ID: 932323145

View in Genome Browser
Species Human (GRCh38)
Location 2:70836572-70836594
Sequence CTGGTGAGGAGCAGACTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 1, 2: 2, 3: 20, 4: 247}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932323145 Original CRISPR CTGGTGAGGAGCAGACTGGT GGG Intergenic
900347400 1:2216282-2216304 CTGGTGAGGCCCAGCCTGGGGGG - Intergenic
900737023 1:4305380-4305402 CTGGTGATGATCAGAAAGGTGGG + Intergenic
900798374 1:4723208-4723230 CTGGGGAGCAGCAGATTGGAAGG + Intronic
902329538 1:15724575-15724597 CTGGGGAGAAGCAGCCTGGGGGG + Intronic
904963847 1:34356333-34356355 CTGGTGAGGGGCAGACAGCAGGG - Intergenic
905016628 1:34782440-34782462 CAGGTGAGTAGCAGCCTGGGAGG + Intronic
905499689 1:38426746-38426768 CTGGCGAGGAGCAGCCTGGGAGG - Intergenic
905717138 1:40161634-40161656 CAGGTGAGGGGCTGACTGGCTGG + Exonic
905910140 1:41647902-41647924 CTGGTGAGGCCCTGCCTGGTGGG + Intronic
906101876 1:43269221-43269243 CTGGTGAAGGGCAGGCTGGCTGG - Intronic
906674786 1:47685415-47685437 CTGCTGAGGAGCAGCTTGGCTGG - Intergenic
907038194 1:51235406-51235428 CTGATGAGAAGCAGAAAGGTTGG + Intergenic
907164316 1:52396960-52396982 CTGGGCAGGAGCACAGTGGTGGG - Intronic
907220972 1:52906675-52906697 CTGGGGAGGGGCAAGCTGGTTGG + Intronic
907341838 1:53740654-53740676 CCTGTGAGCAGCAGAGTGGTTGG - Intergenic
908900008 1:68945826-68945848 CTGGAGAGGAGCAGATTATTTGG - Intergenic
911059880 1:93738686-93738708 CTGGTGGGGAGAGCACTGGTCGG + Intronic
912376267 1:109212398-109212420 CTGAAGAGGAGCAGTCTAGTGGG - Intergenic
912498585 1:110106993-110107015 ATGGTGAGGTGAAGACTGGCAGG - Intergenic
916611160 1:166393075-166393097 CAGGTGAGGAGCAGGCAGTTAGG + Intergenic
916824348 1:168429881-168429903 GCAGAGAGGAGCAGACTGGTAGG - Intergenic
917591332 1:176480092-176480114 CTGGAGAGAAGCCGGCTGGTGGG + Intronic
918406109 1:184213273-184213295 CTGGTGTGGAGCCAACTGGGAGG - Intergenic
919914276 1:202130269-202130291 CTGGTGGGCAGAAGTCTGGTGGG - Exonic
922132467 1:222793673-222793695 CTGGTGAGGGGGAGAAGGGTGGG + Intergenic
922227120 1:223655050-223655072 GTGGTGAGGAGCAGGGAGGTAGG + Intronic
922618947 1:226979073-226979095 CTGGTGAGGAGAAGCCTGCAGGG - Intronic
922906309 1:229176089-229176111 CTGGTGAGGAGGGGAGAGGTCGG - Intergenic
924287580 1:242503856-242503878 CTGATGCGGAGCAGAAAGGTGGG + Intronic
1064985827 10:21208871-21208893 AGGGTGAGGTGCAGACTGGCTGG - Intergenic
1066107364 10:32167578-32167600 CTGGGGATTAGCAGGCTGGTTGG - Intergenic
1066451212 10:35532076-35532098 CTGGAGAGGAGCAGCCTTGGAGG + Intronic
1067071322 10:43134663-43134685 CTTGTCAGTAGCTGACTGGTTGG + Intergenic
1069801102 10:71082165-71082187 TTGGTGGGGAGCAGATTGATAGG - Intergenic
1069818806 10:71214992-71215014 CTGGAGAGGGGCCAACTGGTGGG + Intronic
1069877921 10:71574519-71574541 CTTGGGGGGAGCAGGCTGGTGGG - Intronic
1069895338 10:71677047-71677069 CTGGTGAAGGGCAGGGTGGTTGG - Intronic
1070324481 10:75378953-75378975 CAGGTGAGGAACAGACAGGGTGG - Intergenic
1070774325 10:79100977-79100999 CTGATGAGGAGCACAAAGGTCGG + Intronic
1071500938 10:86203990-86204012 CTGATAAGGAGCAGTCTGGTTGG + Intronic
1072799926 10:98385700-98385722 ATGGGGAGGAGCAGACTCGAGGG - Intronic
1073922818 10:108479265-108479287 CTTGTGAGGTGGAGGCTGGTTGG + Intergenic
1074301242 10:112234970-112234992 CCGGTCAGGAGCAGAGTGGGCGG + Intergenic
1075276609 10:121099329-121099351 GAGGTGAGGAGCAGACTTCTTGG + Intergenic
1075623987 10:123948561-123948583 CTGGAGATGAGCAGTGTGGTGGG - Intergenic
1075713787 10:124544379-124544401 GGGGTCAGGAGCAGACTGGCAGG + Intronic
1076826786 10:132973383-132973405 CTGGGCAGGGGCAGACTGGATGG + Intergenic
1076979367 11:196523-196545 CTGGTGAGGAGGACATGGGTGGG + Intronic
1077198469 11:1293318-1293340 CTGGGGTGGAGCTGAGTGGTCGG + Intronic
1077361971 11:2144801-2144823 CTGGGGACCAGCAGAATGGTGGG + Intronic
1077461923 11:2715045-2715067 CTGGTGAGGAGTAGCAGGGTGGG + Intronic
1077766979 11:5169421-5169443 CTGGTCAGGAGGAAACTGTTTGG - Intronic
1081495153 11:43601819-43601841 CTGGTGAGAAGCAAACTGAGAGG - Intronic
1082000725 11:47392656-47392678 CTGCTTAGGAGCTGGCTGGTGGG - Intergenic
1083521735 11:63320108-63320130 CTGTTGAAGAGCAGATTGGGGGG + Intronic
1083618948 11:64039544-64039566 GTGGTGTGGGGCAGACTGGATGG + Intronic
1084224856 11:67709799-67709821 CTGGTGTTGAGCAGACTTGAAGG - Intergenic
1084679401 11:70657595-70657617 CTGGTGTGGAGCAGCCTCGTAGG + Intronic
1089467078 11:118692297-118692319 CTGGTGGGGAGGACACAGGTAGG + Intergenic
1089563820 11:119359949-119359971 CAGGAGAGGAGCAGGCTGATGGG + Intronic
1091300455 11:134503933-134503955 CTGGGGAGGAGGAGGCTGGGAGG + Intergenic
1091886424 12:4020200-4020222 CTGGCGAGGAGCAGCCTGGGAGG - Intergenic
1094471647 12:30807181-30807203 TTGGTGCTGAGCAGACTGGGAGG - Intergenic
1096488924 12:52003154-52003176 CTGGTGGGCAGCTGACTGGGCGG - Intergenic
1100028515 12:90158665-90158687 CTGGTTAGTAGCACACAGGTTGG - Intergenic
1100852208 12:98724442-98724464 ATGGTGAGGAGCTAAGTGGTTGG - Intronic
1101499019 12:105283984-105284006 CAGGTAAGGGGCTGACTGGTAGG + Intronic
1101749354 12:107570751-107570773 AGGGGGAGGAGCAGACAGGTAGG - Intronic
1104014340 12:124952333-124952355 CTGGTGAGGGGCAGGCGGGCTGG - Intronic
1105210277 13:18253296-18253318 CTGGGGAGGAACAGAGAGGTGGG - Intergenic
1105730631 13:23211911-23211933 GTGTTGAGGTGCAGCCTGGTGGG + Intronic
1105859332 13:24395254-24395276 CTGGAGAGGAGGAGAGGGGTTGG - Intergenic
1111063947 13:83065358-83065380 CTGGCCAGGAGCAGACTCATTGG - Intergenic
1111091324 13:83452020-83452042 CTGGTGAGGGGCAGAGTGGATGG - Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114227266 14:20750443-20750465 CTGGGGAGGAGCAGACACCTGGG + Intergenic
1114230245 14:20774835-20774857 CTGGGGAGGAGCAGACACCTGGG + Intergenic
1115238292 14:31229723-31229745 CTGGGGAGGAGCAGAGGGGTGGG - Intergenic
1116795381 14:49384609-49384631 CTGGTGATGAGCAGGGTGGTGGG - Intergenic
1117120118 14:52558466-52558488 ATTGAGAGGAGCAGACTGGGGGG + Intronic
1117346068 14:54834025-54834047 CTGGCTAAGAGCAGACTGGAAGG - Intergenic
1118425159 14:65652544-65652566 CTGGTGAAGAAGAGACTGGCTGG + Intronic
1118613440 14:67559099-67559121 CTGAAGAGGAGCAGCCTGGCTGG - Intronic
1119481634 14:74961827-74961849 CTGGTGGGCAACAGACAGGTAGG - Intergenic
1119481663 14:74961977-74961999 CTGGTGGGCAACAGACAGGTAGG - Intergenic
1121505749 14:94475177-94475199 CAGGGAAGGAGCAGACAGGTAGG - Intronic
1121613187 14:95294915-95294937 CTGGTGAGGGGCACTCTGGCTGG - Intronic
1122267762 14:100554640-100554662 CTGGTGGGGAGTGGGCTGGTGGG - Intronic
1127621658 15:60740016-60740038 CAGGTGAGGAGAAGAGAGGTTGG - Intronic
1127733180 15:61818724-61818746 CTGGGGAGGAGAAGATTGATTGG - Intergenic
1128329224 15:66745020-66745042 CTGGTGGGGGGCAGGCTTGTTGG - Intronic
1128565353 15:68697513-68697535 GTGGTGAGGAGGTGACTGGAAGG + Intronic
1128566803 15:68706145-68706167 CTCGTGTGGAGCAGGCTGGCTGG - Intronic
1128657383 15:69472322-69472344 CTGGGAAGGAGCAGACTGTCAGG - Intergenic
1128934030 15:71730343-71730365 CTGATGGGGAGCAGGGTGGTGGG - Intronic
1129743969 15:78005185-78005207 CTGGTGTGGAGCAGGCTGCCAGG + Intronic
1129934966 15:79439729-79439751 CTGGTGAGGAGCACAGTGTCTGG + Intronic
1131132742 15:89910530-89910552 GTGTTGAGCAGCAGACAGGTGGG - Intronic
1132221840 15:100110945-100110967 CTGGTGAGAAGCAGACTTCGTGG - Intronic
1132310300 15:100852749-100852771 CTAGTGAGGAGCACACTGCTTGG - Intergenic
1133022898 16:2974642-2974664 ATGGTGAGGCCCAGACTGGCAGG + Exonic
1133236304 16:4388865-4388887 CTCGGGAGGAGCAGCCAGGTTGG - Intronic
1133712956 16:8419307-8419329 CTGGTGAGCAGCAGACTAACAGG - Intergenic
1136123265 16:28155941-28155963 CTGGTGAGGAACAGAAAGGTAGG - Intronic
1137306531 16:47206273-47206295 CTGGTGAGGAGCAGTTTAGATGG - Intronic
1138668330 16:58592251-58592273 CTGGTGAGGAGCAGACAGCATGG + Intronic
1139390495 16:66604465-66604487 CTGGATAGGGGCAGACGGGTGGG + Exonic
1139848146 16:69934918-69934940 CTGGTGAACAGTAGACTGGCTGG + Intronic
1140127999 16:72133798-72133820 CTGGTGATCAGCAGACTCCTGGG + Intronic
1141858334 16:86700313-86700335 CTGGTGAGAAGGGGGCTGGTTGG + Intergenic
1142352302 16:89585956-89585978 CTGGGGAGGAGCAGGTTGGGGGG + Intronic
1142563236 17:823666-823688 CTGGAGAGCAGCAGCCTGGAGGG - Exonic
1143297322 17:5881060-5881082 CTGGAGAGGAGCAGACTAAGGGG - Intronic
1143445204 17:7005234-7005256 CTGGAGAGGAGGAGATTGGAGGG - Intronic
1143595585 17:7911803-7911825 CTGGTGAGAAGAAGTCTGGGTGG + Exonic
1144287795 17:13795321-13795343 TTGGTGAGGAGCATCATGGTAGG + Intergenic
1144485364 17:15659982-15660004 CTGGGCAGGAGCACACAGGTAGG + Intronic
1145768158 17:27473515-27473537 CTTGTGAGGAGCAGCCTGTAGGG + Intronic
1146744398 17:35314674-35314696 CTGGTGAGGAGCAGTGGGGATGG + Intergenic
1148102960 17:45103874-45103896 ATGGTGAGGAGCAGACGGGGGGG + Exonic
1148729238 17:49821274-49821296 CTTTTGAGGAGCAGTCTTGTTGG + Intronic
1148883628 17:50754568-50754590 GTCTTGAGCAGCAGACTGGTCGG - Exonic
1150471170 17:65438723-65438745 CAGCTGAGGAGCAGATTGGCTGG - Intergenic
1151327039 17:73385920-73385942 GTGGAGAGAAGCAGACAGGTGGG + Intronic
1151822971 17:76507012-76507034 CTGGTGAGGAGCAGCCTGCTGGG - Intergenic
1151937909 17:77274567-77274589 CTGGTGAGGAGGAGACTCCTGGG + Intergenic
1152160915 17:78668150-78668172 CTGGTGAGTAGCAGAGTTGATGG - Intergenic
1154004146 18:10512494-10512516 TTGGTCAGGAGTAGACTGGCCGG - Intergenic
1155312405 18:24536703-24536725 CTGTTCAAGAGCAGCCTGGTTGG - Intergenic
1157727882 18:49978809-49978831 CTGGGGAGGAGCAGGGTGTTGGG + Intronic
1161033576 19:2071574-2071596 CTGGTGAGGAGTAGGGTGGCAGG + Exonic
1161635042 19:5382943-5382965 CTGGAGAGGAGAGGACAGGTGGG - Intergenic
1162730433 19:12715325-12715347 CTGGCGGGGAGCAGACACGTGGG + Intronic
1162873157 19:13600852-13600874 CTGGTGAGAAGCAGTGTGGCTGG - Intronic
1163002435 19:14376423-14376445 CCCGTGAGGACCAGACTGGAGGG - Intergenic
1164608289 19:29615615-29615637 ATGGGGAGGAACAGACTGGCAGG + Exonic
1164746695 19:30621683-30621705 TGGGTGAGGAGCAGCCGGGTGGG + Intronic
1166561802 19:43737577-43737599 CAGGTGAGGAGCTGAGGGGTTGG - Exonic
1167321061 19:48797334-48797356 CTGGTGGAGGGCAGTCTGGTTGG + Intronic
1168152016 19:54454461-54454483 CTGCTGAGGGGGAGCCTGGTAGG - Exonic
1168700929 19:58439264-58439286 CTAGTGGGCAGCAGACTGGAGGG - Intronic
926196080 2:10764444-10764466 CTGGGGAACAGCTGACTGGTGGG + Intronic
927244958 2:20950054-20950076 CAGGTGATGAGCAGCTTGGTGGG + Intergenic
928930857 2:36622421-36622443 CTGGTGAGGTTCAAACTGGTTGG + Intronic
929872131 2:45768040-45768062 CTGGTGAGAAGCAAAATTGTTGG + Intronic
929912108 2:46098928-46098950 GGGGTGAGGAGGAGAGTGGTAGG + Intronic
930839121 2:55826000-55826022 CTGGTGAAGAGCAGGCAGTTGGG - Intergenic
932323145 2:70836572-70836594 CTGGTGAGGAGCAGACTGGTGGG + Intergenic
933807199 2:86008253-86008275 GTGGTTGGGAGCAGAGTGGTTGG + Intergenic
934736497 2:96692293-96692315 CTGGTGAGGGGCCGACAGGCAGG - Intergenic
937517299 2:122669999-122670021 CAGGTGAGGAGCAGACTCAAAGG - Intergenic
937880216 2:126858974-126858996 GTGGTGAGGAGGGGGCTGGTGGG - Intergenic
938540787 2:132282094-132282116 CTGGTGAGGAGCTGCCTCTTGGG + Intergenic
938594708 2:132776393-132776415 CTGGCAAGGAGCTGACAGGTAGG - Intronic
939279482 2:140043510-140043532 GTGTTGGGGAGCAGACTAGTGGG - Intergenic
942673524 2:178402429-178402451 CTGATGAGGTCCTGACTGGTAGG + Intergenic
945141107 2:206686941-206686963 CTCCTGAGGAGCAGAGTGGATGG + Intronic
945322645 2:208443246-208443268 CTGGAGGGGAGCAGGCTGGTTGG + Intronic
945594129 2:211770701-211770723 CTAGTATGGAGCAGACTTGTTGG - Intronic
945647910 2:212523619-212523641 ATGATGAGGAGCAGATGGGTGGG + Intronic
946112639 2:217433598-217433620 CTACTGAGGAGCACACTGGAAGG - Intronic
948572342 2:238925466-238925488 CTGGTGAGGAGCGGCATGGAGGG + Intergenic
1169332731 20:4729563-4729585 CTGTTGAGGAACAGACTTCTTGG + Intergenic
1169335224 20:4750410-4750432 CTGGTGAGGAGCTGACATTTAGG - Intergenic
1170937829 20:20825069-20825091 CTGGTGGGGAGACGCCTGGTAGG + Intergenic
1171291421 20:23984986-23985008 CTGGGGAGGAACAGAGAGGTGGG - Intergenic
1171421334 20:25019828-25019850 CTGGGGAGGAGCTTACAGGTGGG + Intronic
1173926237 20:46783469-46783491 TTGGTGAGGGCCAGACTGCTTGG + Intergenic
1174086762 20:48014378-48014400 CTGGTGAGGAACAGGCTGAGCGG - Intergenic
1174154701 20:48508849-48508871 CTGGGGAGGAGAAGTCTTGTTGG - Intergenic
1174393364 20:50231723-50231745 CTGGTGGGGAGCAGACAGGTGGG + Intergenic
1174526086 20:51172637-51172659 CTGGTGAGGAGCTGGCTTGCAGG + Intergenic
1175073364 20:56353469-56353491 CTGCTGAGGGGCACAGTGGTGGG - Intergenic
1179000822 21:37456482-37456504 CGGGTGATGAGCAGGCTGTTTGG + Intronic
1180765978 22:18346107-18346129 CTGGGGAGGAACAGAGAGGTGGG + Intergenic
1180780335 22:18516271-18516293 CTGGGGAGGAACAGAGAGGTGGG - Intergenic
1180813051 22:18773592-18773614 CTGGGGAGGAACAGAGAGGTGGG - Intergenic
1180844462 22:18973619-18973641 CTGGTGAGGACAGGACGGGTGGG + Intergenic
1181199228 22:21207908-21207930 CTGGGGAGGAACAGAGAGGTGGG - Intergenic
1181400536 22:22647949-22647971 CTGGGGAGGAACAGAGAGGTGGG + Intergenic
1181702517 22:24629047-24629069 CTGGGGAGGAACAGAGAGGTGGG + Intergenic
1182903856 22:33920460-33920482 CGGGGCAGGAGCAGACTGGCCGG + Intronic
1183710944 22:39502704-39502726 TTGGTGAAGTGCAGACTGGCTGG + Intronic
1184460482 22:44635050-44635072 CTGGTGAGGGGCACAGTGCTGGG - Intergenic
1184983695 22:48114808-48114830 CTGATGAGGGGCTGACTGGGAGG - Intergenic
1185309100 22:50143670-50143692 CAGGTGAGGAGCAGACTGACTGG + Intronic
1203227597 22_KI270731v1_random:86998-87020 CTGGGGAGGAACAGAGAGGTGGG + Intergenic
949561267 3:5204968-5204990 GTGCTGAGGAGCAGTGTGGTTGG + Intronic
953493217 3:43366679-43366701 CTGGGAAGGAGCAGACAGGGTGG + Exonic
954136959 3:48586312-48586334 CTGGTAAGGAGTAGGCTGATGGG - Exonic
954790941 3:53132986-53133008 CTGTAGAGGAGGAGACTGCTTGG - Intergenic
954841374 3:53514746-53514768 CTGGTGAAGAGCTGGCTGGATGG + Intronic
957078110 3:75617584-75617606 CTGGTGTTGAGCAGACTTGAAGG - Intergenic
961073945 3:123964174-123964196 CCTGTGAGGACCAGACTGATAGG + Intergenic
964307726 3:155358607-155358629 GAAGTGAGGAGCAGGCTGGTGGG + Intergenic
965462447 3:168983758-168983780 ATTCTGAGGAACAGACTGGTTGG + Intergenic
965722530 3:171677546-171677568 CTGGTGAGTATCATAATGGTGGG - Exonic
966285180 3:178286963-178286985 CTTGTGATGGGCAGTCTGGTGGG + Intergenic
968647890 4:1749198-1749220 CAGGTGAGGAGGGGACAGGTGGG - Intergenic
969703175 4:8778870-8778892 GCAGTGAGGAGCAGACTGGAAGG + Intergenic
973385864 4:49513921-49513943 CTGGTGAGGAGCTGCCCGTTGGG - Intergenic
976015090 4:80542872-80542894 CAGGTGAGAAGCACTCTGGTGGG - Intronic
981158711 4:141471319-141471341 CTGGTGTGGAGAAGGCAGGTGGG + Intergenic
982497196 4:156107510-156107532 CTGGCGAGGAGCAGCCTGGGAGG + Intergenic
983023778 4:162710769-162710791 CTGGCGAGGAGCAGCCTGGGGGG - Intergenic
985222999 4:187727884-187727906 GTGGTGAAGAGAAGACCGGTGGG + Intergenic
986919674 5:12666583-12666605 CTGGCGAGAAGCAGCCTGGGAGG + Intergenic
990236876 5:53778248-53778270 CGGGTGAGGAGAGGACTGGGTGG - Intergenic
991471977 5:66978651-66978673 CTGGGGATGAGCAGAAGGGTAGG + Intronic
991480852 5:67077550-67077572 ATGGTGAGGAGCAAAGTGGATGG - Intronic
991622427 5:68558812-68558834 TTGGTAAGGAGAAAACTGGTGGG - Intergenic
993426390 5:87770256-87770278 CTGAGGAGGAGCAGGCTGCTTGG - Intergenic
996392175 5:122973521-122973543 CTGGGGAGGAGAAGGCTGGGTGG + Intronic
997690793 5:135826190-135826212 CTGGCAGGGAGCAGCCTGGTGGG - Intergenic
1002955236 6:1856150-1856172 CTGGTGAGGATCAAACTTGTCGG + Intronic
1004712235 6:18183179-18183201 CTACTGAGGAGCACACTGGAGGG - Intronic
1005242581 6:23849067-23849089 CAGGGGAGCAGCAGACTGGGAGG + Intergenic
1006628015 6:35411215-35411237 CAGGTGAGGAGAGGACTGGCAGG + Exonic
1006752393 6:36386988-36387010 CTGCTGAGGATCAGACTCCTGGG + Intronic
1008247965 6:49202561-49202583 TTGGTGAGGAGCAGAATTCTAGG + Intergenic
1008849333 6:56005739-56005761 CTGGAGAAGGGCAGAATGGTTGG + Intergenic
1011426463 6:87236943-87236965 CTTGTGGGGAGTATACTGGTAGG + Intronic
1013912014 6:115287289-115287311 CTGGTGAGGTGTAGACAGCTCGG - Intergenic
1015399542 6:132773359-132773381 CTGGTGAGAAGAAGCCAGGTTGG - Intronic
1016288919 6:142506570-142506592 CTGGTGATGAGCAGAGGAGTGGG + Intergenic
1018187581 6:161280299-161280321 TGGGTGAGAAGCAGACTGGAGGG - Intergenic
1018916029 6:168132920-168132942 CTGGTGATAAGACGACTGGTGGG + Intergenic
1019083717 6:169454895-169454917 CTGGTGAGGAGCCCACGGCTGGG - Intergenic
1020355531 7:7271406-7271428 CTGGTGCGGAGCAGCCCAGTGGG + Intergenic
1022383271 7:29880650-29880672 CTGGTGACAAGCAGACCAGTAGG - Intronic
1022497681 7:30863271-30863293 CTGGAGAGAAGCAGAGTGGTGGG + Intronic
1023758253 7:43440083-43440105 GTGGTTAGGAGCAGAGTGTTGGG + Intronic
1023875417 7:44283891-44283913 CTGGTGGGGCCCAGGCTGGTGGG - Intronic
1024220958 7:47286242-47286264 CTGATGAGGAGCAGTCTTGCTGG + Intronic
1026629765 7:72028111-72028133 ACGGTCAGGAGCAGCCTGGTGGG - Intronic
1029317006 7:99724561-99724583 CTGGTGAGGAGCAGCCTGGTGGG - Intronic
1033465453 7:141585050-141585072 ATGGGGAAGACCAGACTGGTAGG + Intronic
1034820566 7:154212829-154212851 ATGCTGAGGAGCACACAGGTGGG + Intronic
1034926265 7:155124889-155124911 CTGGTGATGAGGAGAGTGGGCGG + Intergenic
1035679682 8:1478740-1478762 ATACTGAGGAGCCGACTGGTGGG - Intergenic
1038650093 8:29394669-29394691 CTGGAGGGGAGCTGACTGGGGGG + Intergenic
1039395831 8:37224389-37224411 GTGGTGAGGGGCAGACGGGAGGG - Intergenic
1041760361 8:61359828-61359850 CAGATGAGTAGCAAACTGGTGGG + Intronic
1042560505 8:70069950-70069972 CTGGGGTGGAGGAGGCTGGTGGG - Intronic
1045101664 8:98850736-98850758 CTGGTGAGGAGCACAGGGGCCGG + Intronic
1045495027 8:102700845-102700867 CTGGGGAGGAGGAGCCTGGCTGG - Intergenic
1047806182 8:128362597-128362619 CTGATGAGGGGGAGAATGGTAGG - Intergenic
1047991321 8:130289553-130289575 CTGGGGAGGCGAAGACTGGAAGG + Intronic
1048503595 8:135000960-135000982 CTGCTGAGGAGGAGGCTGGTAGG + Intergenic
1049300428 8:141866761-141866783 CAGGTGAGCAGCAGGCTGGAGGG + Intergenic
1049302283 8:141877966-141877988 CTGGAGAGAAGGAGACTAGTGGG - Intergenic
1049381834 8:142320057-142320079 AGGGTGAGGAGGGGACTGGTGGG - Intronic
1051488865 9:17638495-17638517 ATGATGAGGTGAAGACTGGTTGG + Intronic
1052819665 9:33128817-33128839 CTGGGGAGAAGCAGACTCCTGGG - Intronic
1056301351 9:85245070-85245092 CTCGTGAGGAGGAGGCTGGAAGG - Intergenic
1057948592 9:99351815-99351837 CTGGAGAGGAACAGAAAGGTTGG + Intergenic
1058461639 9:105189283-105189305 CTAGTGATGAGCAGATCGGTGGG + Intergenic
1059995234 9:119902675-119902697 ATGGTGAGCAGCAGTTTGGTTGG + Intergenic
1060965395 9:127709691-127709713 TTGGTGAGGAGGGGACTGGCTGG + Exonic
1062158864 9:135068895-135068917 CTGGGGAGGAGCAGCCAGGGAGG + Intergenic
1062355048 9:136157991-136158013 CTGGGGAGGAGCAGAGTGTCTGG - Intergenic
1062583528 9:137238518-137238540 CTGGTGAGGTGGACACTGGCTGG - Intergenic
1062691423 9:137844019-137844041 CTGAGGAGGAGCAGTCTGGGAGG - Intronic
1062703309 9:137919497-137919519 GTGTGGAGGAGCGGACTGGTCGG - Intronic
1187984522 X:24796063-24796085 CTGGAGAGGAGGAGAGAGGTGGG - Intronic
1190726891 X:53195691-53195713 CTGGTTAGGATGAGATTGGTGGG - Intronic
1192265541 X:69535023-69535045 CGGGGGAAGATCAGACTGGTAGG - Intergenic
1194845937 X:98809237-98809259 TTGGTGAGAGGCAGAGTGGTAGG - Intergenic
1198267289 X:135021749-135021771 CTGGTGAGGAGGAGGGGGGTTGG + Exonic
1201769668 Y:17607600-17607622 CTGAGGAAGAGCAGACTGTTGGG + Intergenic
1201831886 Y:18298385-18298407 CTGAGGAAGAGCAGACTGTTGGG - Intergenic