ID: 932317823 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:70797830-70797852 |
| Sequence | GGGCCTCTTCACGAGGCTGT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 932317823_932317829 | 9 | Left | 932317823 | 2:70797830-70797852 | CCTACAGCCTCGTGAAGAGGCCC | No data | ||
| Right | 932317829 | 2:70797862-70797884 | TACAGCCATGTGAGCTGCAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 932317823 | Original CRISPR | GGGCCTCTTCACGAGGCTGT AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||