615494 GTTCACTCCCTTTCTGCAGATGG - Intergenic
1089213563 11:116822142-116822164 TTCCCCTCCTTGTCTGCAGAGGG + Intronic
1089351516 11:117824127-117824149 CACCCTCCCCTTTCTGCATCTGG + Intronic
1089564363 11:119363292-119363314 GTCCTCTCCATTTATGCAGCGGG - Intronic
1090077825 11:123590599-123590621 CTTCCCTCCCTCTCTGCCACGGG + Intronic
1091320646 11:134646902-134646924 CACCCCTCCCCTTCTGCACCTGG - Intergenic
1092887135 12:12934769-12934791 AGCCCCTCCCTCTCTGCAGACGG - Intergenic
1093055806 12:14554616-14554638 CTCCTGTCCCTTGCTCCAGCCGG + Intronic
1093366940 12:18314019-18314041 CTTCCCTACTTTTCTGCAGGTGG - Exonic
1094173713 12:27521222-27521244 CCTCCCATCCTTTCTGCAGCTGG - Intergenic
1095439312 12:42227017-42227039 CTCCGCTTCATATCTGCAGCTGG - Intronic
1096354269 12:50927140-50927162 CTCCCCACCCTCCCAGCAGCTGG + Intronic
1096503789 12:52080754-52080776 CTCCCCTCCCTGTCTCAAGAGGG - Intergenic
1096659616 12:53116075-53116097 CTCCCCTTCCATTCTGCCACAGG + Exonic
1098148987 12:67526897-67526919 CTCCTCTTCCTCACTGCAGCGGG - Intergenic
1098367496 12:69720196-69720218 CTCCCCTTTCTTCCTGCAGTGGG - Intergenic
1099569910 12:84304407-84304429 CTCCTCCCCCTTTCTCAAGCTGG + Intergenic
1100611585 12:96195054-96195076 CTCCCCGCGCTGCCTGCAGCGGG - Intronic
1101141313 12:101798429-101798451 TTCCCTTTCCTTTCTGCAGTTGG - Intronic
1102029434 12:109731466-109731488 CACGCCTCCCATTCTCCAGCAGG - Intronic
1102413417 12:112739836-112739858 TTCCCCTCCCTCTCTGCCTCTGG + Intronic
1103974946 12:124696332-124696354 CTCACCTCTCCTTCTGCACCTGG - Intergenic
1104558787 12:129825370-129825392 CTCCTCTCCCGTCCTCCAGCTGG + Intronic
1104607562 12:130201128-130201150 CTCCCCTCTCATTGTGAAGCGGG + Intergenic
1104796278 12:131521568-131521590 TTCCCCTCCCTATCTGCAGTGGG - Intergenic
1105202956 13:18194914-18194936 CTCCCCTGCCCCTCTGCAGAGGG - Intergenic
1105492402 13:20902115-20902137 TTCCCCTCCCTCCCTCCAGCCGG + Intronic
1107657262 13:42604445-42604467 CTCCACAACCTATCTGCAGCGGG - Intronic
1109603460 13:64662629-64662651 CCCACCTCCCCTGCTGCAGCTGG - Intergenic
1112117276 13:96369760-96369782 TTTCCCTCCCTTTCTTCAGAGGG - Intronic
1112638905 13:101249305-101249327 CTCTTCTCCCTTTCTCCACCAGG + Intronic
1113558655 13:111258689-111258711 CTCCTCTCCTTTTCTCAAGCAGG - Intronic
1113765111 13:112876463-112876485 CCCCCATCCTTTTCAGCAGCTGG + Intronic
1114066256 14:19061967-19061989 CTCCCCTGCCCCTCTGCAGAGGG - Intergenic
1114096012 14:19338057-19338079 CTCCCCTGCCCCTCTGCAGAGGG + Intergenic
1114364653 14:22013399-22013421 CTGCCCTCACTTTCTGCAGAAGG - Intergenic
1114495125 14:23126916-23126938 CTCCCCTCTCCTCCAGCAGCTGG + Exonic
1114704224 14:24709090-24709112 CTCCCCTAAATTTCTGCAGATGG - Intergenic
1114706656 14:24734266-24734288 CTCCCCTGCCTTTCTCCCCCCGG + Intergenic
1115534367 14:34358660-34358682 CTCCCCTTCCTTTCTGAAGATGG + Intronic
1115687217 14:35808888-35808910 CTCCCTCCACTTTCTGCCGCCGG - Exonic
1116685712 14:48035944-48035966 CTCACCTCCCTGACTCCAGCAGG + Intergenic
1117208401 14:53469752-53469774 CTTCCCTCCCTTTCTGTAAGCGG + Intergenic
1117253619 14:53956911-53956933 CTCGCCTCCCTTTCTGGGGATGG + Intronic
1118399527 14:65366889-65366911 CTCCCCTCCCTTCTTACAGAAGG - Intergenic
1119218544 14:72888015-72888037 CTCTCCTCCCTCTCTGAATCTGG - Intronic
1119668588 14:76501503-76501525 CTGCCCTCCCTCTGTGCAGATGG + Exonic
1119740019 14:77008155-77008177 CCCCCTTCCAGTTCTGCAGCTGG - Intergenic
1120652809 14:87155093-87155115 CTCCCTTCCCTTGCTCTAGCAGG + Intergenic
1121050480 14:90816425-90816447 CTCCCCGCCCCTTCCCCAGCCGG - Intronic
1121731856 14:96192933-96192955 CTCCCATTCTTTTCTGCACCTGG + Intergenic
1122324795 14:100875660-100875682 ACCCCCTCCCTTCCTGCAGGAGG + Intergenic
1122939248 14:104973879-104973901 CTCCCCTCCCCTCCGGCTGCGGG - Intronic
1122964055 14:105112853-105112875 CTCCGCTTCATATCTGCAGCTGG + Intergenic
1202902948 14_GL000194v1_random:53661-53683 CTACCCCACCATTCTGCAGCTGG - Intergenic
1124490047 15:30150040-30150062 CTCCCTCCCCTGTCTGCACCTGG + Intergenic
1124753485 15:32388287-32388309 CTCCCTCCCCTGTCTGCACCTGG - Intergenic
1124975227 15:34523990-34524012 CTCCCTCCCCTGTCTGCACCTGG - Intergenic
1127547974 15:60006814-60006836 CTTCCCTCCCTTTCTAAACCTGG - Exonic
1127566730 15:60196637-60196659 CCACCTTCCCTTTATGCAGCAGG - Intergenic
1127772209 15:62241396-62241418 CTCCCTTGCCTGTCTGCACCTGG - Intergenic
1128185095 15:65638109-65638131 CTCCTCTCCCTGTTTGCAGCCGG + Exonic
1128267405 15:66278864-66278886 CTCCCCACGCCTTCTCCAGCTGG - Intergenic
1129428242 15:75480649-75480671 CTCCGCTTCATATCTGCAGCTGG - Intronic
1129490899 15:75924565-75924587 CTCCCCTCCTCTGTTGCAGCTGG - Intronic
1129670021 15:77602471-77602493 CCCTACTCCCTTACTGCAGCAGG - Intergenic
1130204695 15:81865321-81865343 CCTCTTTCCCTTTCTGCAGCTGG - Intergenic
1130473790 15:84246629-84246651 CTCCCGTTCCTGTCTGCACCAGG + Intergenic
1130481204 15:84360693-84360715 CTCCCGTTCCTGTCTGCATCAGG + Intergenic
1131296950 15:91157639-91157661 CTCCCCTCCCTCTCTAAAACAGG - Intronic
1131396707 15:92092074-92092096 CGCCCCTCCTTTTCTGCAAGAGG + Intronic
1131532492 15:93205679-93205701 CTCCCAACCCTCTCTGCAGCTGG + Intergenic
1132309422 15:100846205-100846227 CTCTGCTCCCTTTCTGCTGGTGG + Intergenic
1132591425 16:727949-727971 CTCCCGTCCCTTTCAGCTGCTGG + Exonic
1132626354 16:893515-893537 CTCGGCTCCCTTTGTGCCGCAGG - Intronic
1132689547 16:1176454-1176476 CTGCCGTCTCTTTCTGCAGGTGG + Intronic
1132806121 16:1775965-1775987 CTCCCCCCGCCTTCTGCAGCAGG + Exonic
1133619290 16:7510983-7511005 ACACCCTCCCTTTCTGCATCTGG - Intronic
1133640177 16:7709170-7709192 CTCCCTTCCCTTTCCCCAGCTGG + Intronic
1133678632 16:8099461-8099483 TTCTCCTCCCTTTCTGCTTCTGG - Intergenic
1133758076 16:8777337-8777359 CTGCCCTCCCCTGCTGGAGCTGG + Intronic
1133781174 16:8940556-8940578 CACCTCTCCCTTTCTGATGCAGG - Intronic
1135254965 16:20933797-20933819 ATCCCTTCCCTTTCTGGATCTGG + Intronic
1136033316 16:27519231-27519253 CTCCCCTCCCCTTCCCCAGTAGG - Intronic
1136067516 16:27768832-27768854 CCTCCCTTCCTTTCTGCAGGAGG + Intronic
1136621161 16:31429264-31429286 TTCCCATCCCCTCCTGCAGCTGG - Intergenic
1137547718 16:49415932-49415954 CTCCACTCCCTCTCTCCACCTGG + Intergenic
1138345588 16:56318175-56318197 CGCCCCTCCCTCTCTGCAGCTGG - Intronic
1138998111 16:62477617-62477639 CACACCTCCCCTGCTGCAGCTGG - Intergenic
1139015365 16:62683793-62683815 CTCACCTCCCCTACTTCAGCTGG - Intergenic
1139217716 16:65145219-65145241 CTCCACACCCTTTTTGCAGAAGG + Intergenic
1139509343 16:67417579-67417601 CTCCCTTCCCTTTCTCTACCTGG + Intergenic
1139916631 16:70432393-70432415 CTCCCACCCATTTCTGCAGCAGG + Intronic
1140830109 16:78743010-78743032 GTCCCAACCCTTACTGCAGCCGG + Intronic
1141463822 16:84194303-84194325 CACCCTTCCCTTCCTCCAGCAGG - Intronic
1141605966 16:85153605-85153627 CTCCCCCTCCTTTCTGCAGAGGG + Intergenic
1141680656 16:85541850-85541872 CTGCTCTCCCCTTCTGCAGATGG - Intergenic
1141887387 16:86901897-86901919 CTCCCATCCCCCTCTGCAGGTGG + Intergenic
1141919377 16:87125858-87125880 GTGCCCTCCCTCGCTGCAGCCGG + Intronic
1142004712 16:87684238-87684260 CTCCCCTTCCTTCCAGCACCGGG + Exonic
1142358903 16:89617015-89617037 CTCCCTTCCCCTTCTGCTCCAGG - Intronic
1142509159 17:383903-383925 CTCACCTCCCTGGCTGCACCGGG - Intronic
1142509172 17:383944-383966 CTCACCTCCCTGGCTGCACCGGG - Intronic
1142639739 17:1279140-1279162 CTCCCCTTCCCTTCTGGAGTCGG + Intergenic
1142669754 17:1482709-1482731 CTCCCCTCCCCTCCTGCACTGGG + Intronic
1142940819 17:3378631-3378653 CGCACCTCCCCTGCTGCAGCTGG + Intergenic
1143712101 17:8742267-8742289 CCCCTCTCCCTTTCAGAAGCTGG + Intronic
1143866223 17:9925979-9926001 CAGCCCTCCCGTTCTGGAGCTGG + Intronic
1144242689 17:13328626-13328648 CTCCCCTACATGCCTGCAGCAGG - Intergenic
1144383441 17:14726325-14726347 ATACCCTCCCTTTCTTCAGGTGG + Intergenic
1144389854 17:14783835-14783857 CACACCTCCCTTGCTGCAGCTGG - Intergenic
1145771491 17:27496520-27496542 CTCCCCTCCCTTCCAACAGAAGG + Intronic
1146111206 17:30091288-30091310 CCTCCCTCCCTCTCTCCAGCTGG - Intronic
1147963151 17:44179860-44179882 CTCCGCTTCATATCTGCAGCTGG - Intergenic
1148196083 17:45714045-45714067 CTCCCCAACCTCTCTGCACCTGG - Intergenic
1148211628 17:45812370-45812392 CACCTCTGCCTTTGTGCAGCTGG + Intronic
1148388518 17:47253775-47253797 CTCCCCTCCCCTCCCGCTGCGGG + Intergenic
1148681829 17:49478566-49478588 CTCCCAGTCCTGTCTGCAGCTGG - Intergenic
1148773461 17:50079886-50079908 CTCCTCTCCTTTCCTGCAGAGGG - Intronic
1148936392 17:51166972-51166994 CTCCCCTTCCCCGCTGCAGCCGG + Intronic
1148953846 17:51337295-51337317 CTCTCCCACCTTTCTGGAGCAGG + Intergenic
1151153954 17:72111457-72111479 CACCCCTCCCCTTCTACAGGAGG + Intergenic
1151285640 17:73109087-73109109 CTCCCCCACCCTTCTGCATCAGG + Intergenic
1151477886 17:74354152-74354174 ATCTCCTTCCTCTCTGCAGCGGG - Exonic
1151519588 17:74618638-74618660 CTCCCCACTCTGTCTGCAGCTGG + Intronic
1151522805 17:74642497-74642519 CTCACCTTCCTTTCTCCTGCTGG + Intergenic
1151668380 17:75558365-75558387 ACCCCCTCCCTTTCCACAGCTGG + Intronic
1151671830 17:75575115-75575137 CTCCCATCCCTTTTTGTAGTGGG + Exonic
1151954831 17:77374980-77375002 CTCCCCTCCCTCTGGGAAGCAGG - Intronic
1151987839 17:77555639-77555661 CACCCCTCCCTCTCGGCTGCAGG - Intergenic
1152178223 17:78801688-78801710 CTCCTCTCCCTCTATGTAGCTGG - Intronic
1152600083 17:81257856-81257878 CGCCCCTCCCTTGCTGCATGGGG - Intronic
1152783300 17:82235916-82235938 CTCCCCTGCCAGGCTGCAGCTGG + Exonic
1153406698 18:4748836-4748858 CTCCTCTGCCTTTCTGCATGGGG - Intergenic
1153981539 18:10314813-10314835 CTCCCCTCCCCTACTGCCCCAGG + Intergenic
1154492694 18:14933621-14933643 TGCCCCTCCCTGTCTGCACCTGG - Intergenic
1155209944 18:23591999-23592021 CACACCTCCCTTCCTCCAGCAGG + Intergenic
1155352736 18:24922768-24922790 CTTCCCTCTCTTTCTGCTTCAGG - Intergenic
1155782507 18:29854631-29854653 CTCTTCTCCCTGTCTTCAGCTGG + Intergenic
1160188889 18:76698355-76698377 CTCCACTCCCTCTCAGGAGCAGG + Intergenic
1160313842 18:77822008-77822030 ATGCACTCCCTCTCTGCAGCTGG + Intergenic
1160895317 19:1399644-1399666 GGCCGCTCCCTTTCTGCAGGTGG - Intronic
1161210195 19:3061981-3062003 CCCCCCTCCCCTCCTGCCGCCGG - Intronic
1161284876 19:3463856-3463878 CGCCCCCCCCTTTGTCCAGCTGG + Intronic
1161455785 19:4369183-4369205 CTGCCCTCCATTTCTGCTGAAGG + Intronic
1161585489 19:5103205-5103227 CTTCCCCCGCTCTCTGCAGCAGG + Intronic
1161767844 19:6216789-6216811 GGCCCCTCCATTGCTGCAGCCGG + Intronic
1162199527 19:9010430-9010452 CTCACCACCCTCCCTGCAGCCGG - Intergenic
1162564095 19:11435626-11435648 TTCCGCTTTCTTTCTGCAGCAGG + Intronic
1162787389 19:13044236-13044258 CTCCCCTTTCTTCCTTCAGCTGG + Intronic
1162886658 19:13702618-13702640 CTCCGCTTCATATCTGCAGCTGG - Intergenic
1163129974 19:15266208-15266230 AACCCCTCACTTTTTGCAGCTGG - Intronic
1163275640 19:16282535-16282557 CCCACCTCCCTTCCTGGAGCAGG - Intergenic
1163501822 19:17680604-17680626 CGCGCCTCCGTTTCTGCATCTGG + Intronic
1164191877 19:22925365-22925387 CTCCGCTTCATATCTGCAGCTGG - Intergenic
1164653373 19:29901859-29901881 CTCCGCTTCATATCTGCAGCTGG + Intergenic
1165780087 19:38427449-38427471 ATCCCCTGCCTTTCTTAAGCAGG + Intergenic
1166261395 19:41644044-41644066 CTCCGCTTCATATCTGCAGCTGG - Intronic
1167283659 19:48586450-48586472 CTCCACTCCCTCTCTGCTTCTGG - Intronic
1167294214 19:48639909-48639931 CTCTCCTCCCCTTCTGCTGGGGG - Intronic
1167504770 19:49865423-49865445 CCTCCCTCTCTTTCTGCAGCTGG - Exonic
1167749400 19:51370799-51370821 CTCCCCTCCATGTCTACAGGGGG + Intergenic
1168356555 19:55703866-55703888 CTCCCCTGCGTTTCGGCTGCTGG + Intronic
1168369105 19:55816623-55816645 GTCCCCTACATTTCTGTAGCTGG + Intronic
925241084 2:2329057-2329079 CTGCCTTCCCTTTCAGCACCAGG - Intronic
926377895 2:12252329-12252351 CTCCCCTCTTTGTCTGCAGATGG + Intergenic
926561706 2:14425201-14425223 CTCACCTCCATTTCTGCCCCTGG + Intergenic
927570334 2:24153595-24153617 CTCTCCTCCCTTTAAGCAGAAGG + Intronic
927765492 2:25803553-25803575 GTCCCCAACCTTTCTGCATCAGG + Intronic
929822704 2:45286179-45286201 CTCCCCTCCCAGCCTGCTGCAGG - Intergenic
929974332 2:46617090-46617112 CGCCCCTCCCTTTCTGCGACTGG - Exonic
929977976 2:46653523-46653545 CTGCCCAGTCTTTCTGCAGCAGG - Intergenic
931280847 2:60790405-60790427 CTCCCATCCCTGTCTTCAGTGGG + Intronic
932313849 2:70767187-70767209 CTCCCCTCCCTTTCTGCAGCCGG - Intronic
933578868 2:84102425-84102447 CTTCTCGACCTTTCTGCAGCTGG + Intergenic
934518885 2:95007013-95007035 CGCCCCGCCCTGGCTGCAGCAGG - Intergenic
935695755 2:105769279-105769301 CTCCCCTCCCCATCCCCAGCTGG + Intronic
936071735 2:109375739-109375761 CCCCCCTCTCTTTCTGCACAGGG + Intronic
936165350 2:110115640-110115662 TCCCCCTCCCTCTCTGCAGGTGG + Intronic
937022272 2:118668559-118668581 CTCCCTTCCCTCTCTGCCACAGG + Intergenic
937236875 2:120436543-120436565 CGCCCCTCCCCTGCAGCAGCTGG + Intergenic
937337123 2:121068970-121068992 CTCATCTCCCTCTCTGCGGCGGG + Intergenic
938483652 2:131682103-131682125 CTCCCCTGCCCCTCTGCAGAGGG - Intergenic
938609288 2:132930523-132930545 CTCCTATGCCTTTCTGCAGAAGG - Intronic
938644836 2:133320025-133320047 CTCCCATCCCTTGTTGCAGTTGG - Intronic
939359196 2:141147077-141147099 CTCCCCTCCTTTTCTGCTCTGGG + Intronic
939466274 2:142561611-142561633 TGCCCCTCCCTTGCTGCAGCTGG - Intergenic
939489708 2:142862350-142862372 CTGACCTCCCTTTCTGCATCAGG + Intergenic
939991060 2:148876632-148876654 CTTAGCTCCCTCTCTGCAGCTGG + Intronic
940918414 2:159283224-159283246 GTCCCCACCTTTTCGGCAGCAGG + Intronic
940957072 2:159739267-159739289 CACGCCTCCCCTGCTGCAGCCGG + Intronic
941990035 2:171546787-171546809 CTCTCCGCCCTTTCTACACCAGG - Intronic
942151169 2:173076673-173076695 CTCCCCGCCCTTCCTGCCCCGGG + Intronic
942458017 2:176151118-176151140 CTGCCCGCCCTGCCTGCAGCCGG - Exonic
942462164 2:176175789-176175811 CCCACCTCCCGTTTTGCAGCTGG - Intergenic
943249139 2:185494898-185494920 CTCCACTCACTTTCATCAGCTGG + Intergenic
944022498 2:195123856-195123878 CTCCCTTCCTTTTCTGCCACAGG - Intergenic
944491287 2:200260276-200260298 CTCCTCTCCCTTTCTGCCCCTGG - Intergenic
944653950 2:201859089-201859111 CTCCCCTCCCCCACTGCAGGAGG - Intronic
945750384 2:213774937-213774959 CTCAGCTCCCATTCTTCAGCAGG + Intronic
946248156 2:218398700-218398722 CTCCCCTCCCCCTCTCCCGCGGG - Intronic
947024132 2:225717223-225717245 CTTCCCTCACTCTCTGCAGCTGG + Intergenic
947525674 2:230875366-230875388 CTCCCTTCCGTTTGTGAAGCTGG + Intronic
947971493 2:234328850-234328872 CTCACCTGCGTCTCTGCAGCGGG + Intergenic
948434561 2:237944279-237944301 CGTCCCTTCCTTCCTGCAGCTGG - Intergenic
1169329351 20:4704444-4704466 CTCCCTTCTCTGCCTGCAGCAGG + Intergenic
1169856174 20:10105832-10105854 ACCTCCTCACTTTCTGCAGCAGG + Intergenic
1170169986 20:13399697-13399719 CCGGCCTCCCTTTCAGCAGCTGG + Intronic
1170763738 20:19273418-19273440 CCCCTCTCCCTTTCTCCATCAGG + Intronic
1170847663 20:19975510-19975532 CCCCGCTCACCTTCTGCAGCTGG - Exonic
1171217109 20:23360536-23360558 CTCCACTACCTTTCTGAAGAGGG - Intergenic
1171311354 20:24147482-24147504 CTCCCCTACCCTTCTTCGGCAGG - Intergenic
1174037344 20:47676443-47676465 CTCCCCCTCCTGACTGCAGCCGG - Intronic
1174056465 20:47801852-47801874 CTCCCCTACCCCTCTGCAGATGG - Intergenic
1174872377 20:54195177-54195199 CTCTCCTCCCCATGTGCAGCTGG + Intergenic
1175138416 20:56842211-56842233 TGCACCTCCCTTGCTGCAGCTGG - Intergenic
1175152947 20:56949385-56949407 ACCCCCTCCCTGTATGCAGCTGG - Intergenic
1175514432 20:59559940-59559962 GTTCCCTCCCTTCCTCCAGCTGG + Intergenic
1176112024 20:63415303-63415325 CTCCCCTCCCTCCCTCCCGCCGG - Intronic
1176112079 20:63415425-63415447 CTCCCCTCCCTCCCTCCCGCCGG - Intronic
1176112097 20:63415466-63415488 CTCCCCTCCCTCCCTCCCGCCGG - Intronic
1176112115 20:63415507-63415529 CTCCCCTCCCTCCCTCCCGCCGG - Intronic
1176112129 20:63415548-63415570 CTCCCCTCCCTCCCTCCCGCCGG - Intronic
1176126669 20:63478607-63478629 CTCCCCACCTTCTCTGGAGCTGG + Intergenic
1176622312 21:9068428-9068450 CTACCCCACCATTCTGCAGCTGG - Intergenic
1176715003 21:10343091-10343113 CTCCCCTGCCCCTCTGCAGAGGG + Intergenic
1176868872 21:14071691-14071713 TCCCCCTCCCATTCTGCCGCAGG - Intergenic
1177335538 21:19720912-19720934 CTCCTCTCCCTTTTTTCAGAAGG + Intergenic
1178274188 21:31221430-31221452 CTCCCATCCCCATCTTCAGCTGG + Intronic
1180107793 21:45631248-45631270 AGCCCCTCCCTTTGTCCAGCTGG + Intergenic
1180193911 21:46182419-46182441 CTCCCCTCCCCTTCGGTCGCTGG - Intronic
1180208636 21:46279725-46279747 CTCTCCACCATCTCTGCAGCTGG + Intronic
1180484734 22:15784558-15784580 CTCCCCTGCCCCTCTGCAGAGGG - Intergenic
1180603347 22:17036847-17036869 CTCCCCTGCCCCTCTGCAGAGGG - Intergenic
1181122820 22:20683556-20683578 CTCCCCTGACTGTCTGCAGGTGG - Intergenic
1181179605 22:21057533-21057555 CTCCCCTGACTGTCTGCAGGTGG + Intronic
1181535556 22:23541096-23541118 CTACCCTCCCTTCTGGCAGCGGG - Intergenic
1182358506 22:29733591-29733613 CTCCCCGCCTTCTCTGCGGCTGG - Intronic
1183072111 22:35403395-35403417 TGCCCTTCCCTTTCTCCAGCTGG + Exonic
1183172576 22:36198921-36198943 CTCACCTCCCTCTCTGCTCCTGG - Intronic
1183428992 22:37754598-37754620 CACCCCTCCCTGTCTGCACTGGG + Intronic
1183988902 22:41584951-41584973 CTCCCCTGCCCCTCTGCAGAGGG + Intronic
1184140267 22:42574294-42574316 CTGCCCTTCCTTCCTCCAGCTGG - Exonic
1184471631 22:44699274-44699296 CCTCCCTCCCTCTCTGGAGCTGG + Intronic
1184875035 22:47268941-47268963 CTCCCCTCCCACTCTCCAACAGG - Intergenic
1184991256 22:48171504-48171526 CTCCCCTCCCTGTCTGCCCTGGG + Intergenic
1185236827 22:49718751-49718773 CTCCTCTCTCATTCTCCAGCAGG + Intergenic
949313988 3:2731297-2731319 CTCCCTTCCCTTTATGAAGATGG + Intronic
949919105 3:8987524-8987546 CTCCCTCCCCTGTCTGCAGGTGG + Intronic
950253902 3:11488463-11488485 CTCCGCTTCATATCTGCAGCTGG + Intronic
950411416 3:12840388-12840410 TTTCCCTCCCTTTCCGAAGCTGG + Intronic
950465937 3:13153665-13153687 GTCCCCACCCCTCCTGCAGCAGG + Intergenic
951567001 3:24020504-24020526 CGCGCCTCCCCTGCTGCAGCTGG + Intergenic
952669301 3:35947091-35947113 CTCACCTCTCTTTCTCGAGCAGG - Intergenic
954080487 3:48210706-48210728 CTCCGCTTCATATCTGCAGCTGG - Intergenic
954297403 3:49681868-49681890 CTCCGCTCCCTGTCTGCAGGGGG + Exonic
954440168 3:50517415-50517437 CTCCCTTCCCTCTCTGAGGCAGG + Intergenic
955904604 3:63793547-63793569 CTCTCCTCACTCTCTGCTGCTGG + Intergenic
956077639 3:65522873-65522895 CTTCCCACCCCTACTGCAGCAGG - Intronic
956592105 3:70925812-70925834 CTACCATCCCTCTCTGCATCTGG - Intergenic
957217976 3:77346564-77346586 CTCAGCTACCTTTCTGCAGTAGG + Intronic
959070237 3:101695082-101695104 CTACCCTCCCTTCTGGCAGCGGG - Intergenic
960927128 3:122805486-122805508 CTCTCCTCTCTTTTTGCAGAGGG - Intronic
961105799 3:124240302-124240324 CAGCTCTACCTTTCTGCAGCTGG + Intronic
961184322 3:124901518-124901540 CTTCCGCCCCTTTCTGCGGCTGG - Intergenic
961530936 3:127539988-127540010 CTCCCCTCCCTATGAGCAACCGG - Intergenic
961794117 3:129397286-129397308 TTTCCCTCCCTTTCCGAAGCTGG + Intergenic
962120375 3:132554612-132554634 GTTCCCTGCCCTTCTGCAGCTGG + Intergenic
962739063 3:138349431-138349453 CTCACCTCCCACTCTGCAGTAGG - Intronic
963020589 3:140869412-140869434 CTCCCATTGCTTTCTGCAACAGG + Intergenic
964297041 3:155245360-155245382 CGCCCCTCCCTTCCTTGAGCTGG + Intergenic
964681168 3:159341152-159341174 CTCCCCTTGCTTTCTGCACTTGG + Intronic
964808983 3:160642076-160642098 CTCTCCTCCCATCCAGCAGCAGG + Intergenic
965367637 3:167820248-167820270 CCTCCCTCCCTTGCTGTAGCCGG - Intronic
966834345 3:184037883-184037905 CTCCCGTCCCTTTCAGCATCCGG - Intronic
966924090 3:184633372-184633394 CTCCCCTCCCTCTCCACAGATGG - Intronic
968097842 3:195944660-195944682 CTCCTCTCCGGGTCTGCAGCTGG + Intergenic
968097900 3:195945083-195945105 CTCCTCTCCAGGTCTGCAGCTGG + Intergenic
968234922 3:197025912-197025934 AGCCCCTCCCTCTCTGGAGCAGG - Intronic
968304648 3:197641862-197641884 CTCCTCTCCAGGTCTGCAGCTGG + Intergenic
968304910 3:197643884-197643906 CTCCTCTCCAGGTCTGCAGCTGG + Intergenic
968750308 4:2385529-2385551 CGCCCCTTTGTTTCTGCAGCGGG + Intronic
968964884 4:3764848-3764870 CTTCCCTCCCTCTCTCCTGCGGG + Intergenic
969304127 4:6315776-6315798 CTCCCTTCCCTTATTGCTGCTGG + Intergenic
969418818 4:7077919-7077941 CACCCATCCCTGTCTGCAGAGGG - Intergenic
969848262 4:9936641-9936663 CTTCCCGCCCCTTCTGTAGCTGG - Intronic
970913321 4:21304500-21304522 CTCTGCTCCCTGTCTGCAGCAGG - Intronic
971867215 4:32189178-32189200 CACACCTCCCCTGCTGCAGCTGG - Intergenic
975924422 4:79432032-79432054 GTCCCCTCCCTTTCTGTCCCAGG + Intergenic
977725859 4:100296341-100296363 CTTCCTTCCCTTGCAGCAGCTGG + Intergenic
977985053 4:103373237-103373259 CTCCCCTCCTCCCCTGCAGCTGG - Intergenic
980671020 4:136008126-136008148 CGCACCTCCCTTGCTGCAGCAGG - Intergenic
980739696 4:136933133-136933155 CTCCCCTCCCTTCCTGCTCCTGG - Intergenic
981048685 4:140290324-140290346 CTCCTCTTTCTTTCTTCAGCTGG + Intronic
982616139 4:157637911-157637933 CTCCGCTTCATATCTGCAGCTGG + Intergenic
982918997 4:161250304-161250326 TGCACCTCCCTTACTGCAGCTGG + Intergenic
983248411 4:165316189-165316211 CCAACCTCCCTTTCTGCAGTGGG + Intronic
984758055 4:183342491-183342513 CTCCGCTCCCTTCCTCCTGCTGG + Intergenic
985149716 4:186934223-186934245 CTACTGGCCCTTTCTGCAGCTGG + Intergenic
985393362 4:189514917-189514939 CCCCCCCCCCCTCCTGCAGCAGG + Intergenic
985498190 5:222881-222903 CTCCCCTGCCTGGCTGCTGCTGG - Intronic
986444691 5:7811117-7811139 CTCCCCTCCCTGTCTGTTCCGGG - Intronic
990952393 5:61311196-61311218 CTGCCCTACCTTTCCGCAGGTGG + Intergenic
991984441 5:72269349-72269371 TCCTCCTCCCTTTCTCCAGCAGG - Intronic
992556141 5:77905613-77905635 CTTCCCTCCCTTATTGCAGCAGG + Intergenic
994451451 5:99950065-99950087 GTTGCCTCCCCTTCTGCAGCCGG - Intergenic
994727953 5:103458689-103458711 CACCTCTCCCTCTCTGCAGTAGG + Intergenic
994886416 5:105567545-105567567 ATCTCCTCCCTTCCTGGAGCTGG - Intergenic
995064078 5:107840823-107840845 CTTCACTCACTCTCTGCAGCTGG + Intergenic
995383037 5:111556401-111556423 CTCCCCTCGCTTTCAGCCTCTGG + Intergenic
995815113 5:116158500-116158522 CTCCCCCCCCTTTCTCCCTCAGG + Intronic
995900134 5:117056138-117056160 CTCCCCTCCAGTTCTGCCGTTGG + Intergenic
996559391 5:124812538-124812560 CTTCCCTCTGTTTCTGCAGCTGG - Intergenic
997240230 5:132301399-132301421 CTCCTGTCCTCTTCTGCAGCTGG + Intronic
997304716 5:132829053-132829075 CTGAACTCCCTTTCAGCAGCCGG - Intronic
998727012 5:145028947-145028969 CCCACCTCCCTTTCTGTTGCAGG - Intergenic
1000101901 5:158024343-158024365 CACCCCTTCCTTTCTGCTCCAGG - Intergenic
1001836692 5:174838392-174838414 CTCCCTTCCTATTTTGCAGCTGG - Intergenic
1002341452 5:178518960-178518982 CTCCGCTTCATATCTGCAGCTGG + Intronic
1002670351 5:180861365-180861387 CTCCCCTCCCTCCCTCCCGCCGG - Intergenic
1004094788 6:12542332-12542354 CTCACCTCCCATCCTGCAACAGG + Intergenic
1004706848 6:18132516-18132538 CACCCCTCCCGCTCTGCTGCAGG + Intronic
1007114729 6:39335595-39335617 TGCCCCTCCCTGGCTGCAGCTGG + Exonic
1007273848 6:40659106-40659128 CTCCCCTGCCTTTCTCAGGCTGG - Intergenic
1007416369 6:41693783-41693805 CTCCCTTCCCATCCTGCAGCAGG + Intronic
1007674467 6:43581710-43581732 CTCCGCTTCATATCTGCAGCTGG + Intronic
1007808872 6:44472501-44472523 CTCCCCTCCCATCCTGCTTCAGG + Intergenic
1008060716 6:46993852-46993874 CTCCTCTCCCTTTCTGTAAATGG + Intergenic
1008615312 6:53220538-53220560 GTGCCCAGCCTTTCTGCAGCTGG + Intergenic
1008824970 6:55683034-55683056 CTCACCTCCTGCTCTGCAGCCGG - Intergenic
1009267873 6:61579030-61579052 CCTCCCTCTCTTTCTGCTGCAGG - Intergenic
1010063731 6:71655754-71655776 CTTCCCTCCATAGCTGCAGCTGG - Intergenic
1012399433 6:98832269-98832291 CTCCCCCACCTTTCTGGGGCAGG - Intergenic
1013174076 6:107662518-107662540 CTCCCCTCCCCTGCTGGGGCAGG + Intergenic
1015047687 6:128796339-128796361 CTTCCCTCCATTTATGCACCAGG - Intergenic
1015476499 6:133664148-133664170 CTCCGCTTCATATCTGCAGCTGG - Intergenic
1017760199 6:157562553-157562575 GTCCCCTCCCTCTCTGTACCTGG - Intronic
1017764013 6:157592669-157592691 CTCCCCTCCCTGTAGGCGGCAGG - Intronic
1018391487 6:163344928-163344950 CTGCCCTCCCTCTCTGCACAGGG - Intergenic
1019015974 6:168879359-168879381 CTCCCTGCCCATCCTGCAGCAGG + Intergenic
1019318801 7:405587-405609 CTCCCCTCACTTCCCTCAGCAGG - Intergenic
1019377306 7:699678-699700 CTCCCCACCCCTCCTGCAGCTGG - Intronic
1019770380 7:2880631-2880653 CGCCCCTCAGTTTCTCCAGCTGG + Intergenic
1019849952 7:3544991-3545013 CTGCCTTTCTTTTCTGCAGCAGG + Intronic
1019904417 7:4049867-4049889 CTCTCCTCCCTTTCTACTTCAGG + Intronic
1020079903 7:5281813-5281835 CTCTCCGCCCCTTCTCCAGCAGG + Intronic
1020231296 7:6320903-6320925 CTCACCTCCATGTCTTCAGCAGG + Intergenic
1021380786 7:19963368-19963390 CTTACCTCCTTTGCTGCAGCTGG - Intergenic
1021716741 7:23468903-23468925 CTCCCCTGGCTTTCTTCAGGAGG + Intronic
1022320552 7:29284026-29284048 CCTCCCTCCCTGTCTGTAGCTGG + Intronic
1022363476 7:29685448-29685470 CACCCCTCGCTGTCTCCAGCAGG + Intergenic
1023677551 7:42646320-42646342 CCCCACTTCCTTCCTGCAGCAGG + Intergenic
1023763651 7:43490330-43490352 CTCTCCTCCCTTTCTGGTTCTGG + Intronic
1025085591 7:56020689-56020711 CTGCCCTCCCGCCCTGCAGCTGG - Intronic
1025137983 7:56436608-56436630 TTCCTCTGCCTTTCTGAAGCAGG - Intergenic
1025173102 7:56779462-56779484 CTCCCGTCTCTATATGCAGCAGG + Intergenic
1025236530 7:57238309-57238331 CTCCCCTACCCCTCTGCAGATGG + Intergenic
1025699004 7:63798714-63798736 CTCCCGTCTCTATATGCAGCAGG - Intergenic
1025937711 7:66050548-66050570 GTCCCCACCTTTTCTGCAGGAGG + Intergenic
1026822648 7:73559778-73559800 CTCCCCTCCCCTACTTAAGCTGG - Intergenic
1027729050 7:81846261-81846283 CTCGCCTCACTTTCTGCTGATGG - Intergenic
1028159988 7:87475124-87475146 CTCCCTTCCCTTTGTGCAGGGGG - Intronic
1029886392 7:103877164-103877186 CTCTTCTCCCTTTCTCCTGCAGG + Intronic
1031006450 7:116478343-116478365 ATACCCTCCCTTTGTGGAGCGGG + Intronic
1031955414 7:127937503-127937525 TCTCCCTCCCTTTCTGGAGCTGG + Intronic
1032081812 7:128862893-128862915 CTCCCCGCCATCCCTGCAGCCGG - Exonic
1034470654 7:151252658-151252680 CCCTCCTCCCTCTCTGGAGCTGG - Intronic
1035473030 7:159122524-159122546 CTCACCTCACTTTCTGCCACTGG + Intronic
1035681834 8:1494023-1494045 CTGCCCTCCCATTCTGCATCGGG + Intergenic
1037109514 8:15149037-15149059 CTCCTTTTGCTTTCTGCAGCAGG - Intronic
1037626218 8:20609341-20609363 CTCCTCTCCCTCTCTGGAGGGGG + Intergenic
1037689734 8:21171906-21171928 CCCACCTCCCTCTGTGCAGCGGG + Intergenic
1037906383 8:22718270-22718292 CTCCTCCTCCCTTCTGCAGCTGG + Intronic
1037967614 8:23146303-23146325 CGCCCCACCCTGTCTGCCGCTGG + Intronic
1038423854 8:27451954-27451976 CTTCCCTCCCTGCCTGCAACAGG - Intronic
1041110442 8:54477970-54477992 CTCCCCTCCCTCTCTAAGGCAGG + Intergenic
1041554889 8:59142224-59142246 CTCACCTCCTGTTGTGCAGCAGG - Intergenic
1043533169 8:81172195-81172217 CGCACCTCCCCTGCTGCAGCTGG + Intergenic
1045493147 8:102685736-102685758 CTCACCTCGTGTTCTGCAGCAGG + Intergenic
1045649454 8:104328589-104328611 GTCCCCTCCCATTCTTCCGCAGG - Intergenic
1046705016 8:117440041-117440063 CTCCCCTCTGTTTCTTCAACAGG + Intergenic
1047544075 8:125798078-125798100 CACACCTCCCTTGCTGCAGCTGG + Intergenic
1047687083 8:127315738-127315760 CTCCGCTTCATATCTGCAGCTGG - Intergenic
1048495048 8:134928195-134928217 GTCTCCTGCCTTTATGCAGCTGG - Intergenic
1049248869 8:141577617-141577639 CTCCCCTCTCTCTTTGCAGGTGG + Intergenic
1049438360 8:142598027-142598049 CTCCTCTGCCTTTCTGCCACAGG + Intergenic
1049797982 8:144505227-144505249 TTCCCCTTCCTTTCCGCAGACGG + Exonic
1050458204 9:5854110-5854132 CTCCCCACTCTTTCTCCAGTGGG + Intergenic
1051353333 9:16218499-16218521 CCCCACTCCCTGTTTGCAGCGGG - Intronic
1052781017 9:32782672-32782694 CTCTCCTCCCTTGCTGAAGCAGG - Intergenic
1053457033 9:38241409-38241431 CTCCGCTTCATATCTGCAGCTGG - Intergenic
1053484102 9:38439245-38439267 CTTTCCTCCCTGTCTCCAGCTGG + Intergenic
1055914994 9:81391789-81391811 CTCTCCTTCCTTGCTGCAGTTGG - Intergenic
1056758304 9:89396594-89396616 CTGCCCCCGTTTTCTGCAGCTGG + Intronic
1056805277 9:89723727-89723749 CTCCTCTCACTTTCCCCAGCTGG - Intergenic
1057067429 9:92068586-92068608 CTCCCATCACTTTCTGGGGCTGG + Intronic
1057438676 9:95065477-95065499 CTCTCCTCCCCTTCTCCTGCTGG + Intronic
1057440077 9:95076897-95076919 CTCCCATCCCTATCCCCAGCTGG + Intronic
1057488063 9:95501652-95501674 CTGGCCTCCTTTTCTGCAGAGGG - Intronic
1057750771 9:97791011-97791033 GTCCACTCCCTTGCTGGAGCAGG - Intergenic
1057864353 9:98667381-98667403 CTCCCTTCCCCTTCAGGAGCTGG + Intronic
1058256889 9:102777782-102777804 CTCCTCTCCTTTTCTGCTTCTGG - Intergenic
1058492812 9:105520058-105520080 CTCCCTCCACTTTCTGCCGCTGG + Intronic
1059210825 9:112513569-112513591 CTCCGCTTCGTATCTGCAGCTGG - Intronic
1060064744 9:120494922-120494944 CTCCGCTTCATATCTGCAGCTGG - Intronic
1060933028 9:127500799-127500821 CTTCACTCCCATTCTGCAGATGG + Intronic
1060978390 9:127778783-127778805 CTCCCCACCCTCTCCGCAGGGGG + Intergenic
1061604204 9:131696213-131696235 ATCCCCTCCCTCTCTGGATCAGG - Intronic
1062027794 9:134348502-134348524 CTGGCCTCCCCATCTGCAGCAGG - Intronic
1062295779 9:135825744-135825766 CTCCCCAGCCTGTCTGCACCTGG - Intronic
1186353733 X:8768176-8768198 TGCCCCTCTCTTTCTGCAGGAGG - Intergenic
1186387655 X:9126144-9126166 CCCCCCTCCCTTTCTTCTTCAGG - Intronic
1186574105 X:10747075-10747097 CTCCCCTCCCTCTGCGTAGCTGG - Intronic
1188647738 X:32591635-32591657 CACGCCTCCCTTGCTGCAGCTGG - Intronic
1189160394 X:38804119-38804141 CGCCCGGCCCTTTCTACAGCGGG - Exonic
1192621045 X:72680703-72680725 CTCCGCTTCATATCTGCAGCTGG - Intronic
1194387667 X:93277507-93277529 CTCCTCTCCCTTCCTCTAGCAGG + Intergenic
1194756036 X:97741197-97741219 CTTCCCTCCCTCTCTGGAGAAGG + Intergenic
1199032190 X:143013617-143013639 TTCTCCTCCCTTTATGCAGAAGG - Intergenic
1201554522 Y:15254694-15254716 GTCTCCTCCCTTACTGGAGCTGG - Intergenic
1202377110 Y:24247425-24247447 CTCCCGTTCCTGTCTGCACCAGG - Intergenic
1202493670 Y:25422696-25422718 CTCCCGTTCCTGTCTGCACCAGG + Intergenic