ID: 932313856

View in Genome Browser
Species Human (GRCh38)
Location 2:70767211-70767233
Sequence CAGGGAGAGGAGAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3534
Summary {0: 1, 1: 1, 2: 29, 3: 403, 4: 3100}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932313846_932313856 3 Left 932313846 2:70767185-70767207 CCCCGGCTGCAGAAAGGGAGGGG 0: 1
1: 0
2: 2
3: 37
4: 272
Right 932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG 0: 1
1: 1
2: 29
3: 403
4: 3100
932313848_932313856 2 Left 932313848 2:70767186-70767208 CCCGGCTGCAGAAAGGGAGGGGA 0: 1
1: 1
2: 6
3: 65
4: 480
Right 932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG 0: 1
1: 1
2: 29
3: 403
4: 3100
932313849_932313856 1 Left 932313849 2:70767187-70767209 CCGGCTGCAGAAAGGGAGGGGAG 0: 1
1: 0
2: 2
3: 39
4: 469
Right 932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG 0: 1
1: 1
2: 29
3: 403
4: 3100
932313839_932313856 19 Left 932313839 2:70767169-70767191 CCGGGGATGGCCTCCGCCCCGGC 0: 1
1: 0
2: 2
3: 11
4: 211
Right 932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG 0: 1
1: 1
2: 29
3: 403
4: 3100
932313836_932313856 28 Left 932313836 2:70767160-70767182 CCTCCGGGACCGGGGATGGCCTC 0: 1
1: 0
2: 0
3: 5
4: 102
Right 932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG 0: 1
1: 1
2: 29
3: 403
4: 3100
932313843_932313856 6 Left 932313843 2:70767182-70767204 CCGCCCCGGCTGCAGAAAGGGAG 0: 1
1: 0
2: 0
3: 19
4: 183
Right 932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG 0: 1
1: 1
2: 29
3: 403
4: 3100
932313837_932313856 25 Left 932313837 2:70767163-70767185 CCGGGACCGGGGATGGCCTCCGC 0: 1
1: 0
2: 1
3: 7
4: 95
Right 932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG 0: 1
1: 1
2: 29
3: 403
4: 3100
932313840_932313856 9 Left 932313840 2:70767179-70767201 CCTCCGCCCCGGCTGCAGAAAGG 0: 1
1: 0
2: 1
3: 26
4: 179
Right 932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG 0: 1
1: 1
2: 29
3: 403
4: 3100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932313856 Original CRISPR CAGGGAGAGGAGAGGGAAGA TGG Intronic
Too many off-targets to display for this crispr