ID: 932314812

View in Genome Browser
Species Human (GRCh38)
Location 2:70772908-70772930
Sequence TATCCACAGCTCTCCAGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932314812_932314817 21 Left 932314812 2:70772908-70772930 CCAGACCTGGAGAGCTGTGGATA No data
Right 932314817 2:70772952-70772974 GATAACATGTAAGTCCCTCTGGG No data
932314812_932314819 23 Left 932314812 2:70772908-70772930 CCAGACCTGGAGAGCTGTGGATA No data
Right 932314819 2:70772954-70772976 TAACATGTAAGTCCCTCTGGGGG No data
932314812_932314818 22 Left 932314812 2:70772908-70772930 CCAGACCTGGAGAGCTGTGGATA No data
Right 932314818 2:70772953-70772975 ATAACATGTAAGTCCCTCTGGGG No data
932314812_932314816 20 Left 932314812 2:70772908-70772930 CCAGACCTGGAGAGCTGTGGATA No data
Right 932314816 2:70772951-70772973 TGATAACATGTAAGTCCCTCTGG No data
932314812_932314820 26 Left 932314812 2:70772908-70772930 CCAGACCTGGAGAGCTGTGGATA No data
Right 932314820 2:70772957-70772979 CATGTAAGTCCCTCTGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932314812 Original CRISPR TATCCACAGCTCTCCAGGTC TGG (reversed) Intergenic
No off target data available for this crispr