ID: 932330094

View in Genome Browser
Species Human (GRCh38)
Location 2:70893921-70893943
Sequence AAGAAGAGGGAGATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932330086_932330094 16 Left 932330086 2:70893882-70893904 CCTGGAGAAGGCAGAAAAGAAGA No data
Right 932330094 2:70893921-70893943 AAGAAGAGGGAGATGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932330094 Original CRISPR AAGAAGAGGGAGATGGAGGA AGG Intergenic
No off target data available for this crispr