ID: 932329670

View in Genome Browser
Species Human (GRCh38)
Location 2:70890913-70890935
Sequence GTCTCTAGGAGCCACTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932329670_932329676 11 Left 932329670 2:70890913-70890935 CCAGGCCAGTGGCTCCTAGAGAC No data
Right 932329676 2:70890947-70890969 GTAACCCCTCCTATTCACCATGG No data
932329670_932329680 19 Left 932329670 2:70890913-70890935 CCAGGCCAGTGGCTCCTAGAGAC No data
Right 932329680 2:70890955-70890977 TCCTATTCACCATGGACAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932329670 Original CRISPR GTCTCTAGGAGCCACTGGCC TGG (reversed) Intergenic
No off target data available for this crispr