ID: 932322713

View in Genome Browser
Species Human (GRCh38)
Location 2:70833962-70833984
Sequence ACCTTTCAGCAACTGGACAT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932322707_932322713 30 Left 932322707 2:70833909-70833931 CCGTCACTATTCTTTTTAATTTC 0: 1
1: 0
2: 4
3: 108
4: 976
Right 932322713 2:70833962-70833984 ACCTTTCAGCAACTGGACATTGG 0: 1
1: 0
2: 1
3: 12
4: 139
932322710_932322713 2 Left 932322710 2:70833937-70833959 CCAGGGTGCTGATGTTGTCCACA 0: 1
1: 0
2: 0
3: 17
4: 145
Right 932322713 2:70833962-70833984 ACCTTTCAGCAACTGGACATTGG 0: 1
1: 0
2: 1
3: 12
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932322713 Original CRISPR ACCTTTCAGCAACTGGACAT TGG Exonic
901407930 1:9062410-9062432 ACCTTTGAGCATCTGGAATTTGG + Intronic
901562670 1:10085151-10085173 AGCCTCCAGCAAGTGGACATTGG + Intronic
903754138 1:25648993-25649015 TCCTGTCAGCAACTGAACAGGGG + Intronic
903789030 1:25880123-25880145 TCCTTTCAGGTACTGGACTTAGG - Intergenic
910455925 1:87397237-87397259 ACCTTACAGAAACAGAACATGGG + Intergenic
913093772 1:115497371-115497393 ACCTCCCAGGAACTGGACAGAGG + Intergenic
915909947 1:159908721-159908743 ACCTCACAGCCACTGGACCTGGG + Intergenic
916697770 1:167257374-167257396 ACCTCTCATCATTTGGACATAGG - Intronic
917521867 1:175754347-175754369 AGATTTCAGTATCTGGACATAGG + Intergenic
918115677 1:181495200-181495222 AGCTTTCATCAACTGGGCATTGG - Intronic
919528948 1:198691575-198691597 ACCTTTCAGGAAATGGAAAATGG - Intronic
920858366 1:209683357-209683379 ACCATTGAGTAATTGGACATAGG + Intergenic
922563760 1:226587824-226587846 ACCTTTGATCAACTAGAGATGGG - Intronic
922626690 1:227053376-227053398 AACTTTCAGCTACTGGATTTGGG + Intronic
922777871 1:228225256-228225278 AGCTTTGAGCAACAGGACATGGG - Intronic
1063065490 10:2604174-2604196 ACCTCCCAGCACCTGGACTTGGG - Intergenic
1067976625 10:51033166-51033188 TCCTATGAGTAACTGGACATAGG - Intronic
1068157293 10:53217281-53217303 AACTTTCAGGAACTTGAAATAGG - Intergenic
1069589876 10:69635099-69635121 ACCTTTCAGACACTGGGCTTAGG - Intergenic
1076108333 10:127842453-127842475 ACCTCTCAGTAACCTGACATAGG + Intergenic
1078984453 11:16578533-16578555 GCCTTACAGCAACTTGACAGTGG - Intronic
1081026080 11:38016708-38016730 TCCTTTCTGCAAATGGTCATGGG - Intergenic
1083774186 11:64885277-64885299 ACCTGGCAGCCACTAGACATGGG + Intronic
1084109301 11:67003075-67003097 GCCTCTCAGCTCCTGGACATTGG - Intergenic
1085055153 11:73398959-73398981 ACCTTTCAGCAAGCAGAAATTGG - Intergenic
1087925686 11:103916009-103916031 ACCATTCAGGATATGGACATGGG + Intronic
1089969169 11:122678609-122678631 ACCTTTCAGCCTCTGGGCAGTGG - Intronic
1095929532 12:47611844-47611866 ACCTGTCAGCACCTTGATATTGG - Intergenic
1096210177 12:49759367-49759389 ACCGTTCAGCAGCTGAACTTAGG + Intronic
1097600812 12:61690668-61690690 ACCTTTCAACAAATGGTCTTGGG - Intergenic
1099632750 12:85171846-85171868 ACCTTCCAGCACCTGGATCTTGG + Intronic
1102320266 12:111927281-111927303 ACCTTTTAAGAACTGGACTTCGG + Intergenic
1102723018 12:115034272-115034294 ACCTCCCAGCAACTGGAGCTGGG - Intergenic
1103019817 12:117525065-117525087 CCCTTTGAGCAGCTGGAGATCGG - Exonic
1104323993 12:127778495-127778517 ACATTTCTGCAGCTGAACATGGG - Intergenic
1104676899 12:130717156-130717178 ACCTTTCAGTAACAAGCCATGGG - Intergenic
1106131219 13:26941071-26941093 CCCTTCCAGCAACTGGAAGTGGG - Intergenic
1107579356 13:41765677-41765699 TTTTTTAAGCAACTGGACATTGG - Intronic
1112347643 13:98603946-98603968 AGCTTTCAGCAACAGAACCTGGG + Intergenic
1115846000 14:37535557-37535579 ACCTTTCAGCCACTTGAAAAAGG + Intronic
1118780961 14:69007292-69007314 ACCTATCAGCTACAGGACCTTGG + Intergenic
1119343266 14:73899535-73899557 AGGTTTCAGCATCTGGAGATTGG - Intronic
1120540133 14:85740987-85741009 ACCTTTCAGCAAATGGCAATGGG + Intergenic
1124841735 15:33248523-33248545 ACTTTTCAGCAACTTGAGATTGG - Intergenic
1125010359 15:34865659-34865681 TCCATTCATCAATTGGACATTGG - Intronic
1126099016 15:45108514-45108536 ACCCTGCAGCAACAGGACAATGG + Intronic
1127040334 15:54968648-54968670 ACCATTCAGGAAATGGGCATGGG - Intergenic
1128660123 15:69493976-69493998 TCCTTTCAGCAGCTGGGCCTGGG + Intergenic
1138173270 16:54872960-54872982 ACTATTCAGAATCTGGACATTGG + Intergenic
1138345889 16:56319866-56319888 ACCTGTCAGCAGCTGGAGAAAGG - Intronic
1138491261 16:57378147-57378169 ACCTTTCAGCAACTGCTCTCGGG + Intronic
1140036715 16:71376869-71376891 TCCTTTCTGCAGCTGGACAGTGG - Intronic
1140873822 16:79131689-79131711 ACTTTTCAAAAACAGGACATGGG + Intronic
1141415440 16:83868612-83868634 ACCTTTCAGGAAATAGGCATGGG + Intergenic
1145218263 17:21068421-21068443 ACCTTTGAGCAACTTGGCAAGGG - Intergenic
1146287742 17:31585577-31585599 ACCTTTGAGCAATAGGAAATGGG + Intergenic
1153020999 18:629073-629095 ACCTTTCAGAAACTGAAGCTAGG + Intronic
1155077551 18:22373901-22373923 ACCTTTCAGCACCTGGAAATTGG + Intergenic
1156010870 18:32496302-32496324 ACCTTTCAACAAATGGTCCTGGG - Intergenic
1156027520 18:32671900-32671922 GCCCTTCAGCAACTAGCCATTGG + Intergenic
1156702289 18:39840402-39840424 AACTTTCAGCAAATGTACAAGGG - Intergenic
1158692094 18:59669792-59669814 ACCTTTCAGCTGCAGGACCTAGG + Intronic
1159136092 18:64338299-64338321 CCCTTTCAGCAGCTGGACTTGGG - Intergenic
1163509403 19:17726195-17726217 AGCTTCCAGAAACTGGACTTGGG - Exonic
1167489743 19:49785428-49785450 ACCTTTCAGCAATGTGACAAAGG + Intronic
1168659367 19:58154458-58154480 AGCGTCCAGCAACTGGACAAAGG - Intronic
925275736 2:2646952-2646974 ACCTTTCAGCACCTGCAGGTGGG + Intergenic
926621901 2:15054185-15054207 TCATTTCAGCAACTTGAGATAGG + Intergenic
928713400 2:34032715-34032737 AACTTTCACCAACTGGAAAGAGG + Intergenic
931658426 2:64532231-64532253 ACCTTTCAGAAACTGGAAGAAGG + Intronic
932121494 2:69104750-69104772 ACCTTTGAGCAACGGCACATAGG - Intronic
932322713 2:70833962-70833984 ACCTTTCAGCAACTGGACATTGG + Exonic
935588213 2:104821068-104821090 ACCTTTCATCCACAGGACTTAGG - Intergenic
937158111 2:119735647-119735669 ACCTTTAAGCAACTAGAGAGCGG - Intergenic
943416616 2:187614712-187614734 ACCTTTCAGCTTCTGAACGTTGG - Intergenic
943614559 2:190078292-190078314 ACTTTTCAGAAATTGGACACTGG - Intronic
947841616 2:233211358-233211380 ACCTTTCAGCCACAGGAATTCGG - Intronic
1169728400 20:8761058-8761080 ACCTTACAGCTGATGGACATTGG - Intronic
1174242653 20:49150261-49150283 TCCTTTCATCATCTGGAAATGGG + Intronic
1175692775 20:61077500-61077522 ACTTCTCAGCCACGGGACATTGG - Intergenic
1176703614 21:10091185-10091207 GCCTTTCAGCAACTGGCAACAGG + Intergenic
1177584358 21:23070512-23070534 AGATCTCAGCAACTGCACATAGG - Intergenic
1184470520 22:44693027-44693049 ACCTTTCCCCATCTGGACATGGG + Intronic
954997950 3:54899097-54899119 ACCTTTTAGCAGGTGGGCATTGG + Intronic
955511432 3:59684531-59684553 ACCCTTGAGAAACTGGACTTGGG + Intergenic
955996109 3:64682523-64682545 ACCACTCAGCAACTTGGCATGGG - Intronic
958256000 3:91325529-91325551 GCCTTTGAAGAACTGGACATGGG - Intergenic
958608223 3:96388158-96388180 ACCATTCTGCAAATAGACATGGG - Intergenic
960607554 3:119523184-119523206 ACCTTTTAGGAACTGGTCAAAGG - Intronic
960667844 3:120127986-120128008 ACCTTTGGGCAAGTGGACAATGG - Intergenic
962568460 3:136688205-136688227 ACCTTTCAGCATGTCGACATAGG + Intronic
964826000 3:160828769-160828791 ACCTTTCAGCATATAGACATAGG + Intronic
967851573 3:194086588-194086610 CCCTTCCAGGAACTGGAGATGGG - Intergenic
969078896 4:4603005-4603027 CCCTTTGAGTAACTGGTCATTGG - Intergenic
969265776 4:6063305-6063327 ATCTTTCAGCACCAGAACATGGG - Intronic
970186213 4:13456105-13456127 ACCTTTCAGCAAATTTACAATGG + Intronic
977914076 4:102571401-102571423 ACCATTCAGCACATGGGCATGGG + Intronic
984568655 4:181363157-181363179 AATTATCAGCAACTGAACATTGG + Intergenic
985823598 5:2177558-2177580 ACCCTTCAGGAACTGCAGATGGG - Intergenic
987422516 5:17737188-17737210 ACCTTCCAGCAAGTGGTCATGGG + Intergenic
988829632 5:34974790-34974812 ACCTTTCAGTTGATGGACATTGG + Intergenic
988995462 5:36710738-36710760 ACATTTCAGCACCTGGAGAATGG - Intergenic
989587003 5:43082361-43082383 ACCTTATAGAAACTGGACAAGGG + Intronic
990798133 5:59567274-59567296 CACCTTTAGCAACTGGACATTGG - Intronic
991898635 5:71433740-71433762 ACATTTCATCAAGGGGACATAGG + Intergenic
991997511 5:72402589-72402611 ACAGTTCAACAACTGGAAATAGG - Intergenic
992200635 5:74380525-74380547 ACCTTCAAGCAACTTGAAATAGG + Intergenic
992968813 5:82033615-82033637 ATCTTCCAACAACTAGACATTGG + Intronic
993821148 5:92618538-92618560 ACCATTCAGGAACTAGGCATGGG - Intergenic
994315886 5:98332541-98332563 ACCTTTCAGCTCCTAGGCATGGG - Intergenic
995924587 5:117355770-117355792 CCCTTTCCACAGCTGGACATTGG + Intergenic
1004222588 6:13759336-13759358 ACCATTCAGCCACTGGATACTGG - Intergenic
1004697259 6:18045273-18045295 AATTTTCAGCATCAGGACATGGG - Intergenic
1006765850 6:36505855-36505877 ACTTTCCAGTAACTGGACACTGG + Intronic
1008133460 6:47744680-47744702 ACCTTTCAGCCACTTGATTTTGG - Intergenic
1008999338 6:57695643-57695665 GCCTTTGAAGAACTGGACATGGG + Intergenic
1009187829 6:60595048-60595070 GCCTTTGAAGAACTGGACATGGG + Intergenic
1009260655 6:61482278-61482300 TCCATTCTGCAAATGGACATTGG - Intergenic
1011741562 6:90365752-90365774 AACATTCAGCCACTGAACATGGG - Intergenic
1011985020 6:93432511-93432533 ATCTTTCAGCAATTGGATATGGG - Intergenic
1014557395 6:122851040-122851062 AATTTTCAGCCATTGGACATTGG - Intergenic
1015818784 6:137237987-137238009 ACCTATCAGCATATTGACATAGG + Intergenic
1015977010 6:138800864-138800886 ACCTGTCAGCACCTTGACCTTGG - Intronic
1018457392 6:163964263-163964285 ACCCTTCAGCAACTTCTCATTGG - Intergenic
1022617001 7:31941679-31941701 ACATTTTAGGAACTGAACATTGG + Intronic
1023225084 7:37960739-37960761 ACCTTTCAACAACTTCCCATTGG - Intronic
1024391201 7:48814379-48814401 ACCTTTTAGCAAGCGGACAGGGG - Intergenic
1031709402 7:125026212-125026234 ACTTTTCTGCAAGTGGACATTGG + Intergenic
1035543224 8:458360-458382 TCCTTTCAGCAAGTGAACAATGG + Exonic
1037785798 8:21902373-21902395 GCTTTTCAGCTGCTGGACATGGG - Intergenic
1039397843 8:37242451-37242473 ATGTTATAGCAACTGGACATTGG + Intergenic
1043234505 8:77845362-77845384 ACCTTTCTGGAACTTAACATTGG + Intergenic
1044061845 8:87648200-87648222 ACCTTTCAGCCACTTAACAAAGG + Intergenic
1046493642 8:114985633-114985655 ACCTTTCAGGACGTAGACATGGG - Intergenic
1048500628 8:134971506-134971528 ATATTTCAGGAACTTGACATGGG + Intergenic
1052558403 9:30050522-30050544 ACCTTTCAACTCCTGGACTTTGG - Intergenic
1053277051 9:36791019-36791041 GCCTCTCAGGAACTGGACCTTGG + Intergenic
1053704936 9:40742670-40742692 ATTTTTCAGACACTGGACATTGG + Intergenic
1054363507 9:64204334-64204356 TCCATTCTGCAAATGGACATTGG - Intergenic
1055242551 9:74201609-74201631 TCTTTTCAGCAACAGGTCATGGG - Intergenic
1056462606 9:86822917-86822939 ACCTATCTGCAAGTGGACAGGGG - Intergenic
1059705823 9:116822331-116822353 ACCTTTCTGCAGCTTGACAAAGG - Intronic
1060358172 9:122930632-122930654 ACCATTCACCATCTGGACCTCGG + Intronic
1061570016 9:131471906-131471928 ACCTTTTAGTAACTGGTCAAAGG - Intronic
1202788651 9_KI270719v1_random:61280-61302 GCCTTTCAGCAACTGGCAACAGG + Intergenic
1191771154 X:64760137-64760159 ACCATTCAGGAAATAGACATGGG - Intergenic
1192387267 X:70683935-70683957 TCCTTTCAGCAAATGGTGATAGG + Intronic
1193972938 X:88079524-88079546 ACCTTTCAGAAAATGCACTTGGG - Intergenic
1194538945 X:95146324-95146346 GCCTTTCAGCAGCTGGAATTGGG + Intergenic
1197454795 X:126665668-126665690 ACCTTTGAGCAACGGAAGATAGG + Intergenic
1201597380 Y:15686174-15686196 ACCTTTCAGGAAATAGGCATGGG + Intergenic
1201866822 Y:18665051-18665073 ACCTTTCAACAATAGGACAAAGG + Intergenic
1202047986 Y:20753297-20753319 ATGTTTCAGCCACTGGACAGTGG - Intergenic