ID: 932323163

View in Genome Browser
Species Human (GRCh38)
Location 2:70836745-70836767
Sequence TCTCACATGGTGCAGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 243}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932323163_932323167 -5 Left 932323163 2:70836745-70836767 CCTGCTTCCTGCACCATGTGAGA 0: 1
1: 0
2: 0
3: 12
4: 243
Right 932323167 2:70836763-70836785 TGAGATTTTCAAAAAAAGTAGGG 0: 1
1: 0
2: 3
3: 51
4: 537
932323163_932323169 18 Left 932323163 2:70836745-70836767 CCTGCTTCCTGCACCATGTGAGA 0: 1
1: 0
2: 0
3: 12
4: 243
Right 932323169 2:70836786-70836808 GCGCTCAGCAACCTCAGACTAGG 0: 1
1: 0
2: 0
3: 7
4: 81
932323163_932323166 -6 Left 932323163 2:70836745-70836767 CCTGCTTCCTGCACCATGTGAGA 0: 1
1: 0
2: 0
3: 12
4: 243
Right 932323166 2:70836762-70836784 GTGAGATTTTCAAAAAAAGTAGG 0: 1
1: 0
2: 3
3: 30
4: 349
932323163_932323168 -4 Left 932323163 2:70836745-70836767 CCTGCTTCCTGCACCATGTGAGA 0: 1
1: 0
2: 0
3: 12
4: 243
Right 932323168 2:70836764-70836786 GAGATTTTCAAAAAAAGTAGGGG 0: 1
1: 0
2: 4
3: 32
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932323163 Original CRISPR TCTCACATGGTGCAGGAAGC AGG (reversed) Intergenic
901254496 1:7810285-7810307 TGTGGCATGGTGCAGGAAACTGG + Intronic
901829338 1:11882558-11882580 TTTCACTTGTTGCAGTAAGCAGG + Intergenic
902096043 1:13946903-13946925 TCTTTCATGGTTCTGGAAGCCGG + Intergenic
904661971 1:32092059-32092081 ACTCACATCGGGCAGGCAGCAGG - Intronic
905734372 1:40315693-40315715 CCTCAGACAGTGCAGGAAGCTGG + Intronic
906654773 1:47539991-47540013 CCACACATGGTGCAGCAACCAGG + Intergenic
907456494 1:54579710-54579732 TCTCACAAGGTACTGGAAGGTGG - Intronic
909016691 1:70387722-70387744 TTTCTCACAGTGCAGGAAGCTGG - Intergenic
910260974 1:85293627-85293649 CCTCACATGGAGGAGAAAGCAGG - Intergenic
911841211 1:102684761-102684783 GCTCACATGGTGGAAGAAGCAGG - Intergenic
912595530 1:110872013-110872035 TGTCTCAGGGTGAAGGAAGCGGG + Intergenic
913683157 1:121206290-121206312 GCAAACATGGTGCAGGAGGCTGG - Intronic
914034999 1:143993915-143993937 GCAAACATGGTGCAGGAGGCTGG - Intergenic
914154455 1:145074056-145074078 GCAAACATGGTGCAGGAGGCTGG + Intronic
918402068 1:184173517-184173539 TCTGGCATGGTGGAGGAGGCAGG - Intergenic
918822276 1:189270274-189270296 TCTCACATGGGGAAAGAAACAGG + Intergenic
919485046 1:198135238-198135260 TTTCTCATGGTTCTGGAAGCTGG - Intergenic
920470467 1:206224800-206224822 GCAAACATGGTGCAGGAGGCTGG - Intronic
921771988 1:219051181-219051203 TGTCACATGGTGGAGTAAGTGGG - Intergenic
922819888 1:228476938-228476960 TTTCTCATGGTGCTGGAGGCTGG - Intergenic
924891968 1:248292884-248292906 TCTCTGATGGTGCATGAACCTGG + Intergenic
1063135459 10:3212916-3212938 TTTCACATGTTGCAGGACGCAGG + Intergenic
1063912750 10:10848922-10848944 TCTCACATGGTCCAGGTACCTGG + Intergenic
1064796740 10:19020531-19020553 CCTCACATGGTGGAGAAAGAGGG + Intergenic
1067060142 10:43074087-43074109 TCTCACATGCTACAGGAAGATGG + Intergenic
1067532570 10:47085336-47085358 TCTCACAGGGTGAAGGGGGCAGG - Intergenic
1067777215 10:49172386-49172408 TCTCACAAGCTGGAGGAAGTGGG + Intronic
1069372991 10:67766762-67766784 TCTCAGATGGAACAGGAAACAGG + Intergenic
1069716895 10:70526844-70526866 TCTTCCAGGATGCAGGAAGCAGG + Intronic
1069726724 10:70584948-70584970 TCTGACATGCTCCTGGAAGCTGG - Intergenic
1070680873 10:78448206-78448228 GCTCACATGGGTCAGGAACCTGG + Intergenic
1070754304 10:78982116-78982138 CCTCACATGCTGCAGGGAGGTGG + Intergenic
1071860232 10:89664828-89664850 CCTCACATGGTGGAAGGAGCAGG - Intergenic
1072502379 10:96030624-96030646 TTTCTCATGGTTCTGGAAGCTGG + Intronic
1072918408 10:99554978-99555000 TCTCACCTAGTCCAGGAATCAGG - Intergenic
1074585951 10:114768066-114768088 GCGGACATGGTGCAGGCAGCGGG + Intergenic
1075103009 10:119519216-119519238 TCTTACAAGGTGAGGGAAGCGGG - Intronic
1075922037 10:126221707-126221729 TGTCACAGGGGGCAAGAAGCAGG + Intronic
1076294079 10:129370543-129370565 TCTCACATAGTGCTGGGGGCAGG + Intergenic
1077013494 11:390211-390233 CCTGACATGGTGGAGGAAGGAGG - Intergenic
1077998928 11:7477177-7477199 TCTCACATGGTGGAGAGAGAGGG - Intergenic
1079301438 11:19282711-19282733 TCTCACGTGGTTCTGGAGGCTGG + Intergenic
1079310535 11:19361612-19361634 TCTCAGATGGCAGAGGAAGCTGG - Intronic
1079740354 11:24051044-24051066 TTTCACATGGTTCTGGAGGCTGG - Intergenic
1083476143 11:62916868-62916890 TCTCACCTGGGGCAGGTGGCAGG + Intronic
1084788397 11:71457601-71457623 TCTCTCACAGTTCAGGAAGCCGG + Intronic
1087249951 11:95887370-95887392 TTTCTCATGGTTCTGGAAGCTGG - Intronic
1087670336 11:101098973-101098995 TATCACATGGTATAGGAACCTGG + Intronic
1088506222 11:110530094-110530116 TCTCAGAGGGTCCAGGCAGCTGG + Intergenic
1089124560 11:116167698-116167720 ACTCACCTGGAGCAAGAAGCAGG + Intergenic
1090651486 11:128810444-128810466 CCTCACGGCGTGCAGGAAGCGGG + Exonic
1090722875 11:129492837-129492859 TCTCACTTGGTTCAGGGAGGGGG + Intergenic
1090908438 11:131097237-131097259 ACTCTGGTGGTGCAGGAAGCTGG + Intergenic
1091144820 11:133269314-133269336 TCTGACATTCTGCAGAAAGCAGG + Intronic
1096756419 12:53803452-53803474 TCTGACATGCTGCAGAAATCAGG - Intergenic
1099115604 12:78620538-78620560 TCCCACATCTTGCAGGAAGGGGG - Intergenic
1099975767 12:89544174-89544196 TAACACATGGTTCAGGAAGCTGG - Intergenic
1099988193 12:89693872-89693894 TTTTACATGGTTCAGGAAACTGG + Intronic
1101436889 12:104671789-104671811 TCTCACATTATGCAAGAAGAGGG - Intronic
1103187432 12:118971550-118971572 TCTCACCTGTTGTATGAAGCTGG - Intergenic
1104340694 12:127945869-127945891 TCTCTCACAGTACAGGAAGCCGG - Intergenic
1105227209 13:18447256-18447278 TCACACAGGGGTCAGGAAGCAGG + Intergenic
1105775145 13:23653080-23653102 TAGCACAGGGGGCAGGAAGCTGG - Intronic
1107146258 13:37063533-37063555 TCTCATATGATAAAGGAAGCGGG + Intergenic
1107185885 13:37519573-37519595 TTTCAGATGGGGCATGAAGCTGG - Intergenic
1107210067 13:37842635-37842657 TCCCACATGGTGAAAGGAGCAGG + Intronic
1108551478 13:51549788-51549810 TTTCTCATGGTTCTGGAAGCTGG - Intergenic
1109342081 13:61075241-61075263 TCTCACATGGTGGAAGCAGGAGG - Intergenic
1110622724 13:77616832-77616854 TCCCAGATGGTACTGGAAGCAGG + Intronic
1111184465 13:84713758-84713780 TTTCACATGGTTCTGGAGGCTGG - Intergenic
1112326160 13:98443988-98444010 TCTCCCACAGTGCGGGAAGCCGG + Intronic
1112376433 13:98846053-98846075 TCACTCATGTTGCAGGAACCAGG - Intronic
1113283426 13:108816656-108816678 AATTACATGATGCAGGAAGCTGG - Intronic
1113593956 13:111518319-111518341 TACCACAGGGAGCAGGAAGCCGG - Intergenic
1114161879 14:20177477-20177499 AATTACATGATGCAGGAAGCTGG + Intergenic
1114267721 14:21082462-21082484 ACTCACGTGGCGAAGGAAGCAGG - Exonic
1115475822 14:33811966-33811988 GCTCTCATGGTGCAGGAGGGAGG - Intergenic
1115832507 14:37357987-37358009 CCTCTCAGGGGGCAGGAAGCTGG - Intronic
1116214287 14:41991322-41991344 TTTCTCATGGTTCTGGAAGCTGG + Intergenic
1117268949 14:54121485-54121507 ACTGACATGGTGCAGAGAGCAGG - Intergenic
1119183402 14:72619360-72619382 TCTCATTTCTTGCAGGAAGCTGG - Intronic
1119674862 14:76546165-76546187 TCCCACATAGAGTAGGAAGCTGG + Intergenic
1120768184 14:88350831-88350853 TATTACATGGTGCAGGGAGTAGG - Intergenic
1123880797 15:24676242-24676264 GCTCACGTGGTGAAGGCAGCAGG - Exonic
1125032787 15:35089343-35089365 TCTCACATGTGACAAGAAGCTGG - Intergenic
1128303795 15:66584555-66584577 TTTCACATGGTTCTGGAGGCTGG - Intronic
1128691409 15:69727142-69727164 TCTCACGTGTTGCCAGAAGCTGG + Intergenic
1128780559 15:70356218-70356240 TCACGCAGGGTGAAGGAAGCTGG + Intergenic
1130312845 15:82770216-82770238 TCTCACATCCTCCAGGAGGCTGG - Intronic
1133403519 16:5505704-5505726 TCTTACATTGTCCAGGAAGCGGG + Intergenic
1133963969 16:10518099-10518121 TCACACATGGGGCAGGGAGGCGG + Intergenic
1134039064 16:11053978-11054000 TCCCACCTGGAGCAGGAAGTGGG + Intronic
1134572568 16:15303856-15303878 TCTCACATGACGGAGGAAGTGGG - Intergenic
1134729814 16:16452166-16452188 TCTCACATGACGGAGGAAGTGGG + Intergenic
1134937617 16:18259730-18259752 TCTCACATGACGGAGGAAGTGGG - Intergenic
1135485642 16:22862491-22862513 GCTCACATGCTGCAGGAGCCGGG - Intronic
1135659711 16:24285344-24285366 TCTCACTAGGTGCAGTAAACGGG - Intronic
1137595158 16:49718738-49718760 CCTCACATGGTGGAAGGAGCTGG + Intronic
1138564947 16:57826172-57826194 ACTCCCATGGTGGGGGAAGCGGG - Intronic
1139336441 16:66235032-66235054 CCTCACATGGTGAAGGGAGAAGG - Intergenic
1140231106 16:73117933-73117955 TTTCACATGGTTCTGGAGGCTGG - Intergenic
1140835998 16:78794283-78794305 TTTCTCATGGTTCTGGAAGCTGG - Intronic
1141674562 16:85510770-85510792 GGGCACATGGTGCAGGGAGCAGG - Intergenic
1141700536 16:85640134-85640156 CCACCCATGGTGCAGGGAGCTGG + Intronic
1142667264 17:1470262-1470284 GCGCACATGGTCCAGGAAGAAGG + Exonic
1144037499 17:11380832-11380854 ACTCACATGGTGCTGGATGTTGG + Intronic
1144203475 17:12962299-12962321 TTTGAAATGATGCAGGAAGCTGG + Intronic
1144243988 17:13345238-13345260 TCTCTCATGGTTCTGGAGGCTGG + Intergenic
1144599604 17:16600497-16600519 TCACAAAGAGTGCAGGAAGCAGG + Intergenic
1148226409 17:45900757-45900779 TCTCACAGTGAGCAGGGAGCTGG - Intronic
1151171077 17:72246823-72246845 TCTCACAAGGTGTTGGCAGCTGG + Intergenic
1151870616 17:76834082-76834104 TGTCTCATGGTGCTGGAGGCTGG - Intergenic
1152290802 17:79438928-79438950 CCATACATGGGGCAGGAAGCTGG + Intronic
1153485351 18:5592610-5592632 GCTCACATGGTGTAAGTAGCTGG - Intronic
1154526169 18:15292219-15292241 TCACACAGGGGTCAGGAAGCAGG - Intergenic
1155142055 18:23052606-23052628 TCTCAGAGGGGGCAGGAAGGAGG - Intergenic
1156856884 18:41792367-41792389 TAGCACATGGAGCAGGAAGTGGG - Intergenic
1158013324 18:52754485-52754507 CCTCACATGGTGAAAGGAGCAGG - Intronic
1159516313 18:69463076-69463098 TTTCTCATGGTGCTGGAGGCTGG + Intronic
1161544000 19:4868734-4868756 TCTCAGATGGTCCAGGGAGGAGG + Intergenic
1163080000 19:14932236-14932258 GCTCAAATGTTCCAGGAAGCAGG + Intergenic
1163127810 19:15253765-15253787 TCTCCACTGGTGCAGAAAGCTGG + Intronic
1163413169 19:17169578-17169600 TCTCTTATGGTTCTGGAAGCTGG + Intronic
1167149996 19:47702797-47702819 TCTCAGATGGTGGAGGGTGCTGG + Exonic
925922968 2:8650399-8650421 TGTCACATGGGACAGGAAGGAGG - Intergenic
926364071 2:12116723-12116745 TCTTACATGTTGCAGGGAGCTGG + Intergenic
927242091 2:20928270-20928292 TCTCACATGATGCAAGAGGATGG + Intergenic
928702480 2:33912986-33913008 TCTCACATGGTGCACTCAGGAGG + Intergenic
929815844 2:45230785-45230807 TCTCTCATGGTTCTGGAGGCTGG + Intergenic
929965314 2:46530206-46530228 TCTCACATGCTGTAGGGACCAGG - Intronic
932080433 2:68709521-68709543 GCTCACATTTGGCAGGAAGCTGG + Intronic
932323163 2:70836745-70836767 TCTCACATGGTGCAGGAAGCAGG - Intergenic
933402994 2:81822358-81822380 TCTCACATAGTTCTGGAGGCTGG - Intergenic
934550867 2:95260789-95260811 CCTCCCATCATGCAGGAAGCAGG - Intergenic
935529132 2:104211456-104211478 TGTCACATGGTGGAAGAAGGAGG + Intergenic
936281444 2:111143667-111143689 TCCCACATGGTGCAAGATGCTGG + Intronic
937157150 2:119729225-119729247 TCTTAGATGGGGAAGGAAGCAGG - Intergenic
937171654 2:119877762-119877784 ATTTACATGGTTCAGGAAGCTGG - Intronic
937983243 2:127627102-127627124 TCTGACAGGGGGCAGGGAGCAGG + Intronic
938407459 2:131040424-131040446 GCTCACATGCTCCAGGAAGCAGG - Exonic
938525272 2:132123584-132123606 TCACACAGGGGTCAGGAAGCAGG - Intergenic
938744377 2:134263057-134263079 TCTGGCATGGTACAGCAAGCAGG + Intronic
940352062 2:152701889-152701911 TCTCACATGCTGCAGCAACCAGG + Intronic
940385205 2:153063636-153063658 TCTCACATGGTGGAAGAGGCAGG - Intergenic
943817843 2:192278439-192278461 TCTTACATGGTGGAAGAAGGAGG + Intergenic
944300386 2:198117618-198117640 CCACACATGTTGCAGGAAACAGG + Intronic
944483186 2:200178175-200178197 TGGCATATGGTGCAGGGAGCTGG - Intergenic
946499435 2:220230498-220230520 TTTCTCATGGTTCTGGAAGCTGG - Intergenic
948801391 2:240435192-240435214 GCTGCCAGGGTGCAGGAAGCCGG + Intergenic
948943850 2:241209668-241209690 CCCCACATGGTGCAGGAGGATGG - Intronic
1170366676 20:15605828-15605850 TCTGACATGGTGTAAGAAGTAGG - Intronic
1170467815 20:16638895-16638917 TCTCCCCAGGTGCATGAAGCCGG - Intergenic
1170582767 20:17711502-17711524 CCTGACCTGGTGAAGGAAGCAGG + Intronic
1171139507 20:22728882-22728904 TCTCACACACTGTAGGAAGCTGG + Intergenic
1171277200 20:23867470-23867492 GCTCACATGGTGCTGGGTGCTGG - Intergenic
1171483517 20:25470237-25470259 TAACACCTGGTGCAGGAAGAGGG - Intronic
1173513194 20:43646407-43646429 TCTAGCATGGTGCTGGAGGCTGG + Intronic
1173654560 20:44690686-44690708 TGTCTCATGGTGGAGGAGGCTGG + Intergenic
1173690096 20:44954000-44954022 TTTCACATGGTGCTGCAGGCAGG - Intronic
1176519041 21:7811397-7811419 TCTCTCATGGTTCTGGAGGCTGG - Intergenic
1176771253 21:13076270-13076292 TCACACAGGGGTCAGGAAGCAGG + Intergenic
1177702428 21:24655848-24655870 TCTGACTTGGTGGTGGAAGCTGG - Intergenic
1178303964 21:31474925-31474947 TTTCACCGGCTGCAGGAAGCTGG - Intronic
1178609030 21:34064386-34064408 TCTCACAAGGTGGAGGAACAAGG + Intergenic
1178653069 21:34441410-34441432 TCTCTCATGGTTCTGGAGGCTGG - Intergenic
1179112700 21:38461142-38461164 TCTCTCATGGCTCTGGAAGCTGG + Intronic
1181011451 22:20043229-20043251 TCTCAGAGAGGGCAGGAAGCCGG - Intronic
1181363846 22:22358482-22358504 TGTCCCAAGTTGCAGGAAGCAGG - Intergenic
1182967647 22:34536967-34536989 GCTACCATGGAGCAGGAAGCAGG + Intergenic
1183602649 22:38849059-38849081 GCTCACAGTGTGCAGGCAGCAGG - Intergenic
949303273 3:2609305-2609327 CCTCACATGGTGAAGGCAGAAGG - Intronic
949875458 3:8623543-8623565 GCTCACCTGCTGCAGGACGCGGG + Exonic
953229618 3:41053075-41053097 TGTCACCTGCTGCTGGAAGCAGG + Intergenic
955156472 3:56421742-56421764 TGTCACATGGAGCGGGAATCGGG - Intronic
956171065 3:66433588-66433610 TTTCAGTTGGGGCAGGAAGCAGG - Intronic
956892897 3:73629761-73629783 ACTTACATGGAGCAGGAAGAGGG - Intergenic
957432707 3:80133341-80133363 TCTCACATGGTGGAAAGAGCTGG + Intergenic
959452674 3:106523033-106523055 TCTCAAATGGTGTAGACAGCAGG - Intergenic
962145005 3:132831694-132831716 TCTAACATGAGGCAGCAAGCAGG - Intergenic
964939244 3:162134685-162134707 TCTGACACAGGGCAGGAAGCCGG + Intergenic
967386121 3:188912724-188912746 TCTCACATGGTGGGGGCAGGAGG + Intergenic
967853948 3:194102331-194102353 TCTCAGATGGTGCTGGACGAGGG + Intergenic
967980027 3:195060161-195060183 TCTCACCTGGGGCACGCAGCAGG + Intergenic
968426749 4:528782-528804 AATTACATGCTGCAGGAAGCAGG - Intronic
969433847 4:7172657-7172679 TCTCTCATAGTTCAGGAGGCTGG + Intergenic
971734459 4:30428297-30428319 ACTCACATGATGAAGGAGGCTGG - Intergenic
976050080 4:81001362-81001384 TCTCTCATGGTTCTGGAGGCTGG + Intergenic
977345069 4:95807346-95807368 TCTCCCTTGGAGCAGGATGCTGG - Intergenic
977823329 4:101501829-101501851 CCTCACATGGTGGAGGGAGAGGG + Intronic
980341868 4:131561105-131561127 GCTCACAGGGTGCAGAAAGGAGG + Intergenic
980797305 4:137701079-137701101 TCTCCCATTGTTCAGCAAGCAGG - Intergenic
981211411 4:142110328-142110350 TTTCTCATAGTTCAGGAAGCTGG - Intronic
984438796 4:179739119-179739141 TCCCACATGGCGCAGAAAGATGG - Intergenic
986459115 5:7951919-7951941 TCTCACATGGTTCTGGAGGCTGG - Intergenic
986587751 5:9336239-9336261 TCTCACATGGTCCAGGCATGTGG - Intronic
987008154 5:13732337-13732359 TCTCACATAGTGCAGGAGCTGGG + Intronic
987101772 5:14597413-14597435 TATCACATGCTGCAGTATGCAGG + Intronic
988784965 5:34558170-34558192 TCTCAGGTGGAGCAGGAACCTGG - Intergenic
988976870 5:36524570-36524592 TCTCAGATGCTCCAGGAAGTTGG - Intergenic
989055466 5:37362052-37362074 TTTCTCATGGTTCTGGAAGCTGG - Intronic
989352199 5:40499353-40499375 TCTCACTTGGAGCATGAAACTGG - Intergenic
990703497 5:58500728-58500750 CCTCACATGGTGCTGGGAGGTGG - Intergenic
992389902 5:76321067-76321089 TTTCCCATGGTGCAGAAAGGAGG + Intronic
992778130 5:80105784-80105806 TCTCAGAGGGTGCAGGAAATTGG - Intergenic
993593309 5:89823042-89823064 TTTCCCATGGTTCTGGAAGCTGG - Intergenic
993860800 5:93134471-93134493 CTTCACTTGGTGCAGGCAGCTGG + Intergenic
994142192 5:96354160-96354182 TCTCACTTGGTTCAGGAGACTGG - Intergenic
996415286 5:123203950-123203972 TCTTACATGGAAAAGGAAGCTGG - Intergenic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
1000086261 5:157889963-157889985 TTTCACCTGGTGGAGGAAGAGGG + Intergenic
1001030976 5:168262563-168262585 TCTCGCCTGGTCCAGGACGCGGG - Exonic
1002002553 5:176206265-176206287 TCTCACATGGTGAAAGCAGAAGG + Intergenic
1002820447 6:719764-719786 TTTCTAATGGTGCAGGAAGAAGG - Intergenic
1005003227 6:21263673-21263695 TCTCCCTTGGTGCAGGGCGCAGG - Intergenic
1006350023 6:33514180-33514202 TCTCTCATGGTTCTGGAGGCTGG - Intergenic
1012058952 6:94452756-94452778 TCTTACATGGTGGAAGAAGAAGG - Intergenic
1013910974 6:115275585-115275607 TCTCACAAGGTTAAGGAAGTGGG + Intergenic
1016955458 6:149622427-149622449 TCTCAAATGGTTCAGGAAAAGGG + Intronic
1017371179 6:153710972-153710994 TCTCACATGGTGGAAGCAGGAGG + Intergenic
1017841586 6:158226841-158226863 TTTCACCTGGTGCCGGACGCTGG + Intergenic
1018262767 6:161986756-161986778 TCTCACTTGGTCCAGGGAGTGGG - Intronic
1018442506 6:163826051-163826073 TCTCCCATGGTGCATGGAACAGG + Intergenic
1018442776 6:163828369-163828391 TCTCCCATGGTGCATGGAACGGG + Intergenic
1019552582 7:1610550-1610572 TCATGAATGGTGCAGGAAGCAGG - Intergenic
1024598615 7:50960930-50960952 TCTCTCATGGTCCTGGAGGCTGG + Intergenic
1026028507 7:66767795-66767817 TTTCTCACAGTGCAGGAAGCTGG - Intronic
1029905405 7:104088114-104088136 TCTCTGATGGTGTAGGAAGGTGG - Intergenic
1030982359 7:116201069-116201091 TATCTCATGGCTCAGGAAGCTGG - Intergenic
1031642123 7:124178235-124178257 TCTCTCATGGTTCTGGAGGCTGG + Intergenic
1032449485 7:132017704-132017726 CCTCCCATGGTTCAGAAAGCCGG - Intergenic
1033004396 7:137545894-137545916 ACTCACATGGTGAAGGAGCCGGG + Intronic
1039758561 8:40549210-40549232 TCTCTCATGGTTCTGGAGGCTGG - Intronic
1041219631 8:55636069-55636091 TCTCTCATGGTTCTGGAGGCTGG - Intergenic
1041650061 8:60293552-60293574 TCTTACATGCTGCATGCAGCAGG - Intergenic
1047177140 8:122552743-122552765 TCTCACATTGTGCAATAATCTGG + Intergenic
1048008022 8:130434821-130434843 TATCACATGAGACAGGAAGCAGG + Intronic
1048117947 8:131546043-131546065 TCTTTCATGATGAAGGAAGCTGG - Intergenic
1048922672 8:139245456-139245478 TGTCACATGGTGAAGGCAGGAGG + Intergenic
1052375342 9:27712622-27712644 TATCTCATGGTGCAGAAAGACGG + Intergenic
1056576263 9:87857947-87857969 TCCCAGATGGTGCAGGGACCAGG + Intergenic
1056744717 9:89290423-89290445 TTTCTCATGCTGCTGGAAGCTGG + Intergenic
1057313728 9:93956376-93956398 TCCAACATGGTGGAGGAAGTTGG + Intergenic
1057754613 9:97822187-97822209 TTTCTCATGGTGCTGGAGGCTGG + Intergenic
1058109575 9:101017708-101017730 CCTCACATGGTGAAGGCAGAAGG + Intergenic
1061084375 9:128390587-128390609 TCCCACCTCCTGCAGGAAGCAGG + Exonic
1062146598 9:134992815-134992837 TCACACATGGAGTAGGAGGCAGG + Intergenic
1185853510 X:3510847-3510869 TCTCCCATGGTCCTGGAGGCTGG - Intergenic
1185942246 X:4334644-4334666 TCTCCCATGGTCCTGGAGGCTGG - Intergenic
1186578933 X:10796225-10796247 TTTGACATTGTACAGGAAGCTGG + Intronic
1188391785 X:29630157-29630179 CCTCACATGGTGAAGGGAGAAGG + Intronic
1188694963 X:33178888-33178910 GGTCACATGATGCAGGCAGCTGG + Intronic
1191768031 X:64722148-64722170 GCTACCATGGAGCAGGAAGCAGG + Intergenic
1194583878 X:95709597-95709619 TTTCTCATGGTTCTGGAAGCAGG - Intergenic
1195338327 X:103878893-103878915 TGTCACATGGGGCTGGAAGGAGG - Intergenic
1197839280 X:130728200-130728222 TTGCACATGCTGCAGGAACCTGG - Intronic
1199684791 X:150256391-150256413 CCCCACCTGGGGCAGGAAGCAGG + Intergenic