ID: 932333024

View in Genome Browser
Species Human (GRCh38)
Location 2:70910012-70910034
Sequence TGGAACATGTAAAACCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 178}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932333019_932333024 22 Left 932333019 2:70909967-70909989 CCCTTGAACAAATGGTTTTTTTT 0: 1
1: 0
2: 11
3: 83
4: 916
Right 932333024 2:70910012-70910034 TGGAACATGTAAAACCAGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 178
932333020_932333024 21 Left 932333020 2:70909968-70909990 CCTTGAACAAATGGTTTTTTTTA 0: 1
1: 0
2: 1
3: 56
4: 684
Right 932333024 2:70910012-70910034 TGGAACATGTAAAACCAGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932333024 Original CRISPR TGGAACATGTAAAACCAGGT GGG Intronic
904413401 1:30339426-30339448 TGGAAGCAGTAAGACCAGGTAGG + Intergenic
905298134 1:36967576-36967598 AGTAAGATGGAAAACCAGGTAGG + Intronic
906221868 1:44086845-44086867 TGGAACATGTATAAAGAGGGAGG + Intergenic
906441944 1:45854861-45854883 AAGAACAGGTAAAACCAGCTAGG - Intronic
909977113 1:82058275-82058297 TGGAACATATAATACCAATTTGG + Intergenic
910108987 1:83661743-83661765 GGGAGCAGGTAAAACCAGCTGGG - Intergenic
913031458 1:114907897-114907919 TGGAAGATGTAAATGCATGTAGG - Intronic
914837655 1:151221063-151221085 TGGAATATGTGAAACCTGTTTGG - Intronic
920934359 1:210417529-210417551 TAGAAAATGTAAAATAAGGTGGG - Intronic
921555303 1:216591630-216591652 TGGAACATACAAAACCAGCCTGG + Intronic
921629578 1:217417552-217417574 TGGAACATGGTTAACCAGGACGG - Intergenic
921768423 1:219002384-219002406 TACAACATGTAAGAACAGGTGGG - Intergenic
921962850 1:221054210-221054232 TGGCACATGTTAAACCAGTTGGG + Intergenic
922623203 1:227007824-227007846 TGAAACTTGTAAAACCATTTAGG - Intronic
922908552 1:229196124-229196146 TGGAAATTTTAAAAACAGGTTGG - Intergenic
924789953 1:247236848-247236870 TGCAACATGTAAAACTATTTGGG + Intergenic
1064509250 10:16071694-16071716 TTGAAGATGCAAAACCAGGGCGG - Intergenic
1065977114 10:30851861-30851883 TTGAAAATGTAAAATCAGCTGGG + Intronic
1066343845 10:34562542-34562564 TGGAAGATGGAAAAGCAGATTGG - Intronic
1068443063 10:57084476-57084498 TAGAACATATAAAACCTTGTTGG - Intergenic
1069330538 10:67287035-67287057 TGGAACATGAAAAAACATGCTGG + Intronic
1071036373 10:81251569-81251591 AGGAACCTGAAAAACCAGTTCGG + Intergenic
1073836026 10:107443838-107443860 TGGAAGATGTTAAACCACCTTGG - Intergenic
1074243265 10:111661032-111661054 TGGGATATGTAGAACCAGGAAGG + Intergenic
1074763022 10:116681610-116681632 TGCATGTTGTAAAACCAGGTAGG - Intronic
1074973244 10:118560122-118560144 TAGAGCCTGTAAAACCAAGTAGG - Intergenic
1079539997 11:21561674-21561696 TGGTATATTTAAAACCAGTTAGG + Intronic
1079646822 11:22874133-22874155 TCTAACACGCAAAACCAGGTAGG - Intergenic
1082747111 11:56976297-56976319 TAAAACATGTGAAACCAGCTTGG + Intergenic
1083249396 11:61455770-61455792 TGGAACATGAAAGAGCAGATTGG - Intronic
1084310819 11:68315116-68315138 CTGAGCATGTAAACCCAGGTGGG - Intronic
1085076988 11:73599938-73599960 TGGAACTATTAAAACCAGGCAGG - Intergenic
1085936075 11:81145162-81145184 TGAAAAATGTAAAATCAAGTTGG - Intergenic
1086097456 11:83064908-83064930 TGGAACATGTAATCCTAGATTGG - Intronic
1089610906 11:119668174-119668196 AGGAAGATGGCAAACCAGGTTGG - Intronic
1090967500 11:131611770-131611792 TGAAACATGTCAACCAAGGTGGG + Intronic
1095761919 12:45849208-45849230 TTTAACATGTAAAAGTAGGTAGG - Intronic
1098458207 12:70700798-70700820 TGGAACATTGAAATCAAGGTGGG - Intronic
1105910073 13:24855983-24856005 TGGAACACATAAAACCAAGAAGG - Intronic
1107028839 13:35830654-35830676 TGGGACATGTTAAGCCAGATAGG - Intronic
1107765224 13:43727245-43727267 TAACACATGTTAAACCAGGTGGG + Intronic
1107823439 13:44306494-44306516 TGTAAGATGTAAAAGCAGGGAGG - Intergenic
1108308994 13:49166741-49166763 GGAAACATGTAAAACAAGGAAGG - Intronic
1109425284 13:62159137-62159159 TGGAAGATGCAAAGCCATGTGGG - Intergenic
1109430971 13:62234738-62234760 TGGATCCTCTAAAGCCAGGTGGG - Intergenic
1111137930 13:84074568-84074590 TGGAAAATGTAAAACAATTTAGG - Intergenic
1116738748 14:48728527-48728549 TGGAAAAGGTAAAACTTGGTAGG - Intergenic
1117001860 14:51378233-51378255 TAGAAAATGTAAAACTAGGCTGG + Intergenic
1117794319 14:59376619-59376641 TGGAAAAGGTAAAACTAGGGAGG + Intergenic
1121588202 14:95078575-95078597 TGGGACATGTAAAATCAAGAGGG - Intergenic
1121943430 14:98095109-98095131 TGGAACAAGAAAAGCCAGGAGGG + Intergenic
1124064173 15:26324128-26324150 TGGAACATGCAAAATCAGACAGG + Intergenic
1124452156 15:29804565-29804587 TGGAGAAAGGAAAACCAGGTAGG + Intronic
1125027918 15:35049322-35049344 TGGAAAATATAAAACTTGGTAGG + Intergenic
1125052704 15:35319859-35319881 TGGAAAATGTAAAGCAAGATTGG + Intronic
1125360141 15:38856544-38856566 TGGAATAAGTACAAACAGGTTGG + Intergenic
1125825001 15:42668774-42668796 TGGATCATGTAAAACTGGGGTGG + Intronic
1126061567 15:44787585-44787607 TGGAAGGGGCAAAACCAGGTAGG + Intergenic
1126370098 15:47936778-47936800 TGGAACTTTTATAACCTGGTAGG + Intergenic
1126550740 15:49926428-49926450 TGGAATGGGTAAAACCAGTTAGG - Intronic
1126880259 15:53087055-53087077 AGGAATATATCAAACCAGGTAGG - Intergenic
1127234133 15:57029088-57029110 TGATACATGTAAAGACAGGTGGG - Intronic
1128737177 15:70059792-70059814 TGGTGGATGTAAAACCAGCTGGG - Intronic
1131602317 15:93862138-93862160 TGGATCATGTGAAAGCAGGGAGG + Intergenic
1132924929 16:2424360-2424382 TGGAAGTTTCAAAACCAGGTAGG + Intergenic
1135230310 16:20700256-20700278 TTAAACATGTAAGACAAGGTTGG + Intronic
1135750062 16:25050960-25050982 AGGAACATCTAAATCCAGGTGGG + Intergenic
1136998250 16:35206628-35206650 TGGAACATTTAAGACAAGGCTGG - Intergenic
1137028970 16:35505216-35505238 TGGAACATTTAAGACAAGGCTGG - Intergenic
1140021780 16:71246043-71246065 TGGAACCTGGCAAACCAGTTGGG + Intergenic
1141808846 16:86360433-86360455 TGTAGAATGGAAAACCAGGTCGG + Intergenic
1145740598 17:27270926-27270948 TGCAGCTTTTAAAACCAGGTTGG + Intergenic
1145885543 17:28380215-28380237 GGGAAAATATAAAACCAGGCTGG - Intronic
1150604039 17:66675912-66675934 TGGAACCTCTAAAACCATGCAGG - Intronic
1150995900 17:70317152-70317174 TGGAAGATGCAAAATGAGGTTGG - Intergenic
1155123892 18:22851329-22851351 TGTAAAATGTAAAACCAGGCTGG - Intronic
1155493319 18:26420572-26420594 TGTAACATGTAAACCCAGCCTGG + Intergenic
1155874619 18:31070361-31070383 CAGAAAATGTAAAACCATGTTGG + Intronic
1156522520 18:37733804-37733826 TGCAACCTAGAAAACCAGGTTGG - Intergenic
1157210378 18:45736978-45737000 TGGAAGATTTAAAACCAGGCTGG - Intronic
1159293913 18:66456145-66456167 TGGAACATGAAAAAGCACATGGG - Intergenic
1164276960 19:23727723-23727745 TTGAACATGAAAAACCAGCTGGG - Intergenic
1165537620 19:36462614-36462636 TGGGACATGCAAAAACAGGGGGG + Intronic
1167170394 19:47827238-47827260 AAGAACAAGTAAAACCTGGTAGG - Intronic
928005920 2:27561573-27561595 TGGAACATAGAAAAAAAGGTAGG - Intronic
930590310 2:53319351-53319373 TGGAACAAGAAAGACCAGGAAGG + Intergenic
931470831 2:62536319-62536341 TGCAACATGGAAAGCCAGGGAGG - Intergenic
932333024 2:70910012-70910034 TGGAACATGTAAAACCAGGTGGG + Intronic
933561749 2:83896120-83896142 TGGAATATTTATAACCAAGTTGG + Intergenic
933976198 2:87513647-87513669 TGGGACATTTACAACCAAGTGGG - Intergenic
934109974 2:88733318-88733340 TGGCACCTGGAAAACCAGGCAGG + Intronic
934856706 2:97734394-97734416 TGGAGCATGCACAAGCAGGTGGG - Intronic
935062961 2:99623822-99623844 TGGAACAGGCAAGGCCAGGTGGG + Intronic
935446951 2:103167126-103167148 TGGTTAATGTAAAACCAGGCTGG - Intergenic
936317624 2:111437159-111437181 TGGGACATTTACAACCAAGTGGG + Intergenic
939706368 2:145458325-145458347 TGGAACATGAAAAATGAGATAGG - Intergenic
942364516 2:175209424-175209446 TGGAAAAGGCAAAACCATGTAGG - Intergenic
943527550 2:189036678-189036700 TGTACCACGTAAAACCTGGTGGG - Exonic
944539064 2:200739642-200739664 TGGGATATGGAAAACCAGGGAGG + Intergenic
944674679 2:202025396-202025418 TGGAAAATCTAAAACAATGTTGG + Intergenic
944791254 2:203129743-203129765 TGCAACATGTAAAACCCTCTTGG - Intronic
945367705 2:208976902-208976924 TGGAACAGCTGATACCAGGTAGG + Intergenic
947885247 2:233564267-233564289 AGGAACATGGCAAACCAGATAGG + Intronic
1169746461 20:8947910-8947932 TGGGACAGGTAAATTCAGGTAGG + Intronic
1169811670 20:9615118-9615140 TGGAACAGGTAAAACTAAGGTGG + Intronic
1173304883 20:41838690-41838712 TGGCACTTCTAAAATCAGGTAGG - Intergenic
1178240571 21:30894910-30894932 GGGAACATGTAACAACAGCTTGG - Intergenic
1181810809 22:25402941-25402963 CTGAGCATGTAAATCCAGGTGGG + Intronic
1181942603 22:26490071-26490093 TGGAGCATGTAAAAGATGGTAGG - Exonic
1182831499 22:33308077-33308099 TGGCAGATCTAAAAACAGGTGGG + Intronic
1183256899 22:36768283-36768305 TGGAAGCTGTCAACCCAGGTTGG - Intronic
1183869664 22:40731637-40731659 TGGTGCACGTAAAACTAGGTCGG + Intergenic
1184554406 22:45225418-45225440 AGGAAGATGTGAAACCAGGCAGG - Intronic
949194851 3:1292666-1292688 TGCAACTTGTAAAAACAGGGTGG - Intronic
951946254 3:28140003-28140025 TGGAAGAAGTGAGACCAGGTGGG - Intergenic
952451241 3:33434979-33435001 TAAAAAATGTAAAACCAGATCGG - Intronic
960895036 3:122494887-122494909 TGATACATGTGAACCCAGGTAGG - Intronic
963215280 3:142739428-142739450 TCAAACATGTAAAGACAGGTAGG + Intronic
963558260 3:146824844-146824866 TGGATCATGGTAAAGCAGGTAGG + Intergenic
964682416 3:159356997-159357019 TGGAACACATAAAACTAGGTTGG - Intronic
965754572 3:172012559-172012581 TGAAACAGGTAAAACCACCTCGG + Intergenic
966828539 3:183986144-183986166 TGGAAATTGAAAAACCAGGCTGG - Intronic
967370905 3:188744907-188744929 TGGAACATTCAAAACCAAGAGGG - Intronic
967469068 3:189842003-189842025 AGGAACAGGGAAAACCAGTTTGG + Intronic
968226044 3:196972924-196972946 AGGAAAATGAAAAAACAGGTGGG - Intergenic
972235047 4:37122226-37122248 TGGGTCATGCAAAAACAGGTGGG - Intergenic
973245963 4:48011725-48011747 GGGACAATTTAAAACCAGGTGGG + Intronic
976474978 4:85473671-85473693 TAGAACATGTAAGGCCATGTGGG + Intergenic
977979563 4:103306467-103306489 TAGAGCATGAAAAACCAGTTAGG + Intergenic
978332943 4:107634484-107634506 TGGAAAAAGTAAAACATGGTGGG - Intronic
979223765 4:118261404-118261426 TGGAACATGTTAAACAAAGCAGG - Intergenic
979561250 4:122104522-122104544 TGGAAAATCTAAAGTCAGGTGGG - Intergenic
980949726 4:139362648-139362670 TTGAACATTAAAAACCAGCTTGG + Intronic
983803437 4:171964534-171964556 TGCAACTTTTAAAACCAGGCTGG - Intronic
984014239 4:174407052-174407074 TGGAACTTGTAAAATGTGGTGGG + Intergenic
986989688 5:13537249-13537271 TGGAACATTTAAAGACAGGCTGG + Intergenic
988438505 5:31205026-31205048 TGGAATAGATAAATCCAGGTTGG + Intronic
988541307 5:32112438-32112460 TGTAAGATGTAAAACCAGGCTGG + Intergenic
989348497 5:40456860-40456882 TGGAATTAGTAAAACCAGGCAGG + Intergenic
990050278 5:51491258-51491280 TGGAAAATGTAAAAACAACTGGG + Intergenic
991325777 5:65430462-65430484 CGGAACATTTAAAACCAAGCAGG + Intronic
993479705 5:88409634-88409656 TGGAACATCAGAAATCAGGTGGG - Intergenic
993909424 5:93663275-93663297 TGTAACCTGTAAAAACAGTTTGG - Intronic
994449578 5:99925375-99925397 TAAAACATGGAAAAACAGGTTGG - Intergenic
996454279 5:123662197-123662219 TGGAACATTTAAAAGTGGGTTGG + Intergenic
996989003 5:129605281-129605303 TAGAACATGTAGAACTTGGTGGG - Intronic
997975849 5:138440839-138440861 TGGAACATGCCCAGCCAGGTAGG - Intronic
1005326328 6:24704446-24704468 TGGAGGATTTAAAACCAGGCTGG - Exonic
1006551410 6:34826320-34826342 TGTAACATGTAAAAGCATGTAGG - Intronic
1006799364 6:36750180-36750202 TGGATGATGTAAGATCAGGTAGG + Intronic
1008662013 6:53678164-53678186 TGGAACTTGCAAACACAGGTAGG + Intergenic
1008999511 6:57697173-57697195 TGGAACTAGTAAGACCAGTTTGG - Intergenic
1010360732 6:74990370-74990392 TGGAACATGTAAATGCAGTAAGG + Intergenic
1010799229 6:80154883-80154905 TGGATTATGTAAAAACAGCTTGG + Intronic
1011351166 6:86425546-86425568 TGGCAGATGTAAAACTAGATAGG - Intergenic
1013235195 6:108192289-108192311 GTGAAAATGTAGAACCAGGTTGG + Intergenic
1013236849 6:108204510-108204532 TGGAAAATGTTAAACAAGCTGGG + Intergenic
1013517060 6:110897884-110897906 TGAAATATGTAAATCCAGCTGGG + Intergenic
1013692729 6:112665516-112665538 TGGACCAGGTACCACCAGGTTGG + Intergenic
1015400980 6:132787864-132787886 TGGAATATGTAGAATCAGCTGGG + Intronic
1015627841 6:135200015-135200037 TGTAACAGGTAAAGCCATGTAGG + Intronic
1015688592 6:135894808-135894830 GGGAACATGTTTACCCAGGTGGG + Intronic
1016388660 6:143553434-143553456 TGGTGCATGTAAACCCAGCTGGG + Intronic
1017887266 6:158609568-158609590 TGGAACACAGAAAACCAGGACGG - Intronic
1018428804 6:163707430-163707452 TGGAGCATTTAAAACGAGCTGGG + Intergenic
1018746954 6:166769747-166769769 GGGACCACCTAAAACCAGGTGGG + Intronic
1018937229 6:168281470-168281492 TGGGAAATGTGAAAGCAGGTGGG + Intergenic
1022881531 7:34592810-34592832 TGCAACATGAAAAACCAAGCAGG + Intergenic
1027926305 7:84468117-84468139 TGGAAAATTTAAAACGAGGGAGG + Intronic
1028006331 7:85573931-85573953 TGGAACATGTAAATGCAGTAAGG + Intergenic
1030907053 7:115198853-115198875 TGGAACATGTGAAAGCCAGTGGG + Intergenic
1032465779 7:132143913-132143935 CTGAATATGAAAAACCAGGTAGG - Intronic
1032705726 7:134419881-134419903 GGGAACAATTAAAAGCAGGTAGG - Intergenic
1038884712 8:31650464-31650486 TGGCATATGTAAAAACAGGAGGG - Intronic
1039617331 8:38966500-38966522 TGCAGCATGTAACACCGGGTGGG + Intronic
1040605117 8:48923906-48923928 TGGAACAAGCAAACCCAAGTGGG + Intergenic
1042057201 8:64777142-64777164 TGTAAAAAGTAAACCCAGGTAGG + Intronic
1053341899 9:37344015-37344037 TAAAAAATGTAAAACCAGCTGGG + Intronic
1055253103 9:74332297-74332319 TGGCAAAAGGAAAACCAGGTAGG + Intergenic
1058795043 9:108489806-108489828 TGGAACATGCAAAGGCAAGTAGG + Intergenic
1058915649 9:109561786-109561808 TGGGACATGTAAGACCATCTGGG + Intergenic
1060078458 9:120617531-120617553 CAGAAAATGTAAAACCAGATAGG + Intronic
1060471089 9:123948783-123948805 TGGAACATATCATAACAGGTGGG + Intergenic
1060798565 9:126528880-126528902 TTGACCATGTGAAACCAGTTAGG + Intergenic
1187920075 X:24193082-24193104 TTAAAGATGTAAAACCAGATGGG + Intronic
1189844048 X:45115298-45115320 TGGAATCTGTTAAAACAGGTAGG - Intergenic
1201560369 Y:15309899-15309921 TGGAAAATGGAAAACTTGGTGGG - Intergenic