ID: 932317525

View in Genome Browser
Species Human (GRCh38)
Location 2:70795858-70795880
Sequence TTTCCCTCCATGCCTGTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932317522_932317525 10 Left 932317522 2:70795825-70795847 CCATTATTGTCACTTCTCTTGCT No data
Right 932317525 2:70795858-70795880 TTTCCCTCCATGCCTGTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932317525 Original CRISPR TTTCCCTCCATGCCTGTGGG CGG Intergenic
No off target data available for this crispr