ID: 932314435

View in Genome Browser
Species Human (GRCh38)
Location 2:70770141-70770163
Sequence TGGTTAGGGCCCACAAACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 59}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932314435_932314442 3 Left 932314435 2:70770141-70770163 CCAGAGTTTGTGGGCCCTAACCA 0: 1
1: 0
2: 0
3: 4
4: 59
Right 932314442 2:70770167-70770189 CACTGCATGGCCTCCCAGAGGGG 0: 1
1: 0
2: 1
3: 18
4: 248
932314435_932314436 -10 Left 932314435 2:70770141-70770163 CCAGAGTTTGTGGGCCCTAACCA 0: 1
1: 0
2: 0
3: 4
4: 59
Right 932314436 2:70770154-70770176 GCCCTAACCACTACACTGCATGG 0: 1
1: 0
2: 2
3: 9
4: 109
932314435_932314441 2 Left 932314435 2:70770141-70770163 CCAGAGTTTGTGGGCCCTAACCA 0: 1
1: 0
2: 0
3: 4
4: 59
Right 932314441 2:70770166-70770188 ACACTGCATGGCCTCCCAGAGGG 0: 1
1: 1
2: 0
3: 13
4: 196
932314435_932314440 1 Left 932314435 2:70770141-70770163 CCAGAGTTTGTGGGCCCTAACCA 0: 1
1: 0
2: 0
3: 4
4: 59
Right 932314440 2:70770165-70770187 TACACTGCATGGCCTCCCAGAGG 0: 1
1: 0
2: 1
3: 17
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932314435 Original CRISPR TGGTTAGGGCCCACAAACTC TGG (reversed) Intergenic
901174601 1:7289715-7289737 TGGATAGGACACACAGACTCAGG + Intronic
904273357 1:29364662-29364684 TGTTTACGGCCCACCAAATCTGG - Intergenic
905266955 1:36760924-36760946 TGGTGAGGGTCCTGAAACTCGGG + Intergenic
1064517936 10:16170427-16170449 TGATTTGGGCCCACTAACTAGGG - Intergenic
1065607260 10:27430634-27430656 TGCTTAGGGCACAGAAACTATGG + Intergenic
1069280593 10:66649879-66649901 AGGTTAAGCCCCACAGACTCGGG + Intronic
1072312871 10:94173172-94173194 TGGTTTAAGCCCACAAAGTCAGG + Intronic
1084647308 11:70465918-70465940 TGGTGAGGGCCCACAGTCTGGGG + Intergenic
1107260138 13:38480838-38480860 TGGATAGGGGCCACATACCCAGG - Intergenic
1111725701 13:92005422-92005444 TGGTTAGGGCCCTCAGCTTCAGG + Intronic
1115893531 14:38059175-38059197 TGGATGGGGCCCACAAGATCAGG - Intergenic
1128636458 15:69305549-69305571 TGGTTCGGGCCCGCACACTAAGG + Intronic
1131745589 15:95443640-95443662 TGGTTAAGCTCCACCAACTCAGG + Intergenic
1134266175 16:12694684-12694706 TGATAAGGTCCCACAAACTCTGG + Intronic
1135640878 16:24118912-24118934 TGAGTAGGGGCCACAAACCCAGG + Intronic
1144140565 17:12343077-12343099 GAGTCAGGGCCCACAAGCTCGGG + Intergenic
1155021203 18:21898585-21898607 TGCTTAGGGGCCAGGAACTCTGG - Intergenic
1155257642 18:24012823-24012845 TGGGCAGGGCCCTCAAACGCAGG - Intronic
1155870508 18:31021115-31021137 TGGTTGTTGCCCACAAAATCTGG + Intronic
1158009813 18:52715939-52715961 TGGTTAGGGCCTGTGAACTCAGG - Intronic
1165421293 19:35723234-35723256 GTGTTAGGGCCCCCAAACTTGGG - Exonic
1167445445 19:49534485-49534507 TGGTTAGGGGCCAGGGACTCCGG - Intronic
932314435 2:70770141-70770163 TGGTTAGGGCCCACAAACTCTGG - Intergenic
934572954 2:95383720-95383742 TGGTTAGCGCCCACCTCCTCTGG + Intronic
935407112 2:102720738-102720760 TGGTTAGGAACTCCAAACTCTGG - Intronic
938207018 2:129432411-129432433 GGGATCAGGCCCACAAACTCAGG - Intergenic
941962221 2:171264834-171264856 TCATTAGGTCCCACAAAATCTGG - Intergenic
945525373 2:210882555-210882577 TGGTGAGGCACCCCAAACTCTGG - Intergenic
1176082886 20:63282738-63282760 TCCTCAGGGCCCACAGACTCAGG - Intronic
1179120844 21:38544273-38544295 TGGTTAGGGCCCTCAGGCCCTGG + Intronic
952691279 3:36209299-36209321 TGGTCAAGGCACACACACTCCGG - Intergenic
954427276 3:50450029-50450051 GGCTTGGGGCTCACAAACTCTGG - Intronic
956924993 3:73976293-73976315 TGTTTAGGGACTACAAATTCTGG + Intergenic
965046451 3:163584553-163584575 TGGGTAGGCCCCACAACCTTGGG + Intergenic
967488632 3:190063058-190063080 TGGTTTGGGCCCAAATACACTGG - Intronic
971336449 4:25727910-25727932 TGCTGAGGGCCCACAGAATCAGG - Intergenic
975727797 4:77308861-77308883 TGGTGAGGTCCCACAAAATGAGG + Intronic
977095428 4:92736729-92736751 TGTTTAGGGCCCATAAACTGGGG - Intronic
982220862 4:153124135-153124157 TCCTGTGGGCCCACAAACTCTGG + Intergenic
982291219 4:153784608-153784630 TGGTCAGGTCCCTAAAACTCTGG - Intronic
983995608 4:174177643-174177665 TAGTTAGGGCTCAAATACTCAGG - Intergenic
984671799 4:182498172-182498194 TATTTTGGTCCCACAAACTCTGG - Intronic
986279335 5:6310853-6310875 TGGTTAGGGCCCAAACCCTGAGG - Intergenic
994639266 5:102386300-102386322 AGGTTGGCCCCCACAAACTCAGG - Intronic
996776055 5:127134129-127134151 TGTTTTGGGCCCACAAAATCTGG + Intergenic
1001771558 5:174300855-174300877 AGGTAAGGGCACACAAACTGTGG - Intergenic
1002454528 5:179338624-179338646 TGGTCAGGGCCCTCCAGCTCCGG - Intronic
1004691971 6:17999927-17999949 TGGGTAGTGCCCACACACTTTGG + Intergenic
1007915251 6:45555541-45555563 TGGTTAGGGAGAACAAAATCAGG - Intronic
1009174287 6:60440580-60440602 GGGTCAGGGCCCACAATCTGTGG + Intergenic
1013801631 6:113952109-113952131 TTCTTAGGGCCCAGAAACTCTGG - Intronic
1015719773 6:136228944-136228966 TAGTTAGTGCCCTCAAACTAAGG - Intergenic
1040340428 8:46437733-46437755 TGGGTGGGCCACACAAACTCAGG - Intergenic
1049083313 8:140458571-140458593 TTGTTGGGGCCCTCAAAGTCGGG - Exonic
1049644480 8:143729910-143729932 TGGCCAGTGCCCAGAAACTCGGG - Intronic
1051436816 9:17042562-17042584 TTGTTAGGGACCACAACCCCAGG + Intergenic
1060204546 9:121674829-121674851 TGGTGAGGGCCCACCTACCCAGG + Intronic
1062149221 9:135008950-135008972 GGATTAGGGCCCACCCACTCCGG - Intergenic
1186114299 X:6289051-6289073 AGGCTTGGGCCCACAAACTATGG - Intergenic
1186972544 X:14863306-14863328 TGGATAGGGCACACAAAATAAGG + Intronic
1192260141 X:69501218-69501240 TGGCCAGGGCCCACCAGCTCTGG + Intergenic
1193297512 X:79850476-79850498 TGATTTGGGCCCACTAACTAGGG + Intergenic
1196751756 X:119124478-119124500 GGGTTGGGGCCCATTAACTCTGG + Intronic
1202088550 Y:21164181-21164203 AGGTTAAGGCCCACACACTTGGG - Intergenic