ID: 932332511

View in Genome Browser
Species Human (GRCh38)
Location 2:70905747-70905769
Sequence ATCCTTTGGAAGCCCGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 71}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932332499_932332511 19 Left 932332499 2:70905705-70905727 CCCCAGGTAGCTTCTGGGGAGTC 0: 1
1: 0
2: 0
3: 13
4: 144
Right 932332511 2:70905747-70905769 ATCCTTTGGAAGCCCGGACAAGG 0: 1
1: 0
2: 0
3: 6
4: 71
932332507_932332511 -3 Left 932332507 2:70905727-70905749 CCGAGGGGCAAGGAGGCCAAATC 0: 1
1: 0
2: 1
3: 15
4: 171
Right 932332511 2:70905747-70905769 ATCCTTTGGAAGCCCGGACAAGG 0: 1
1: 0
2: 0
3: 6
4: 71
932332500_932332511 18 Left 932332500 2:70905706-70905728 CCCAGGTAGCTTCTGGGGAGTCC 0: 1
1: 0
2: 0
3: 17
4: 139
Right 932332511 2:70905747-70905769 ATCCTTTGGAAGCCCGGACAAGG 0: 1
1: 0
2: 0
3: 6
4: 71
932332501_932332511 17 Left 932332501 2:70905707-70905729 CCAGGTAGCTTCTGGGGAGTCCG 0: 1
1: 0
2: 1
3: 6
4: 106
Right 932332511 2:70905747-70905769 ATCCTTTGGAAGCCCGGACAAGG 0: 1
1: 0
2: 0
3: 6
4: 71
932332498_932332511 20 Left 932332498 2:70905704-70905726 CCCCCAGGTAGCTTCTGGGGAGT 0: 1
1: 0
2: 3
3: 18
4: 156
Right 932332511 2:70905747-70905769 ATCCTTTGGAAGCCCGGACAAGG 0: 1
1: 0
2: 0
3: 6
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932332511 Original CRISPR ATCCTTTGGAAGCCCGGACA AGG Intronic
902184725 1:14716777-14716799 ATCCTCTGCAATCCCAGACATGG + Intronic
908790964 1:67780926-67780948 CTCCTTTGGCTGCCTGGACATGG + Intronic
915637433 1:157196247-157196269 AGCCATGGGAAGCCCAGACAAGG - Intergenic
917052871 1:170943600-170943622 ATCCTTTGGAAATCCAGAGAGGG + Intronic
919774234 1:201183828-201183850 GTCCTTGGGAAGCCCAGCCATGG - Intergenic
920674931 1:208032049-208032071 ACCCATGGGAAGCCCGGACCCGG - Intronic
920675084 1:208032987-208033009 ATCCTTTGGAAGCCCTGCCCAGG + Intronic
922706631 1:227793898-227793920 ATCCCTGGGAAGCCAGGCCATGG + Intergenic
923420281 1:233807985-233808007 ATACTCTGGAAGCCTGGACAAGG - Intergenic
1073765200 10:106674463-106674485 TTCCTTTGGAAAACTGGACATGG - Intronic
1076017162 10:127037143-127037165 CTTCTGTGGAAGCCCAGACATGG + Intronic
1077532578 11:3104089-3104111 ATTCTCTGGAAGCCCCCACAGGG + Intronic
1081483827 11:43512423-43512445 AGACTTTGAAAGCCAGGACACGG - Intergenic
1088119409 11:106350615-106350637 TTCCTTTGGAAACCTGAACAAGG - Intergenic
1088228274 11:107645225-107645247 ATCCTTTAGAGGGCCGGGCACGG - Intronic
1091791711 12:3275714-3275736 ATTCTTTGGGAGCCCTGACGTGG + Intronic
1092447937 12:8574968-8574990 ACACTTTGGAAGCCAAGACAGGG - Intergenic
1092534871 12:9378522-9378544 CTCCTTTGGAAGCACTGACCTGG + Intergenic
1096677287 12:53232448-53232470 ATCCTCTGGGAGGCCGGGCACGG + Intronic
1096714983 12:53485972-53485994 ATGGTTTGGAAGCCGGGAGAAGG + Intronic
1097172970 12:57127929-57127951 AGACTTTGGAAGACCGGACTGGG - Intronic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1098082713 12:66806974-66806996 ATGCTTGGGAAGCCAGGATAAGG + Intergenic
1102374290 12:112409253-112409275 ATCCTCTGGAACCCAGGACCAGG + Intronic
1103369614 12:120408836-120408858 GTCCTGTGGGAGCCTGGACAGGG + Intergenic
1103719513 12:122965922-122965944 ATCCCTGGGAAGCCCTGACATGG + Intronic
1110178283 13:72584386-72584408 AAGCTTTGGAAGCCCAGAGATGG + Intergenic
1113465354 13:110508721-110508743 ATACTTTGAAAGCCAGGAGAAGG + Intronic
1122318442 14:100839359-100839381 CTCCTTTGGAAGAGGGGACAGGG - Intergenic
1130297155 15:82655541-82655563 TTCCTTTCCAAGCCAGGACAGGG + Intergenic
1134112884 16:11526887-11526909 ATCCTCTGGAAACTCAGACAAGG - Intergenic
1134611313 16:15610867-15610889 ATCTTCAGGAAGCACGGACAGGG + Intronic
1135511798 16:23091474-23091496 ATCCTTTGGAAGCACAGCCTAGG + Intronic
1140279688 16:73543458-73543480 ATCCTTTGGAGGCACCGGCAGGG + Intergenic
1143643519 17:8214151-8214173 ATCCTTTATAAGGCCGGGCACGG - Intergenic
1144281463 17:13731047-13731069 ATCCTATGGAAGCCCAAACTTGG + Intergenic
1149321162 17:55482430-55482452 AGCCTGTGGAAGCCTGGAGAAGG - Intergenic
1150271091 17:63865674-63865696 ACCCTTTGGAAGGCCAGGCACGG + Intergenic
1155863142 18:30929916-30929938 CTCCTGTGAAAGCCCAGACAAGG - Intergenic
1156755105 18:40514009-40514031 CTCCTTTGAAAGCCAGCACAAGG + Intergenic
1159884653 18:73892333-73892355 ATCATTTGGAAGCCACGGCAGGG - Intergenic
932332511 2:70905747-70905769 ATCCTTTGGAAGCCCGGACAAGG + Intronic
932378553 2:71260617-71260639 ATCCTTTGTGAGGCCGGGCATGG + Intergenic
933665011 2:84957804-84957826 ATCCTTTGGGATCACAGACATGG + Intergenic
934979541 2:98828548-98828570 AGCCTTTGCTAACCCGGACAGGG + Intronic
936176127 2:110221528-110221550 ATCCTTTGGCAGCCATGAGAAGG - Intergenic
936656416 2:114493262-114493284 TTGCTCTGGAAGCCAGGACAGGG + Intronic
938204070 2:129402273-129402295 ATACTTTGCAAGGCTGGACAAGG + Intergenic
944038403 2:195325850-195325872 CTCTTTTGGAAGCCAGGAGAGGG - Intergenic
948972434 2:241439617-241439639 ATTCTTTTGAAGGCCGGGCATGG - Intronic
1173435396 20:43027901-43027923 ATTCTTTGGAAGCTCAGAAAGGG - Intronic
1174151630 20:48490086-48490108 ATCCTTTGTAATCTCTGACAGGG - Intergenic
1175314893 20:58040302-58040324 ATCCTTTGGAAGCCACATCAAGG - Intergenic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1177895593 21:26853201-26853223 CTGCTCTGGAAGCCAGGACATGG - Intergenic
1180605926 22:17058577-17058599 CTCCTTTGGAAGCACTGACTTGG - Intergenic
954686559 3:52373244-52373266 AGCCTCTGGAAGCCTGGAAAAGG + Intronic
956740884 3:72275010-72275032 GTTCTTTGGAAGCCAAGACACGG + Intergenic
962308238 3:134307608-134307630 GTCCATTTGAAGCCAGGACAAGG - Intergenic
973306717 4:48660325-48660347 ATCCTTTGAAAGGCCTTACAAGG + Intronic
981654258 4:147093934-147093956 AACATTTGGAAACCAGGACAGGG + Intergenic
991950465 5:71942533-71942555 GTCCTTTGGAAGGCCCAACAAGG + Intergenic
1004580980 6:16951982-16952004 ATCCTTTGCCAGCCCAGCCAGGG + Intergenic
1005996136 6:30932450-30932472 ATCCTTGGGAGGCCCGGGCATGG - Intergenic
1013361420 6:109396933-109396955 AGCTTTTGGAAGCCCAGACATGG - Intronic
1022838266 7:34137399-34137421 ATCCTGTGGAAGCTGGGAAAAGG + Intronic
1027783498 7:82550177-82550199 AGCCATTGGAAGCCCGGGCATGG + Intergenic
1028089128 7:86675358-86675380 ATACTTTGGAAGCAGGGATATGG - Intronic
1031050934 7:116944788-116944810 ATAATTTTGAAGGCCGGACATGG + Intergenic
1033657396 7:143382669-143382691 ATCCTTTCAAAGCCCGGGTAAGG + Exonic
1033757585 7:144407680-144407702 TTCCTTTGAAAGCCCAGAAAAGG + Intronic
1038435634 8:27533952-27533974 AACCCATGGAAGCCTGGACAGGG - Intronic
1039414148 8:37379198-37379220 ATCCTTTGGAAGCAGGGATGTGG - Intergenic
1044616282 8:94145784-94145806 ATGCTTTGGAAGCTTGTACAGGG - Intronic
1048299977 8:133244496-133244518 CTCCTTTGTAAGGCAGGACAAGG - Intronic
1048435250 8:134410431-134410453 CTCCTTTGGAACCCATGACATGG + Intergenic
1058220983 9:102302004-102302026 ATCCTTTCCAAGGCCGGGCATGG - Intergenic
1196534831 X:116831349-116831371 ATCTTTTGAAAGACCTGACATGG + Intergenic