ID: 932332350

View in Genome Browser
Species Human (GRCh38)
Location 2:70904911-70904933
Sequence CACAATGGCGTGCAGCCGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 71}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932332345_932332350 2 Left 932332345 2:70904886-70904908 CCCAAGTCCGAACTCGTACACAC 0: 1
1: 0
2: 0
3: 1
4: 34
Right 932332350 2:70904911-70904933 CACAATGGCGTGCAGCCGCCGGG 0: 1
1: 0
2: 0
3: 2
4: 71
932332343_932332350 18 Left 932332343 2:70904870-70904892 CCACGCTCCGGAAACACCCAAGT 0: 1
1: 0
2: 0
3: 1
4: 49
Right 932332350 2:70904911-70904933 CACAATGGCGTGCAGCCGCCGGG 0: 1
1: 0
2: 0
3: 2
4: 71
932332344_932332350 11 Left 932332344 2:70904877-70904899 CCGGAAACACCCAAGTCCGAACT 0: 1
1: 0
2: 0
3: 6
4: 74
Right 932332350 2:70904911-70904933 CACAATGGCGTGCAGCCGCCGGG 0: 1
1: 0
2: 0
3: 2
4: 71
932332346_932332350 1 Left 932332346 2:70904887-70904909 CCAAGTCCGAACTCGTACACACA 0: 1
1: 0
2: 0
3: 0
4: 53
Right 932332350 2:70904911-70904933 CACAATGGCGTGCAGCCGCCGGG 0: 1
1: 0
2: 0
3: 2
4: 71
932332347_932332350 -5 Left 932332347 2:70904893-70904915 CCGAACTCGTACACACAGCACAA 0: 1
1: 0
2: 0
3: 7
4: 114
Right 932332350 2:70904911-70904933 CACAATGGCGTGCAGCCGCCGGG 0: 1
1: 0
2: 0
3: 2
4: 71
932332342_932332350 19 Left 932332342 2:70904869-70904891 CCCACGCTCCGGAAACACCCAAG 0: 1
1: 0
2: 0
3: 5
4: 51
Right 932332350 2:70904911-70904933 CACAATGGCGTGCAGCCGCCGGG 0: 1
1: 0
2: 0
3: 2
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932332350 Original CRISPR CACAATGGCGTGCAGCCGCC GGG Intronic
901088316 1:6625379-6625401 CCCAAAGGCGTGCGGCCGCTGGG + Intronic
904813865 1:33181414-33181436 CGCCATGGCGTGCAGCCTCAAGG - Exonic
920855705 1:209659425-209659447 GAGAATGGCGTGCATCCGCGAGG + Intergenic
923508825 1:234631358-234631380 CACAATGGCGTGAACCCGGGAGG + Intergenic
1064034024 10:11900997-11901019 CACAGTAGCAGGCAGCCGCCCGG + Intergenic
1068906878 10:62336628-62336650 GACAATGGGGTGGAGCCACCAGG + Intergenic
1075738578 10:124679391-124679413 CACAAGGCCGTGCACTCGCCAGG + Intronic
1085658596 11:78340897-78340919 CACAATGGTGATCAGCCGCATGG + Intronic
1090920845 11:131204713-131204735 CACAATGGTGTGGAGCTTCCCGG + Intergenic
1092996899 12:13959315-13959337 CACAAAGGCAGGCAGCCGCCAGG + Intronic
1096771617 12:53939200-53939222 CACACTGGCGCGCCGCCTCCGGG - Exonic
1106048939 13:26172631-26172653 GACAATGGCGTGAACCCGGCAGG - Intronic
1113483913 13:110640961-110640983 CAAGATGGCCTGCAGCTGCCAGG + Intergenic
1115645891 14:35368201-35368223 CCCAATGGAGTGCAGGGGCCCGG - Intergenic
1116102805 14:40464098-40464120 CAGAATGGGGTGGAGCCACCGGG + Intergenic
1119401760 14:74367546-74367568 CAGAATGGCGTGAATCCGGCAGG - Intergenic
1122661399 14:103297924-103297946 GAGAATGGCGTGAACCCGCCAGG + Intergenic
1123917895 15:25050670-25050692 CACGATGGTCTGCAGCCTCCAGG - Intergenic
1131238369 15:90716993-90717015 GAGAATGGGGTGCAGACGCCTGG + Intergenic
1137021440 16:35432247-35432269 CACAAGAGGGTGCTGCCGCCTGG + Intergenic
1141409231 16:83821220-83821242 CTCAGTGGAGTTCAGCCGCCTGG - Intergenic
1142033588 16:87850497-87850519 CACCAGAGCGTGCATCCGCCGGG + Intronic
1146719835 17:35116300-35116322 CACAATGGCCTCCCGCCTCCAGG + Intronic
1147150328 17:38510444-38510466 CACTCTGGCGCGCCGCCGCCTGG + Exonic
1155692202 18:28638713-28638735 GAGAATGGCGTGAACCCGCCAGG - Intergenic
1161087906 19:2343614-2343636 CTCACGGGAGTGCAGCCGCCTGG - Intronic
1165934120 19:39378812-39378834 CAGAATGGCGTGAACCCGGCAGG + Intronic
1167201148 19:48066428-48066450 CACCATGCCATGCAGCTGCCGGG - Intronic
1168668261 19:58220736-58220758 CAGAATGGCGTGAACCCGGCAGG + Intergenic
926142192 2:10374352-10374374 CACAGTGGTGTGCAGCCTTCTGG + Intronic
926235633 2:11041313-11041335 CACCATGGCAAGCAGCAGCCTGG + Intergenic
928986979 2:37191463-37191485 CACAATGGAAAGCAGCAGCCAGG - Intronic
929114502 2:38432900-38432922 CCCAAGGGCCTGCACCCGCCTGG - Intergenic
930710048 2:54542546-54542568 CACAATGGCCTTGAGCCCCCTGG - Intronic
931444028 2:62311562-62311584 CACAATGGCGTGAACCCGAGAGG + Intergenic
932332350 2:70904911-70904933 CACAATGGCGTGCAGCCGCCGGG + Intronic
935011974 2:99144108-99144130 GAGAATGGCGTGAAGCCGCGAGG - Intronic
944665810 2:201958294-201958316 CACAATGGCGTGAACCCGGGAGG - Intergenic
947953870 2:234171073-234171095 CAGAAAGGCGGGCAGTCGCCTGG + Intergenic
1173199856 20:40946352-40946374 CAGGATGGCGTGGAGGCGCCTGG - Intergenic
1175215299 20:57389338-57389360 CACAAAGGGGTGCGGCCGCTCGG - Intergenic
1179949609 21:44702385-44702407 CACAAGGGCGTGCAGGAGCTGGG - Intronic
953317601 3:41943121-41943143 CAGAATGGCGTGAACCCGGCAGG + Intronic
958863035 3:99467754-99467776 CACAATGTCATGCTGCCTCCAGG - Intergenic
959780616 3:110228359-110228381 CACAATGCTGGGCAGCCCCCAGG + Intergenic
961467064 3:127088584-127088606 CACCCTGCCATGCAGCCGCCTGG + Intergenic
961487627 3:127227723-127227745 CACAGTGGCCTGCAGGCTCCTGG - Intergenic
961981846 3:131087744-131087766 GGCAATGACGTGCAGCCACCAGG + Intronic
966050802 3:175616676-175616698 CACAAGGGAGTGCAGCCTGCTGG - Intronic
978125113 4:105125908-105125930 CACAATGGTGTGCAGTGGCATGG + Intergenic
978703290 4:111675015-111675037 GAGAATGGCGTGAACCCGCCAGG + Intergenic
980012059 4:127607656-127607678 GACAATGGCGTGAACCCGCGAGG - Intergenic
983441355 4:167790794-167790816 GACAATGGCGTGAACCCGGCAGG - Intergenic
985936764 5:3103294-3103316 GACCGTGGCATGCAGCCGCCGGG - Intergenic
986300501 5:6474887-6474909 CACAATGCCATGCAGCTGTCAGG - Intronic
1006669758 6:35722654-35722676 CACACAGGCGTGAAGCAGCCCGG - Intronic
1006719071 6:36138501-36138523 CACAAAGGCCTGCAGCCCACTGG - Intronic
1013666556 6:112355544-112355566 CAGAATGGCGTGCACCCGGGAGG - Intergenic
1014996600 6:128153330-128153352 CACAATGTGCTGCAGCCGCTGGG + Intronic
1018792860 6:167162712-167162734 CACTATGGCGTGCGCCCGGCAGG + Intronic
1023802877 7:43850158-43850180 CACAAAGGTTTGCAGCCTCCAGG + Intergenic
1025190914 7:56895174-56895196 CACAATGGGCTGCAGCCTCAAGG - Intergenic
1025681029 7:63681755-63681777 CACAATGGGCTGCAGCCTCAAGG + Intergenic
1026987722 7:74565146-74565168 ACCAATGGCGTTCAGCCCCCAGG - Intronic
1039990588 8:42484638-42484660 CAGAATGGGGTGCAGCCCCATGG + Intronic
1041351064 8:56948004-56948026 CACAATGGCCTGCAGCACCTGGG - Intergenic
1045702887 8:104887024-104887046 CACAAAGGCATGCAGAGGCCGGG - Intronic
1053285733 9:36848512-36848534 GACAGTGGGCTGCAGCCGCCCGG + Intronic
1055132766 9:72794182-72794204 CTCAATGGGGTGGAGCCCCCAGG + Intronic
1060587368 9:124795016-124795038 CACCATGGACTGCAGCTGCCCGG - Exonic
1062052546 9:134455087-134455109 CAGAATGGTGTGCACCAGCCAGG - Intergenic
1195538297 X:106033909-106033931 CACTATGGCCTGCTGCCGCCAGG + Intronic
1197275689 X:124476247-124476269 CACAATAGCATGCAGATGCCAGG + Intronic
1201063682 Y:10069774-10069796 CACACTGGAGGCCAGCCGCCAGG + Intergenic