ID: 932313968

View in Genome Browser
Species Human (GRCh38)
Location 2:70767630-70767652
Sequence GGTCCCACCATCCCCAAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 170}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932313960_932313968 7 Left 932313960 2:70767600-70767622 CCACCTGTCAGGCGTTACGCTCC 0: 1
1: 0
2: 0
3: 0
4: 31
Right 932313968 2:70767630-70767652 GGTCCCACCATCCCCAAGCAGGG 0: 1
1: 0
2: 2
3: 9
4: 170
932313958_932313968 9 Left 932313958 2:70767598-70767620 CCCCACCTGTCAGGCGTTACGCT 0: 1
1: 0
2: 0
3: 1
4: 34
Right 932313968 2:70767630-70767652 GGTCCCACCATCCCCAAGCAGGG 0: 1
1: 0
2: 2
3: 9
4: 170
932313954_932313968 30 Left 932313954 2:70767577-70767599 CCATTCGGACCCAAAAGAAAGCC 0: 1
1: 0
2: 0
3: 4
4: 80
Right 932313968 2:70767630-70767652 GGTCCCACCATCCCCAAGCAGGG 0: 1
1: 0
2: 2
3: 9
4: 170
932313962_932313968 4 Left 932313962 2:70767603-70767625 CCTGTCAGGCGTTACGCTCCGGG 0: 1
1: 0
2: 0
3: 0
4: 18
Right 932313968 2:70767630-70767652 GGTCCCACCATCCCCAAGCAGGG 0: 1
1: 0
2: 2
3: 9
4: 170
932313956_932313968 20 Left 932313956 2:70767587-70767609 CCAAAAGAAAGCCCCACCTGTCA 0: 1
1: 0
2: 1
3: 14
4: 193
Right 932313968 2:70767630-70767652 GGTCCCACCATCCCCAAGCAGGG 0: 1
1: 0
2: 2
3: 9
4: 170
932313955_932313968 21 Left 932313955 2:70767586-70767608 CCCAAAAGAAAGCCCCACCTGTC 0: 1
1: 0
2: 1
3: 24
4: 167
Right 932313968 2:70767630-70767652 GGTCCCACCATCCCCAAGCAGGG 0: 1
1: 0
2: 2
3: 9
4: 170
932313959_932313968 8 Left 932313959 2:70767599-70767621 CCCACCTGTCAGGCGTTACGCTC 0: 1
1: 0
2: 0
3: 0
4: 25
Right 932313968 2:70767630-70767652 GGTCCCACCATCCCCAAGCAGGG 0: 1
1: 0
2: 2
3: 9
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932313968 Original CRISPR GGTCCCACCATCCCCAAGCA GGG Intronic
900116062 1:1028394-1028416 GGTGCCCCCAACCCCAACCAAGG - Intronic
901633540 1:10659218-10659240 GGACCCAGCATCCCCAGCCAGGG + Intronic
901811173 1:11767407-11767429 GCTCCCTTCATCCCCCAGCAGGG - Intronic
904039876 1:27577582-27577604 GCTCCCCCCACTCCCAAGCAAGG + Intronic
904592882 1:31625173-31625195 AGTCTCCCCATCCCCAAGCCAGG + Intronic
904928283 1:34065480-34065502 GGTACCACCAGCCCTAAGCAGGG + Intronic
910106032 1:83632075-83632097 GGTAGCACCATCTCCAAGAAGGG - Intergenic
916216310 1:162397996-162398018 TGTCCCCCCATCCCCATGAAGGG - Intronic
920668343 1:207983175-207983197 GGTCCCAGCATGCCCAGGGATGG - Intergenic
1062801781 10:386407-386429 GGTCCTCCAATCCCAAAGCAGGG + Intronic
1062801798 10:386487-386509 GGTCCTTCAATCCCAAAGCAGGG + Intronic
1062996930 10:1874774-1874796 GGCCCCAGCAGCCCCAAGGAGGG + Intergenic
1067667899 10:48294201-48294223 GGTACCAACATCCCCAACCTAGG + Intergenic
1072520652 10:96227268-96227290 GCTCCCGCCACCTCCAAGCAGGG - Intronic
1072892871 10:99340597-99340619 GGTCCCAGAATCCCCAAACATGG - Intronic
1075453571 10:122570102-122570124 GGACCAGCCCTCCCCAAGCAAGG + Intronic
1075453684 10:122570829-122570851 GGACCAACCCTCCCCAAACAAGG + Intronic
1075454077 10:122573654-122573676 GGACCAACCCTCCCCAAGCGAGG + Intronic
1075763050 10:124871220-124871242 GCTCCCACCCTCCCCAGTCATGG + Intergenic
1077405019 11:2378956-2378978 CATCCCACCTTCCCCAAGCCGGG + Intronic
1078049404 11:7948674-7948696 AGTCCCACAACCCCCATGCAGGG - Intergenic
1078775422 11:14389378-14389400 GGTCCCACTGTCCCCAGGCCAGG + Intergenic
1081616365 11:44593571-44593593 GGGCACAGCATGCCCAAGCATGG + Intronic
1081866159 11:46361801-46361823 GGCCCCACCATCCCTAGGCAAGG + Intronic
1084540452 11:69782908-69782930 GGGCCCACCCTCCCCTATCAGGG + Intergenic
1086610307 11:88748049-88748071 GGAACCCCCATCCCCAGGCAAGG + Intronic
1087904558 11:103680544-103680566 GATCTCACAACCCCCAAGCAAGG + Intergenic
1090380212 11:126321223-126321245 GGTCCCACTATCACCCAGGATGG - Intronic
1092175756 12:6405305-6405327 GGTCCCACCAGCTCCAAATATGG + Intergenic
1092846751 12:12590791-12590813 GGTCCCACATTCCCCAGGAATGG + Intergenic
1095495476 12:42779506-42779528 GGTCCCACCTGCCCCATCCAGGG - Intergenic
1095987393 12:48008517-48008539 GGGCTCACCACCCCCAGGCACGG - Intergenic
1096638225 12:52974822-52974844 GCTCCCACCCTCCTCAACCATGG + Intergenic
1096717876 12:53501822-53501844 GGGCCCACTACCCCAAAGCAAGG - Intronic
1097688837 12:62715272-62715294 GGTGCCAGAATCCCCAAGCTGGG - Intronic
1097694447 12:62763072-62763094 GGTCCCGAAGTCCCCAAGCAGGG + Intronic
1099630792 12:85142280-85142302 GATCTCACCAACTCCAAGCAGGG - Intronic
1101396999 12:104357077-104357099 GGTCTCCCCACCCCCAAGCTCGG - Intergenic
1103864715 12:124042752-124042774 GGTTCCTGCATCCCTAAGCAGGG + Intronic
1104013756 12:124949337-124949359 GGCCCCACCAGCCCCAGGAAGGG + Intronic
1105221068 13:18327963-18327985 GGTCACCCCATTCCAAAGCATGG - Intergenic
1105543974 13:21338673-21338695 CTTCCCATCAGCCCCAAGCAGGG + Intergenic
1106787970 13:33126034-33126056 TGCCCCACCACCCCCAACCATGG - Intronic
1116049981 14:39790529-39790551 GGTCCTACCTTCCCCAAACAAGG + Intergenic
1118885225 14:69860343-69860365 GGGCCCTCCATTCCCAAGAAGGG + Intronic
1121760920 14:96444224-96444246 GGCCCCTCCATCCCCAGGGATGG - Intronic
1124571284 15:30866434-30866456 TCTCCCACCATCCCGAAGCCTGG - Intergenic
1128475107 15:67990779-67990801 TGTGCCACTATCCCCAAGCCTGG + Intergenic
1130223683 15:82043112-82043134 GGTTCCCCCTTCCCCCAGCACGG + Exonic
1130432172 15:83859671-83859693 GGTACCACCACCCCCATGAATGG - Intronic
1132684238 16:1155632-1155654 GGCTGCCCCATCCCCAAGCAGGG + Intronic
1132887201 16:2187509-2187531 GGCCCCAGCACCCCCAAGCCAGG + Intronic
1136853700 16:33635266-33635288 GGTTCCCCCATCCCCAACCCAGG - Intergenic
1138521962 16:57576120-57576142 GGTCCCACCCGCCCCAAGCCAGG - Exonic
1138819054 16:60236299-60236321 GCTCACACCATGCCCAAACAAGG + Intergenic
1141036370 16:80629800-80629822 GGTTCCTCCATTCACAAGCAAGG + Intronic
1142351473 16:89582723-89582745 AGTCCCTCCACCCCCAACCAGGG - Intronic
1203115291 16_KI270728v1_random:1483711-1483733 GGTTCCCCCATCCCCAACCCAGG - Intergenic
1142761738 17:2046198-2046220 GCCCCCATCATTCCCAAGCAGGG + Intergenic
1143438764 17:6951576-6951598 GGACCCTCCAGCCCCAGGCAAGG + Intronic
1143969801 17:10787394-10787416 GGTCCCTCCAGCCAGAAGCAGGG + Intergenic
1145814368 17:27784942-27784964 GGTTCCAACACCACCAAGCATGG + Intronic
1147261643 17:39212478-39212500 GGTCCCATCATCCCCCAGGGTGG - Intronic
1148693481 17:49545911-49545933 TGTAACACCATCCCCAAGCTTGG + Intergenic
1149946610 17:60934632-60934654 GTGCCCACCATCCCCCACCAGGG - Intronic
1151913669 17:77101745-77101767 AGTCCCACCATCCCTGAGAAAGG - Intronic
1152656244 17:81520310-81520332 GGTCACACCATGCCCAGGGAAGG + Intronic
1152895377 17:82907882-82907904 CCTCCCACCCTCCCCAGGCAGGG + Intronic
1156219616 18:35038404-35038426 GGTCTCCCCAACACCAAGCAAGG - Intronic
1160149182 18:76386190-76386212 AGCCCCCCAATCCCCAAGCAAGG - Intronic
1160554969 18:79718974-79718996 GGCCTCAGCATCCCCACGCAGGG - Intronic
1162544364 19:11319719-11319741 GGTGCCCCCCTCCCCAAGAAAGG - Intronic
1162686136 19:12386267-12386289 TGTGCCACCATGCCCAACCAAGG - Intronic
1163120060 19:15212082-15212104 GGTCCCAGCATCCCCCAGCATGG + Intergenic
1165774568 19:38397032-38397054 GGTCCACCCACCCCCAAGCCAGG + Intergenic
1166034294 19:40156191-40156213 TGTCCCAGCATCACAAAGCAGGG + Intergenic
1166600569 19:44090678-44090700 AGTCCCACGATCCTCAAACATGG + Intergenic
1166946425 19:46399818-46399840 GGTCGCACAATGCCCAAGGATGG - Intergenic
1167722015 19:51185664-51185686 GGTCACACCAGCCTCAGGCAGGG - Intergenic
1168054490 19:53854437-53854459 GGGCCCACCATCCTCAAGCATGG - Intergenic
927513349 2:23658179-23658201 GGTCCCACCCTCCTCCACCAAGG + Intronic
929551309 2:42894455-42894477 GGTCCCCCCCTCCACAATCATGG + Intergenic
930552520 2:52852872-52852894 GGTGCCCCCACCCCCAACCAAGG - Intergenic
930789878 2:55314119-55314141 GGTCTCTCCATCCTCCAGCAGGG - Intronic
932102177 2:68911394-68911416 GCTGCCACCATCCCCCAACAGGG - Intergenic
932289727 2:70566701-70566723 GGTATCACCCTACCCAAGCAGGG + Intergenic
932313968 2:70767630-70767652 GGTCCCACCATCCCCAAGCAGGG + Intronic
933684696 2:85133676-85133698 GGCCCCACCATGCCCCAGCTCGG + Exonic
934034270 2:88076123-88076145 GGACCCACATTCCACAAGCATGG - Intronic
934073420 2:88406986-88407008 GTTCCCATCATCCTGAAGCAAGG + Intergenic
934182989 2:89644505-89644527 GGTCACCCCATTCCAAAGCATGG + Intergenic
934293275 2:91718692-91718714 GGTCACCCCATTCCAAAGCATGG + Intergenic
934858362 2:97742993-97743015 TGTCCCACCCTGCCCAATCAAGG + Intergenic
936514647 2:113174073-113174095 GGTTCCACCAGCCCCAACCTAGG - Intronic
936527565 2:113252007-113252029 GGTCCCACCATGCAGAATCATGG - Intronic
938371062 2:130768549-130768571 GCCCCCTCCATCCCCCAGCAGGG - Intergenic
940982830 2:160022657-160022679 GGACTCACCATCTCCAAGGAGGG + Exonic
945941038 2:215950501-215950523 GATCCCACCTTCCCCTACCATGG + Intronic
946407243 2:219498219-219498241 GGTCCCACCACCCCCGGGCTCGG - Intronic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
947668294 2:231920664-231920686 GTTCCCACCTTCCCCTAACAGGG + Intergenic
948370559 2:237486946-237486968 GGTCCCACCGTGCCCAAGGCAGG + Intronic
1168904567 20:1392860-1392882 GGGCGCACCTTCCCCAAGCGCGG - Exonic
1173211017 20:41031298-41031320 GATCCCACCTTCCTCTAGCAAGG - Intronic
1173722760 20:45273866-45273888 GGTCCAACCATTCCCCAGCTGGG + Intergenic
1173776589 20:45713883-45713905 GGAACCCCCATCCCCAAACAAGG + Intergenic
1174301850 20:49588170-49588192 GGCCCCACCACTCCCAGGCATGG - Intergenic
1175569468 20:60008060-60008082 GGTACCTCCTTCCCCAAGCAGGG - Intronic
1176099675 20:63359225-63359247 TGCCCCGCCACCCCCAAGCAAGG + Intronic
1180060209 21:45381207-45381229 GTTCCCAGCACCCCCAGGCAAGG + Intergenic
1180927559 22:19566753-19566775 GGTCCCGCCATCCCTCAGCCAGG + Intergenic
1180956952 22:19745522-19745544 ACCCCCACCATGCCCAAGCAGGG + Intergenic
1181132602 22:20742139-20742161 GGTGCCGCCACCACCAAGCATGG - Intronic
1181460883 22:23085353-23085375 TGTCCCCCTGTCCCCAAGCAGGG + Intronic
1182427889 22:30284475-30284497 GATCCCAGCCTCACCAAGCAGGG + Intergenic
1183589094 22:38769589-38769611 GGTCCCACCACCTCTCAGCAGGG - Intronic
1184609526 22:45593885-45593907 TGCCCCACCATCCCCAACCCAGG - Intronic
1184685314 22:46094185-46094207 AGTCCCACCATGCCCAGGCAAGG + Intronic
950425822 3:12924285-12924307 CTTCCCTCCATCCCTAAGCACGG - Intronic
954569547 3:51629186-51629208 AGCCCCACCATACCCATGCAAGG - Intronic
956107508 3:65836152-65836174 GGTACAACCATTCCCAAGTAAGG + Intronic
959299046 3:104576042-104576064 GGTGCTCCCATCCCCAGGCAAGG - Intergenic
959872429 3:111343419-111343441 ATTGCCACCATCCCCAAGCCTGG + Intronic
961083164 3:124043641-124043663 TGTACTACCCTCCCCAAGCATGG - Intergenic
961745465 3:129061403-129061425 GCTCCTCTCATCCCCAAGCAGGG + Intronic
962709029 3:138070156-138070178 GCTCCCACCACCCCCATGCTTGG + Intronic
969101049 4:4768537-4768559 AGGCCCACCAAGCCCAAGCAAGG - Intergenic
972389253 4:38597567-38597589 GGGCCCAGCATCACCAAGCCTGG + Intergenic
972976270 4:44640532-44640554 GGTCCCACCCTTCCCATGGAAGG - Intronic
975851187 4:78574133-78574155 GGAGCCACCATGCCCAACCAAGG - Intronic
983650921 4:170035594-170035616 TGTCCCTGCTTCCCCAAGCATGG + Intergenic
990450815 5:55930161-55930183 GGTGACATCATCACCAAGCAGGG + Intergenic
990947396 5:61263274-61263296 GGTCCCACTGTCCTCAAACAGGG + Intergenic
991048180 5:62244913-62244935 GGTTCCCCCATCCCCAACCCAGG + Intergenic
992890798 5:81202225-81202247 GGGCTTCCCATCCCCAAGCACGG - Intronic
998252404 5:140561929-140561951 GGGCCCACCCTCCCCAACCAGGG + Intronic
1002055888 5:176597700-176597722 GGGACCACCTTCCCCAAGGATGG + Exonic
1002522685 5:179800345-179800367 TGTCCCCCCACCCCCATGCACGG + Intronic
1002523959 5:179805795-179805817 GGCCCCACCATCGCCAAGACCGG + Intronic
1002571790 5:180143788-180143810 GGTCCCCACATCCCTCAGCATGG + Intronic
1002876544 6:1215756-1215778 GAGCCCTCCATCCCCAGGCACGG - Intergenic
1003279397 6:4678617-4678639 GGTCCCTCCCTCAACAAGCAGGG - Intergenic
1005762226 6:28977693-28977715 GGTCCCACCGTCGCCCAACACGG - Intergenic
1007075696 6:39064887-39064909 GGTGCCACCATCCTCAGACAGGG + Intronic
1007623062 6:43226476-43226498 GCTCCCACCCTCCCTGAGCAGGG - Intronic
1009383921 6:63066601-63066623 AGTTCCACCGTCACCAAGCAGGG + Intergenic
1011809941 6:91119600-91119622 AGTCCAAACATCCCAAAGCAGGG - Intergenic
1015878780 6:137850169-137850191 GATCCCACCGTCCCCAAGTCTGG + Intergenic
1018037116 6:159891015-159891037 GGTCCCAACATCTCGAAGGATGG - Intergenic
1018570445 6:165204170-165204192 GGTCCCTCCATCCACATGTAGGG + Intergenic
1018617883 6:165705069-165705091 GGTACCACCCGCCCCCAGCATGG + Intronic
1019344751 7:523704-523726 GGTCCCCCCACCCCCAACCCAGG - Intergenic
1021700991 7:23319184-23319206 GGTGCCATCATCGGCAAGCAGGG - Exonic
1022580899 7:31553166-31553188 AGTCTCACCATCCCCATGCTGGG + Exonic
1024028131 7:45431650-45431672 CTCCCCACCATCCCCAAGCGTGG - Intergenic
1024247515 7:47481471-47481493 GCTCCCAAGCTCCCCAAGCACGG - Intronic
1027211115 7:76149916-76149938 GTCCCCACCTTCCCCAAGCCTGG + Intergenic
1030641734 7:112013822-112013844 AGTCCCTCCATCCTCAAGGAAGG + Intronic
1031293707 7:119974062-119974084 GGTCCCACCTTCCACATGTAGGG + Intergenic
1034943319 7:155246002-155246024 GTTCCCATAATCCCCACGCATGG - Intergenic
1035616228 8:1003780-1003802 GGTCCCCCCATACCCCAGAATGG + Intergenic
1038519570 8:28218675-28218697 GGTCACACAAACCACAAGCAGGG - Intergenic
1038808202 8:30813396-30813418 GGCACCCCCCTCCCCAAGCATGG + Intronic
1039581373 8:38669579-38669601 GCCTCCACCACCCCCAAGCATGG - Intergenic
1045037182 8:98184746-98184768 GCTCTCACCACCCCCAAGCTAGG - Intergenic
1046785998 8:118267444-118267466 GTTCCTACCATTCCCAAGCTGGG + Intronic
1049426899 8:142541758-142541780 GGTACCACCCTACCCAAGCCTGG - Intronic
1049603542 8:143518950-143518972 GGATCCTCCATCCCCAAGCACGG + Intronic
1051853426 9:21535625-21535647 GGGCCCACCACTCCCAACCAAGG + Intergenic
1053721465 9:40951118-40951140 GCCCCCACCATCCCCCAGCTGGG - Intergenic
1054344531 9:63901050-63901072 GCCCCCACCATCCCCCAGCTGGG + Intergenic
1056657371 9:88520418-88520440 TGAGCCACCATCCCCAACCAAGG - Intergenic
1060732976 9:126049704-126049726 GGTCCCAGGATCCCCCAGCGAGG + Intergenic
1061682577 9:132250284-132250306 GGTCTCCCCATGCCCAAGAAAGG + Intergenic
1062199830 9:135296676-135296698 GGGGCCACCTTCCCAAAGCAAGG + Intergenic
1062325645 9:136011219-136011241 CCTCCCACCCTCCCCAAGAAGGG + Exonic
1062413220 9:136434967-136434989 GCTGCCCCCAGCCCCAAGCAAGG + Intronic
1188609564 X:32079308-32079330 TGACCCACCAGGCCCAAGCAAGG - Intronic
1200183541 X:154166867-154166889 GGCCCCCCCCTCCCCAAACAAGG + Intergenic
1200189195 X:154203995-154204017 GGCCCCCCCCTCCCCAAACAAGG + Intergenic
1200194950 X:154241804-154241826 GGCCCCCCCCTCCCCAAACAAGG + Intergenic
1200200600 X:154278925-154278947 GGCCCCCCCCTCCCCAAACAAGG + Intronic