ID: 932317823

View in Genome Browser
Species Human (GRCh38)
Location 2:70797830-70797852
Sequence GGGCCTCTTCACGAGGCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932317823_932317829 9 Left 932317823 2:70797830-70797852 CCTACAGCCTCGTGAAGAGGCCC No data
Right 932317829 2:70797862-70797884 TACAGCCATGTGAGCTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932317823 Original CRISPR GGGCCTCTTCACGAGGCTGT AGG (reversed) Intergenic
No off target data available for this crispr