ID: 932334439

View in Genome Browser
Species Human (GRCh38)
Location 2:70922013-70922035
Sequence GAATGACATCATCTGCTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 745
Summary {0: 1, 1: 1, 2: 17, 3: 166, 4: 560}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932334439_932334443 11 Left 932334439 2:70922013-70922035 CCAAGAAGCAGATGATGTCATTC 0: 1
1: 1
2: 17
3: 166
4: 560
Right 932334443 2:70922047-70922069 GTGAAAGGAAGTTATGCCCAAGG 0: 1
1: 0
2: 0
3: 11
4: 147
932334439_932334440 -4 Left 932334439 2:70922013-70922035 CCAAGAAGCAGATGATGTCATTC 0: 1
1: 1
2: 17
3: 166
4: 560
Right 932334440 2:70922032-70922054 ATTCCCATGTTACACGTGAAAGG 0: 1
1: 0
2: 1
3: 18
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932334439 Original CRISPR GAATGACATCATCTGCTTCT TGG (reversed) Intronic
902757747 1:18560276-18560298 GAATAACATTATCTCCTTCATGG - Intergenic
902905232 1:19551795-19551817 GCATGGCAGCATCTGCTTCTTGG + Intergenic
905353139 1:37361197-37361219 CAGTGTCATCATCTGCATCTGGG + Intergenic
906186675 1:43867346-43867368 GAAAGAAATGATCTTCTTCTTGG - Intronic
906625093 1:47318567-47318589 GACTGACATAATCTGATTTTAGG + Intergenic
906856236 1:49308133-49308155 GAATGGCAGCATCTGCTTCTGGG - Intronic
906991922 1:50747959-50747981 GCATGGCAACATCTACTTCTGGG - Intronic
907073957 1:51562390-51562412 GCATGGCAGCATCAGCTTCTGGG - Intergenic
907108886 1:51908610-51908632 GTATGACTTCCTCTGCTTGTGGG - Exonic
907253128 1:53156537-53156559 GCATGGCAGCATCTGCTTCTGGG - Intergenic
907448004 1:54521710-54521732 GCATGGCAGCATCTGCTTCTGGG + Intergenic
907567997 1:55455052-55455074 GCATGGCAGCATCTGCTTCTGGG - Intergenic
908260344 1:62335421-62335443 GCATGGCAGCATCTGCTTCTGGG + Intergenic
908689718 1:66764863-66764885 AAATAACATCATCTACTGCTGGG + Intronic
908830008 1:68169467-68169489 GAAGGATTTCATCTGCTCCTGGG + Intronic
908929824 1:69305090-69305112 GCATAGCAGCATCTGCTTCTGGG - Intergenic
909133586 1:71768997-71769019 GCATAACAGCTTCTGCTTCTGGG - Intronic
909180321 1:72415756-72415778 GCATGGTAGCATCTGCTTCTGGG - Intergenic
909453812 1:75828484-75828506 GAATGAAATCATGTTCTTTTTGG + Intronic
909773680 1:79457796-79457818 GCATGACAGCATCTGCTACTGGG - Intergenic
910138025 1:83995543-83995565 GCATGGCAGCATCTGCTTCTGGG - Intronic
910186206 1:84543429-84543451 GCATGGCATCATCTGCTTCTGGG + Intergenic
910990646 1:93052705-93052727 GCATGGCAGGATCTGCTTCTGGG + Intergenic
911172612 1:94784955-94784977 GCATGGCAGCATCTGCTACTGGG - Intergenic
911565810 1:99462108-99462130 GAGTTACACCATCAGCTTCTTGG - Intergenic
911850436 1:102811647-102811669 TACTGACATCACCTGCTCCTGGG - Intergenic
912191936 1:107351376-107351398 GCATGGCAGCAGCTGCTTCTGGG + Intronic
912192275 1:107353805-107353827 GCATGGTAGCATCTGCTTCTGGG + Intronic
912533721 1:110346872-110346894 GAAGGGGATCATTTGCTTCTCGG + Intergenic
912545704 1:110449823-110449845 GAATCAAAGCATCTGCCTCTGGG + Intergenic
913051308 1:115119239-115119261 GCATGGCAGCATCTGCTTCTGGG + Intergenic
913051586 1:115121280-115121302 GCATGGCAGCAGCTGCTTCTGGG + Intergenic
914877869 1:151525661-151525683 GGCTGACATCTTCTGCCTCTCGG - Exonic
916022523 1:160806379-160806401 AAATGTCATCTTTTGCTTCTGGG + Intronic
916250789 1:162735932-162735954 CAATGAGAGCCTCTGCTTCTTGG - Intronic
916649151 1:166818910-166818932 GCATGACAGCATTTGCTTCTGGG + Intergenic
916649432 1:166821054-166821076 ACATGGCAGCATCTGCTTCTGGG + Intergenic
916735915 1:167606927-167606949 GCATAACAGCATCTGCTTCTGGG - Intergenic
917777241 1:178350946-178350968 GCATGGCATCATCTGCTTCTGGG + Intronic
919254745 1:195106320-195106342 GAATAACACCTTTTGCTTCTAGG + Intergenic
919597470 1:199581487-199581509 GCATGGCAGCTTCTGCTTCTGGG - Intergenic
919816786 1:201446013-201446035 GCATGGCAGCATCTGCTTCTGGG - Intergenic
920246352 1:204590440-204590462 GCATGGCAGCATCTGCTTCTGGG + Intergenic
921239820 1:213167275-213167297 GAACAGCATCTTCTGCTTCTGGG - Intronic
921301419 1:213754652-213754674 GCACGGCAGCATCTGCTTCTGGG - Intergenic
921351670 1:214242421-214242443 ACATGGCAGCATCTGCTTCTGGG - Intergenic
921399045 1:214700160-214700182 GCATGGCAGCATCTGCTTCCGGG - Intergenic
921482462 1:215678903-215678925 TCATGAGAGCATCTGCTTCTTGG - Intronic
923139662 1:231150742-231150764 CAGTGTCAGCATCTGCTTCTGGG + Intergenic
923430372 1:233914115-233914137 GACTGACATCATCTTCCTCCTGG + Intronic
924650440 1:245921606-245921628 GAATGACATCATGTCCTTTGTGG + Intronic
1063124588 10:3127399-3127421 GAATGACATCAACCGCTTAATGG - Intronic
1063840397 10:10065299-10065321 GCATGACATCATCTGCTTCTGGG + Intergenic
1064151463 10:12869169-12869191 GCATGGCAGCTTCTGCTTCTGGG + Intergenic
1064432253 10:15281209-15281231 GCATGGCATCTTCTGCTTCTGGG - Intronic
1065378445 10:25065529-25065551 GCATAACAGCTTCTGCTTCTGGG - Intergenic
1065393787 10:25212236-25212258 GCATGGCAGCATCTGCTTCTGGG + Intronic
1065430406 10:25648896-25648918 GTATGGCAGCATCTGCTTCTTGG - Intergenic
1066227150 10:33394369-33394391 TAAAGACCTCATCTACTTCTTGG - Intergenic
1066252750 10:33650236-33650258 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1066540719 10:36444005-36444027 GCATGACAGCACCTGCTTGTGGG - Intergenic
1067099022 10:43321367-43321389 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1067916726 10:50407730-50407752 GAAAGCCATCATGTACTTCTAGG + Intronic
1068310699 10:55270964-55270986 GAATGAAATCATGTGCTTCACGG + Intronic
1068504337 10:57880895-57880917 GAAAGACATTATCTGATTATGGG - Intergenic
1069982103 10:72260066-72260088 GAATGTCATCATCTGCCTCCAGG + Intergenic
1070349069 10:75574957-75574979 GCATGGCAGCTTCTGCTTCTGGG + Intronic
1070385244 10:75918347-75918369 GCATAGCAGCATCTGCTTCTGGG + Intronic
1070581865 10:77726794-77726816 GCATGACAGCTTCTGTTTCTGGG + Intergenic
1070989095 10:80715696-80715718 GAATGACTGCATCTGCTCCTTGG + Intergenic
1071338587 10:84622034-84622056 GAGTTCCAGCATCTGCTTCTGGG - Intergenic
1071702520 10:87955504-87955526 GCATAGCAGCATCTGCTTCTGGG + Intronic
1072266074 10:93729133-93729155 GCATGGCAGCATCTGCTTCAGGG - Intergenic
1072507448 10:96082850-96082872 CAATGTCACCAGCTGCTTCTGGG - Intergenic
1073468351 10:103707698-103707720 TAATGATAGCATCTTCTTCTTGG - Intronic
1073619226 10:105029698-105029720 GAATGTCATAAGCTTCTTCTAGG - Intronic
1073939706 10:108682157-108682179 GTATGGCAACATCTACTTCTAGG + Intergenic
1073964368 10:108971887-108971909 GCATGACAGCAACTGCTTTTGGG + Intergenic
1073990250 10:109254184-109254206 GCATGGCAGCGTCTGCTTCTTGG + Intergenic
1074214219 10:111368705-111368727 GCATAGCAGCATCTGCTTCTAGG + Intergenic
1074217436 10:111399382-111399404 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1075467085 10:122659753-122659775 GCATGACAGCATGTGCCTCTAGG - Intergenic
1075470550 10:122686040-122686062 GCATAGCAGCATCTGCTTCTGGG + Intergenic
1075624473 10:123951782-123951804 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1076104709 10:127812289-127812311 GCATGACATCAAATCCTTCTCGG + Intergenic
1076473864 10:130738929-130738951 CAGTGCCAACATCTGCTTCTGGG - Intergenic
1077981136 11:7301996-7302018 TAATGACAGCATCTGCTACATGG - Intronic
1078589414 11:12626547-12626569 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1079213972 11:18489426-18489448 GAATGACCTTATCTGTTTCCTGG - Intronic
1079747140 11:24147899-24147921 GCATGGCAGTATCTGCTTCTGGG - Intergenic
1081369080 11:42276611-42276633 GCATAGCAGCATCTGCTTCTCGG + Intergenic
1081585952 11:44383815-44383837 GCATGGAAGCATCTGCTTCTGGG + Intergenic
1081751809 11:45516607-45516629 GCATGGCAGCATCTGTTTCTGGG - Intergenic
1081783793 11:45732336-45732358 GCATGGCAGCATCTGCTTTTGGG + Intergenic
1082764870 11:57159292-57159314 AAATGACACCATCTGCATCCAGG + Intergenic
1084018934 11:66405535-66405557 GTATGGCAGCATCTGCTTCTGGG - Intergenic
1084495274 11:69499843-69499865 GAGCGACACCACCTGCTTCTTGG + Intergenic
1084498291 11:69518554-69518576 GCGTGGCAGCATCTGCTTCTGGG - Intergenic
1084577346 11:69997879-69997901 ACATGGCAGCATCTGCTTCTGGG - Intergenic
1085698598 11:78726802-78726824 GCCTGGCAGCATCTGCTTCTGGG - Intronic
1085859297 11:80213427-80213449 GCATGGCAACATCTGCTTCTGGG - Intergenic
1086084466 11:82940625-82940647 GCATGACAGCATCTGCTTCTGGG + Intronic
1086849012 11:91786480-91786502 CAATGACATTTTCTCCTTCTGGG + Intergenic
1087062111 11:93989338-93989360 GAATAACAGCCTCAGCTTCTAGG + Intergenic
1087249744 11:95884507-95884529 GAATGAAATCATGTGCTTAGTGG - Intronic
1087586235 11:100125478-100125500 GAATGAAATCATGTGCTTTGTGG - Intronic
1087621427 11:100547248-100547270 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1087743045 11:101911674-101911696 GCATGGCAGCATCTGCTTCTGGG - Intronic
1087967203 11:104431382-104431404 GTATGGCACCCTCTGCTTCTAGG + Intergenic
1089745658 11:120615138-120615160 GAATAACAACACCTGCTTCATGG - Intronic
1091539685 12:1448516-1448538 GACTCACATCTTCTGTTTCTTGG - Intronic
1092140762 12:6182012-6182034 GGAAGACATTATCTGCTTCTTGG - Intergenic
1092473278 12:8796919-8796941 GCATAGCAGCATCTGCTTCTGGG + Intergenic
1092683375 12:11014456-11014478 TGATGACAGCATCAGCTTCTTGG + Intronic
1092786216 12:12029292-12029314 GCATAGCAGCATCTGCTTCTGGG - Intergenic
1092853203 12:12649276-12649298 GCATGGCAGCATCTGCTTTTGGG + Intergenic
1093191759 12:16082712-16082734 TGATGCCAGCATCTGCTTCTTGG - Intergenic
1094646385 12:32328545-32328567 GAATGAGATTACCTGCTTGTTGG - Exonic
1094719522 12:33049109-33049131 GCATAGCAGCATCTGCTTCTGGG - Intergenic
1094729406 12:33157426-33157448 TAGTGTCAGCATCTGCTTCTGGG - Intergenic
1094754373 12:33449315-33449337 TAATGCCAGCATGTGCTTCTGGG + Intergenic
1095388757 12:41680145-41680167 GCATAGCAGCATCTGCTTCTGGG - Intergenic
1095781669 12:46067053-46067075 GCATGGAAGCATCTGCTTCTGGG + Intergenic
1097759611 12:63447715-63447737 GAATGACAACATCTGCTCCATGG - Intergenic
1098253362 12:68591315-68591337 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1098833781 12:75395562-75395584 CAATGACTCCATCTGGTTCTGGG + Intronic
1099009880 12:77279580-77279602 GCATGGCAGCATCTGCTTTTGGG + Intergenic
1099490969 12:83287743-83287765 GCATAGCAGCATCTGCTTCTAGG + Intergenic
1099854769 12:88150141-88150163 GCATAGCAGCATCTGCTTCTGGG + Intronic
1100397557 12:94198211-94198233 GAATGAGATCATGTCCTTTTGGG + Intronic
1100471679 12:94899338-94899360 GAGAGACATCATGTGCTTCCTGG + Intronic
1100559050 12:95729007-95729029 GCATGGCAGCATCTGCTTCTGGG - Intronic
1101549132 12:105745671-105745693 CAATGAGATCATGTGATTCTTGG + Intergenic
1101571080 12:105954268-105954290 GCATGGCAACATCTGCTTCTGGG - Intergenic
1101595003 12:106156316-106156338 GACTGACTTTTTCTGCTTCTTGG - Intergenic
1101998074 12:109539323-109539345 GAATGGCATCCTTTGCTTCACGG + Intergenic
1102448423 12:113022158-113022180 GCATGGCAACATCTGCTTCTGGG + Intergenic
1102711254 12:114929643-114929665 GCATGGCACCATCTGATTCTGGG + Intergenic
1103139955 12:118539911-118539933 GAAAGACAAAATCTTCTTCTAGG + Intergenic
1103964532 12:124630402-124630424 GAAAGCCATCATCTCCTCCTGGG - Intergenic
1104142579 12:126003071-126003093 TAGTGCCAGCATCTGCTTCTGGG - Intergenic
1105308845 13:19188563-19188585 CAGTGTCAACATCTGCTTCTGGG - Intergenic
1105528748 13:21199584-21199606 CAGTGTCAACATCTGCTTCTGGG + Intergenic
1105529027 13:21201592-21201614 TAGTGCCAACATCTGCTTCTGGG + Intergenic
1106924541 13:34600332-34600354 GCATGGTAGCATCTGCTTCTGGG - Intergenic
1107061457 13:36163873-36163895 GAATTACATCATTTGCTGCTGGG + Intergenic
1107111500 13:36702848-36702870 GGATGCCATCTTCTTCTTCTTGG + Intergenic
1107629110 13:42325438-42325460 GCATGGTAGCATCTGCTTCTGGG + Intergenic
1107921613 13:45214391-45214413 GAAAGAAATCATTTCCTTCTTGG - Intronic
1108056219 13:46488086-46488108 GCATGGCAGCACCTGCTTCTGGG + Intergenic
1108133696 13:47332438-47332460 GCATGGCAACTTCTGCTTCTGGG + Intergenic
1108210869 13:48138635-48138657 GCATGGCAGCATCTGTTTCTGGG - Intergenic
1108263894 13:48685130-48685152 GCATGGCGGCATCTGCTTCTGGG + Intronic
1108684150 13:52804380-52804402 GGATGACCTAATCTGTTTCTGGG + Intergenic
1108807829 13:54181581-54181603 GAATGACATCATGTCCTTAGTGG - Intergenic
1109009564 13:56923083-56923105 GCATGGCAGCATCTGCTTCTAGG + Intergenic
1109093139 13:58073408-58073430 GCATAGCAGCATCTGCTTCTGGG - Intergenic
1109283051 13:60379412-60379434 GCATGGCAGCATCTGCTTCTAGG + Intergenic
1109342391 13:61077325-61077347 ACATGGCAGCATCTGCTTCTGGG - Intergenic
1109414813 13:62025062-62025084 GAATGACATAATGTCTTTCTTGG - Intergenic
1109466866 13:62746155-62746177 GCATGGCGACATCTGCTTCTGGG + Intergenic
1109503714 13:63271176-63271198 GAATAGCAGCATCTGCTACTGGG + Intergenic
1109910968 13:68909381-68909403 CAATGAAATCATCAGGTTCTTGG + Intergenic
1109961961 13:69643438-69643460 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1109962342 13:69646725-69646747 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1110614085 13:77521812-77521834 GAATGCCAGCATCTGCTTCACGG + Intergenic
1111104378 13:83626729-83626751 GTGTGGCAGCATCTGCTTCTGGG + Intergenic
1111207375 13:85028371-85028393 GCATGGGAGCATCTGCTTCTAGG + Intergenic
1111638116 13:90931783-90931805 GAATGAGATCATGTGCTTTGTGG + Intergenic
1111668850 13:91303155-91303177 GCATGGCAGCTTCTGCTTCTGGG + Intergenic
1112068083 13:95816070-95816092 GCATGGCAGCATCTGCTTCTGGG - Intronic
1112096349 13:96136340-96136362 GCGTGGCACCATCTGCTTCTGGG + Intronic
1112180890 13:97079143-97079165 GCATGGCGGCATCTGCTTCTGGG + Intergenic
1112257964 13:97852174-97852196 GCATGGCAGCACCTGCTTCTAGG + Intergenic
1112549102 13:100403418-100403440 GCATAGCAGCATCTGCTTCTGGG + Intronic
1112717361 13:102202132-102202154 GCATGGCAGCATCTGCTTCTGGG - Intronic
1112786867 13:102961073-102961095 GCATGGCAGCATCTACTTCTAGG + Intergenic
1113062520 13:106338401-106338423 GCATAGCAACATCTGCTTCTGGG - Intergenic
1113616287 13:111683005-111683027 GAACAAAATCATCTCCTTCTCGG + Intergenic
1113621755 13:111767898-111767920 GAACAAAATCATCTCCTTCTCGG + Intergenic
1113711928 13:112471106-112471128 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1114188615 14:20423317-20423339 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1114437773 14:22722640-22722662 GCATGGCAGCATCTGCTTCTAGG + Intergenic
1114997297 14:28371413-28371435 GAATTACATTATCCACTTCTAGG - Intergenic
1115407688 14:33036693-33036715 AAATGACTTCGTCTACTTCTAGG + Intronic
1115456602 14:33611395-33611417 GGATGACAACATCTGAATCTTGG + Intronic
1115812475 14:37124926-37124948 GCATGGCAGCATCTACTTCTGGG - Intronic
1116145419 14:41061671-41061693 GCATGTCAGCATCTGCTTCTGGG - Intergenic
1116537617 14:46054627-46054649 TCATAATATCATCTGCTTCTGGG + Intergenic
1116581051 14:46641954-46641976 GCATAGCAACATCTGCTTCTGGG - Intergenic
1116673273 14:47871566-47871588 GAATGATACCATATGCTTTTTGG - Intergenic
1117886577 14:60370571-60370593 GCATGGCAGCATGTGCTTCTGGG - Intergenic
1118416981 14:65550127-65550149 TAATGCCAGCATCTGCTTCTGGG + Intronic
1118742435 14:68749448-68749470 GAATTTCACCATCTTCTTCTTGG - Intergenic
1120032867 14:79662661-79662683 GCATAGCAGCATCTGCTTCTGGG + Intronic
1120774305 14:88416072-88416094 CAATGCCAGCATCTGCTTCAGGG - Intronic
1120878470 14:89395970-89395992 AAAGGACCTGATCTGCTTCTTGG - Intronic
1121148008 14:91603631-91603653 GCATGGCAGCATCAGCTTCTGGG + Intronic
1121678798 14:95775860-95775882 GCATGGCAGCTTCTGCTTCTGGG + Intergenic
1121814014 14:96915280-96915302 GCATGGCAGCATCTGCTTCTGGG - Intronic
1122039344 14:98972665-98972687 TAGTGCCAGCATCTGCTTCTGGG + Intergenic
1122043931 14:99010139-99010161 GCATAACAGCTTCTGCTTCTGGG + Intergenic
1122438692 14:101715804-101715826 GCATGGCAGCATCTGCCTCTGGG - Intergenic
1123100847 14:105798830-105798852 GCATGGCAGCCTCTGCTTCTGGG - Intergenic
1124899982 15:33813316-33813338 AACTGAAATCATCTGCTCCTGGG + Intronic
1125173906 15:36798070-36798092 CACTGACATCTTCTTCTTCTAGG + Intronic
1125274794 15:37978833-37978855 GCATGGCGGCATCTGCTTCTGGG + Intergenic
1125457264 15:39872652-39872674 TAATGTCAGCAACTGCTTCTAGG + Intronic
1125810582 15:42537338-42537360 GAATGAGATCATCTCATTGTAGG - Intronic
1126376946 15:48006323-48006345 GAGTTACATCAGCCGCTTCTTGG + Intergenic
1126544186 15:49854275-49854297 GCATGTCAGCATCTGCTTCTGGG - Intergenic
1126562828 15:50062403-50062425 GCATAGCAGCATCTGCTTCTGGG - Intronic
1126814917 15:52445349-52445371 GCATGGCGGCATCTGCTTCTAGG - Intronic
1127007003 15:54581955-54581977 GTATGACCTCCTCTCCTTCTAGG - Intronic
1127440256 15:58999802-58999824 GCGTGGCAGCATCTGCTTCTGGG + Intronic
1127577444 15:60305654-60305676 GTATGGCAACATCTGTTTCTGGG + Intergenic
1128284542 15:66425545-66425567 GCAGGAAATCAGCTGCTTCTGGG + Intronic
1128679980 15:69643440-69643462 GCGTGGCAGCATCTGCTTCTGGG + Intergenic
1129260253 15:74362652-74362674 CAATGATGTCATCTTCTTCTTGG - Intronic
1131221953 15:90591832-90591854 AACTGACATCAGGTGCTTCTTGG - Intronic
1131338345 15:91571985-91572007 GGATGAAATAATCTGATTCTAGG - Intergenic
1131377673 15:91939129-91939151 TAGTGCCAGCATCTGCTTCTGGG + Intronic
1131648662 15:94375061-94375083 GCATGACAGCTTCTGCTTCTTGG + Intronic
1131969712 15:97879727-97879749 GCATAGCAGCATCTGCTTCTAGG + Intergenic
1133202241 16:4211073-4211095 TATTGAAATCACCTGCTTCTTGG + Intronic
1133499079 16:6348321-6348343 AGATGACACCATATGCTTCTTGG + Intronic
1134218508 16:12335076-12335098 AAATGACATCATCTGCAGCAGGG + Intronic
1134360142 16:13523513-13523535 GCATAGCAGCATCTGCTTCTGGG + Intergenic
1134487866 16:14672894-14672916 GGCTGACATCACCTGCTTCCTGG - Intronic
1134529351 16:14970872-14970894 GAAAGTGATCATCTGGTTCTAGG + Intergenic
1134775227 16:16847083-16847105 GAATGACATCACTGGCTTCCTGG + Intergenic
1135503068 16:23013851-23013873 GCATAGCAGCATCTGCTTCTGGG - Intergenic
1138578610 16:57924919-57924941 GCATGGCAGCATCTACTTCTGGG - Intronic
1139867000 16:70070082-70070104 GAAAGTGATCATCTGGTTCTAGG - Intergenic
1140343384 16:74188170-74188192 GCATGGCAGCATCTGCTTCGGGG + Intergenic
1140967221 16:79978359-79978381 GCATGGCAGCATCTGCTGCTAGG - Intergenic
1141153635 16:81581966-81581988 GCATGGCAGCATCAGCTTCTGGG + Intronic
1141537557 16:84693042-84693064 GAATGACCTCATTTAATTCTTGG - Intergenic
1141844417 16:86597557-86597579 GGATGAATTCATCTGCTTTTTGG + Intergenic
1142914879 17:3128185-3128207 GAATGACATGAGCTGCAGCTGGG - Intergenic
1143166280 17:4898837-4898859 CCTTGACAACATCTGCTTCTGGG - Exonic
1144218950 17:13082830-13082852 GAGCGCCAGCATCTGCTTCTGGG + Intergenic
1144221207 17:13101437-13101459 GAATGGCGGCATCAGCTTCTGGG - Intergenic
1144468484 17:15516074-15516096 GCATGAGAACATCTGCTTCTGGG - Intronic
1146555728 17:33822098-33822120 GAATGACATAACCTACTTCCTGG + Intronic
1147757489 17:42778657-42778679 GAATGACACCATCTGCTTCAGGG - Intronic
1148069687 17:44901007-44901029 GAATGACATCATCAACTTCAAGG + Exonic
1148992378 17:51677458-51677480 GCATGGCAGCATCTGCTTCTGGG - Intronic
1149020701 17:51961016-51961038 GAATGTCTTCTTCTGCTTCAGGG - Intronic
1149914592 17:60597562-60597584 GAATGACTTGATCTGATTCATGG + Intergenic
1150739697 17:67769432-67769454 GCATAACGGCATCTGCTTCTGGG - Intergenic
1150822850 17:68449706-68449728 GCACGGCAGCATCTGCTTCTGGG - Intronic
1150978691 17:70118505-70118527 TAATGCCAGCACCTGCTTCTGGG + Intronic
1151270080 17:72987226-72987248 TAGTGCCAGCATCTGCTTCTGGG - Intronic
1151382742 17:73736797-73736819 GCATGGCGGCATCTGCTTCTGGG - Intergenic
1151506478 17:74531159-74531181 GACTGACATCGTGTGCTTCGGGG - Intronic
1151905245 17:77043815-77043837 GCATGGCAGCGTCTGCTTCTGGG + Intergenic
1152213347 17:79016980-79017002 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1153588109 18:6644866-6644888 GCATAGCAGCATCTGCTTCTGGG + Intergenic
1155465310 18:26128138-26128160 GCATAACAGCTTCTGCTTCTGGG - Intergenic
1155889517 18:31249202-31249224 GAATTATATCATCTGCTCTTTGG - Intergenic
1157488198 18:48104388-48104410 TGGTGCCATCATCTGCTTCTGGG - Intronic
1157854127 18:51088725-51088747 TAATCACATCATCTGCAACTAGG - Intergenic
1158000373 18:52611416-52611438 GAAAGAATTCATCTGCCTCTCGG - Intronic
1159077168 18:63693884-63693906 GAATGAGATCATTTCCTTTTCGG + Intronic
1159218666 18:65429747-65429769 GCATGGCAGCACCTGCTTCTGGG - Intergenic
1159516836 18:69469881-69469903 AAGTGACGGCATCTGCTTCTGGG + Intronic
1159522721 18:69546957-69546979 GCATGACAGCATCTGCTTCTGGG + Intronic
1159763157 18:72453765-72453787 GCATAGCAGCATCTGCTTCTGGG - Intergenic
1161151479 19:2712357-2712379 GCATGGCAGCAGCTGCTTCTGGG - Intergenic
1164098015 19:22029258-22029280 GAGTCACATCATCTACTTGTTGG + Intergenic
1164170070 19:22717174-22717196 AAGTGACATCATCTGCTTGCTGG + Intergenic
1164307978 19:24021804-24021826 GAAGGTGAGCATCTGCTTCTGGG + Intergenic
1164871420 19:31647494-31647516 GTATGGCAGCTTCTGCTTCTGGG + Intergenic
1164885238 19:31773174-31773196 GAAAGACATCAGGTGCTTCTGGG - Intergenic
1165216776 19:34280032-34280054 GTATGGCAGCATCTGCTCCTGGG + Intronic
1165408820 19:35645936-35645958 GTATGAGATCGTCTGCCTCTGGG - Intergenic
1165531729 19:36408476-36408498 TTATGATATGATCTGCTTCTAGG - Intronic
1166033518 19:40150623-40150645 GCATGGCAGCGTCTGCTTCTGGG - Intergenic
1167008318 19:46789296-46789318 GAATGACTTCCTCTGCCTCTGGG - Intergenic
1167837552 19:52086464-52086486 GCATGGCGACATCTGCTTCTGGG - Intronic
1167838318 19:52093654-52093676 GAATGAGATCAGCTGATTATTGG + Intronic
1167842412 19:52132705-52132727 GCATGGCAACATCTGCTTCTGGG - Intronic
1167846466 19:52169150-52169172 GAATGACGTCAGCTGATTATAGG + Intronic
1168154443 19:54465100-54465122 GAACGACGTCATCGGCCTCTAGG - Exonic
1168658035 19:58145861-58145883 AAGTGACATCATGTTCTTCTTGG - Intronic
924963179 2:52320-52342 GCATGGCAGCATTTGCTTCTGGG - Intergenic
925061941 2:898090-898112 GCATGGCAGCATCTGCTTCTGGG - Intergenic
925096894 2:1212358-1212380 GCATGGCAGCTTCTGCTTCTAGG - Intronic
925389326 2:3484712-3484734 GGCTGACAGCATCTGCTGCTAGG - Intronic
925612363 2:5712457-5712479 GCATGACAGCATCAGCTTCTGGG + Intergenic
926227082 2:10974624-10974646 GCATGGCAGCTTCTGCTTCTGGG + Intergenic
926547711 2:14262642-14262664 GCATGACAGCATCTGCTTTGGGG + Intergenic
926950962 2:18242956-18242978 GCATGGCAGCATCTGCTTCTGGG - Intronic
927127922 2:20030289-20030311 GCATGGCAGCATCAGCTTCTGGG + Intergenic
927311743 2:21639361-21639383 GCATAGCAGCATCTGCTTCTGGG + Intergenic
927360470 2:22226479-22226501 AGATGATATCATCTGATTCTTGG + Intergenic
927459838 2:23288866-23288888 GAAGGACATCCAATGCTTCTTGG + Intergenic
928619833 2:33077419-33077441 GCACGGCAGCATCTGCTTCTGGG + Intronic
928692724 2:33817433-33817455 GCATGGCAGCTTCTGCTTCTGGG + Intergenic
928719478 2:34102790-34102812 GCATGGCAGCATCTGCTTCTGGG + Intergenic
929343476 2:40851869-40851891 GAATGACAAGAAATGCTTCTGGG - Intergenic
929828392 2:45328400-45328422 AAATGACTTTATATGCTTCTGGG - Intergenic
930832221 2:55757296-55757318 GCATGGCAGCATCTGCTTCTGGG + Intergenic
932334439 2:70922013-70922035 GAATGACATCATCTGCTTCTTGG - Intronic
933071093 2:77858475-77858497 GCATGGCAGCATCTGGTTCTGGG - Intergenic
934918061 2:98316904-98316926 GCATGGCAGCATCTGCTTCTGGG - Intergenic
935028917 2:99303527-99303549 GAACGACCTCCTCAGCTTCTAGG - Intronic
935228599 2:101076900-101076922 GCATGGCAACTTCTGCTTCTGGG + Intronic
935370741 2:102344047-102344069 GCATGGCGGCATCTGCTTCTGGG + Intronic
935507977 2:103931366-103931388 GCATAGCATCATCTGCTTCTGGG + Intergenic
935878852 2:107540880-107540902 GAGTGACAGCCCCTGCTTCTGGG - Intergenic
936474480 2:112827876-112827898 GCATGGCAGCATCTGCTTCTGGG + Intergenic
936775687 2:115970090-115970112 ACATGGCAGCATCTGCTTCTGGG + Intergenic
936777560 2:115992834-115992856 GCATAGCAGCATCTGCTTCTGGG - Intergenic
937120728 2:119438514-119438536 CAATAACATCACCTACTTCTGGG - Exonic
938017495 2:127879452-127879474 GCATAGCAGCATCTGCTTCTGGG - Intronic
938218657 2:129546149-129546171 GCATAGCAGCATCTGCTTCTGGG + Intergenic
938581242 2:132648375-132648397 TGATGACAGCATCTGCCTCTAGG - Intronic
939364542 2:141215261-141215283 TAATGCGAGCATCTGCTTCTGGG - Intronic
940005728 2:149008003-149008025 GAAGGAAATTTTCTGCTTCTGGG - Exonic
940269315 2:151874085-151874107 GCATGGCAGCATCTGCTTCTGGG - Intronic
940507201 2:154570843-154570865 GCATAGCAGCATCTGCTTCTGGG - Intergenic
940729907 2:157376596-157376618 GCATGGCAGCATCTGCTTCTTGG + Intergenic
941261681 2:163305897-163305919 GTATGGCAGCATCTGCTTCTGGG - Intergenic
941310730 2:163927713-163927735 GAATGAAATCATGTCCTTTTCGG + Intergenic
941416134 2:165224013-165224035 GCATGGCAGCAACTGCTTCTGGG + Intergenic
941553881 2:166951298-166951320 GCATGGCAGCATCAGCTTCTGGG + Intronic
941595319 2:167469304-167469326 GAATAACATTATCTGCTTTATGG + Intergenic
941728812 2:168892965-168892987 GAAGAGCAGCATCTGCTTCTAGG + Intronic
942154866 2:173117834-173117856 GAATGACATCATCTGACACAGGG - Intronic
942597884 2:177609350-177609372 GGATGGCAGCATCTGCTTCTGGG - Intergenic
942731764 2:179067681-179067703 GCATAGCAGCATCTGCTTCTGGG - Intergenic
943104632 2:183529183-183529205 GCATGACAGCATCTGCTTGTAGG - Intergenic
943142702 2:184002572-184002594 GGATGGCAGCATCTGCTTCTGGG + Intergenic
943587497 2:189758498-189758520 GCGTGGCAGCATCTGCTTCTGGG - Intronic
943832185 2:192477274-192477296 ACATGGCAGCATCTGCTTCTGGG - Intergenic
943832464 2:192479620-192479642 GCATGGCGGCATCTGCTTCTGGG - Intergenic
943893399 2:193320840-193320862 GCATGGCAGCATCTGCTTTTGGG - Intergenic
944785959 2:203070632-203070654 GCATGACAGCCTCTGCTTCTGGG + Intronic
945121948 2:206466843-206466865 GCATGGCAGCATCTGCTTCTGGG + Intronic
945122225 2:206468845-206468867 CCATGACAGCATCTGCTTCTGGG + Intronic
946799074 2:223390598-223390620 GCATAGCAGCATCTGCTTCTGGG + Intergenic
946898245 2:224346499-224346521 GCCTGGCAGCATCTGCTTCTGGG + Intergenic
947005704 2:225508927-225508949 GAAGGACATCAGCTGAGTCTAGG - Intronic
947035360 2:225847585-225847607 AAATGGCATCATATGCTACTGGG - Intergenic
947208621 2:227685257-227685279 GCGTGGCAACATCTGCTTCTAGG + Intronic
948247794 2:236501062-236501084 GCATGGCAGCATCTGCGTCTGGG + Intronic
948532881 2:238623939-238623961 CCATGGCAGCATCTGCTTCTGGG + Intergenic
948773297 2:240263643-240263665 GAATGATATGATTTGGTTCTGGG + Intergenic
949067595 2:242002809-242002831 GCATGGCAGCTTCTGCTTCTGGG - Intergenic
1169150052 20:3282531-3282553 AAATGACATGATCTGACTCTGGG - Intronic
1169311451 20:4544876-4544898 CAATGACATCATCTAGTCCTGGG + Intergenic
1169349157 20:4854300-4854322 GAATGTATTCATCTGCTTCTTGG - Exonic
1169630668 20:7627131-7627153 ATATGACAGCCTCTGCTTCTAGG - Intergenic
1170111741 20:12811707-12811729 TAAAGACATCATCTGGTCCTGGG - Intergenic
1170369514 20:15633455-15633477 GAATGGCATTTTCTGGTTCTGGG - Intronic
1170456633 20:16539639-16539661 GCATAGCAGCATCTGCTTCTGGG - Intronic
1170638274 20:18128660-18128682 GCATAGCAGCATCTGCTTCTGGG + Intergenic
1173683632 20:44907247-44907269 GAATGACCTTATCTGTTTCCTGG + Exonic
1174095090 20:48082536-48082558 GCATGGTAGCATCTGCTTCTGGG + Intergenic
1174159491 20:48540847-48540869 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1174679908 20:52396339-52396361 TAAAGAAATAATCTGCTTCTGGG + Intergenic
1174949627 20:55029799-55029821 GCATGGCAACACCTGCTTCTAGG + Intergenic
1175656249 20:60773571-60773593 AAATGCCATCATCTGGTTGTGGG - Intergenic
1176898047 21:14406204-14406226 GCATAACAGCATCTGCTTCCTGG - Intergenic
1177179907 21:17734036-17734058 GCATGGCAGCTTCTGCTTCTGGG + Intergenic
1178320998 21:31605599-31605621 GCATGGCAGCTTCTGCTTCTGGG - Intergenic
1178402814 21:32301483-32301505 GCATGGCAGCTTCTGCTTCTGGG - Intronic
1178425134 21:32473192-32473214 CTATGAAATCATTTGCTTCTTGG + Intronic
1178450213 21:32691380-32691402 GAATGGCAGCATCTGCTTCTGGG - Intronic
1178625054 21:34209132-34209154 GTGTGACAGCATCAGCTTCTGGG - Intergenic
1178729409 21:35085796-35085818 GCATAACAGCTTCTGCTTCTGGG - Intronic
1179024768 21:37670811-37670833 GAATAACATCCTGTGCTTATAGG - Intronic
1180757092 22:18169662-18169684 GCATGGCAGCATCTGCTTCTAGG - Intronic
1180990724 22:19934145-19934167 GAATGACAACACCTGCTGCCAGG - Intronic
1181074686 22:20367803-20367825 GCATGGCAGCATCTGCTTCTAGG + Intronic
1182084565 22:27552401-27552423 GCATGGTAGCATCTGCTTCTGGG - Intergenic
1182995970 22:34812733-34812755 ACATGACAGCATCTGCTTCTGGG - Intergenic
1183041243 22:35179757-35179779 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1183286023 22:36964567-36964589 GAATGACCTCACCTGCTTTGTGG + Intergenic
1184132085 22:42522878-42522900 GCATGGCTGCATCTGCTTCTGGG - Intergenic
949196528 3:1316303-1316325 GCATAACAGCTTCTGCTTCTGGG + Intronic
949285301 3:2395755-2395777 GAATGACATCATGTCATTCATGG - Intronic
949449600 3:4170882-4170904 GACTGACTTCATCTGCTTCTGGG - Intronic
949515429 3:4803042-4803064 GCATGGCAGCATCTGCTTCTGGG + Intronic
949607946 3:5675180-5675202 GTATGGCAGCATCTGCTTCTGGG + Intergenic
949772799 3:7597125-7597147 GCATGGCAACATTTGCTTCTGGG + Intronic
950320882 3:12051786-12051808 GTATAACAACATCTGCTTCAAGG + Intronic
950598474 3:14008224-14008246 GTATGACAGCATCTGCTTCTGGG - Intronic
950732448 3:14972731-14972753 GCACGGCAGCATCTGCTTCTGGG + Intronic
951087531 3:18531176-18531198 GCATGGCAGCATCTCCTTCTGGG - Intergenic
951885121 3:27516692-27516714 TAGTGACGTCATCTGGTTCTGGG + Intergenic
951998085 3:28754133-28754155 GAATGAGATAATTTCCTTCTTGG + Intergenic
952063518 3:29539909-29539931 GAAGGAAATCATCTTTTTCTTGG + Intronic
952074298 3:29676970-29676992 GCATGACAGTATCTGCTTCTGGG + Intronic
952532686 3:34278582-34278604 GAATGACAAAATCAGATTCTTGG - Intergenic
952870866 3:37899973-37899995 GAATGACATGACCTACTTCATGG - Intronic
953125208 3:40086303-40086325 GAATCACATCCATTGCTTCTGGG - Intronic
953206728 3:40837854-40837876 GAATGCTTTCATCTGCTTGTTGG - Intergenic
953321836 3:41979575-41979597 TAGTGCCAGCATCTGCTTCTGGG + Intergenic
953706642 3:45236142-45236164 GCATGGCAGCATCTGCTTCTGGG - Intergenic
953962951 3:47281207-47281229 GAGTGACATCATATGCCCCTTGG - Intronic
953981237 3:47414218-47414240 GGATGACCTCATCAGCATCTGGG - Exonic
953992008 3:47491322-47491344 GCATGGCAGCATCTGCTTCTGGG + Intergenic
954033163 3:47834896-47834918 GAATGAAATCATCAGCTCATAGG - Intronic
954124917 3:48522466-48522488 GAGTGACATCAGCTGCCACTGGG + Intronic
955636137 3:61031729-61031751 AAATGCCATCATCAGCTTCAAGG + Intronic
956378351 3:68639703-68639725 AAATTGCCTCATCTGCTTCTAGG + Intergenic
956858004 3:73294692-73294714 TAATGACCTCATTTGCATCTGGG + Intergenic
956861480 3:73328263-73328285 GCATGGCAGCATCTGCTTTTGGG + Intergenic
956888705 3:73587806-73587828 GAATGACATCATGTCATTCAAGG - Intronic
957768400 3:84657195-84657217 GCCTGGCAGCATCTGCTTCTGGG - Intergenic
957768695 3:84659379-84659401 GCATGGCAGCATCTGCTTCTGGG - Intergenic
958846108 3:99266837-99266859 TAGTGCCAGCATCTGCTTCTGGG + Intergenic
959037633 3:101384857-101384879 GCATAGCAGCATCTGCTTCTGGG - Intronic
959105102 3:102056896-102056918 GCATGGCAGCATCTGCTTCTGGG + Intergenic
959543015 3:107561688-107561710 ATATGACAATATCTGCTTCTGGG + Intronic
960059986 3:113310917-113310939 GCATGGCAGCACCTGCTTCTGGG - Intronic
960150531 3:114244658-114244680 GCATGGCAGCATCTGCTTCTGGG - Intergenic
960150784 3:114246694-114246716 GCATGGCAGCATCTGCTTCTGGG - Intergenic
960189802 3:114689612-114689634 TAATGATAGCATTTGCTTCTTGG - Intronic
960604631 3:119492315-119492337 GGATGACATCACCTGTTACTGGG + Exonic
960959714 3:123061728-123061750 GTATGGCAGCATCTGCTTCTGGG + Intergenic
963096316 3:141545337-141545359 GCATGGCAGCATCTGCTTCTGGG + Intronic
963217656 3:142767791-142767813 GAATGACATCTTTTGCTTAATGG + Intronic
963834270 3:150040641-150040663 GGAAGCCATCTTCTGCTTCTGGG - Intronic
964196436 3:154070320-154070342 GCATGGCAGCATTTGCTTCTGGG + Intergenic
964528671 3:157643776-157643798 GCATAGCAGCATCTGCTTCTGGG + Intronic
964718926 3:159752522-159752544 GCATGACAGCATCTGCTTCTGGG + Intronic
965990567 3:174812053-174812075 GTAGGGCAGCATCTGCTTCTGGG - Intronic
966056992 3:175705803-175705825 GAATGAGATGATCTGGGTCTGGG - Intronic
966641191 3:182192243-182192265 CAGTGCCAGCATCTGCTTCTGGG - Intergenic
967237763 3:187403645-187403667 GATTGACAACTTCTTCTTCTGGG - Intergenic
968528178 4:1075369-1075391 GCATGGCAACAGCTGCTTCTGGG + Intronic
969095880 4:4732308-4732330 ACATGGCAGCATCTGCTTCTGGG - Intergenic
969625387 4:8302343-8302365 GAATGACACCTGCTGCTTCCTGG + Intronic
970069933 4:12146495-12146517 GAATGACATCCACTGCTCCTTGG - Intergenic
970399759 4:15705917-15705939 GAATGGCAACATCTACTTCTGGG + Intronic
970669466 4:18379585-18379607 GAGTGACAGCAGCTACTTCTAGG - Intergenic
970836107 4:20409384-20409406 GAATGAGATCATGTCCTTTTAGG - Intronic
971405046 4:26314685-26314707 GCATGACAGCATCTGCTTCTGGG - Intronic
971599635 4:28575924-28575946 CAGTGAGAGCATCTGCTTCTAGG + Intergenic
971620052 4:28844548-28844570 GCATGGTAGCATCTGCTTCTGGG - Intergenic
971640126 4:29120345-29120367 ACATGGCAGCATCTGCTTCTGGG - Intergenic
971641049 4:29133674-29133696 GAACTATATCATCAGCTTCTTGG - Intergenic
971712237 4:30129270-30129292 GCATGGCAGCATCTGCTTCTGGG - Intergenic
971748021 4:30610653-30610675 GCATGGTAACATCTGCTTCTGGG + Intergenic
971755081 4:30697210-30697232 GCATGGCAGCATCTGCTTCTAGG + Intergenic
972069388 4:34996320-34996342 GCAAGGCAGCATCTGCTTCTGGG + Intergenic
972367670 4:38391600-38391622 GCATGGCAGCAACTGCTTCTGGG - Intergenic
972368014 4:38393909-38393931 GCATGTCAGCATCTGCCTCTGGG - Intergenic
972988705 4:44797731-44797753 CCATGGCAGCATCTGCTTCTGGG - Intergenic
972994903 4:44868648-44868670 TAATGACCTCTGCTGCTTCTTGG + Intergenic
973046504 4:45540545-45540567 GCATGGCAGCTTCTGCTTCTGGG - Intergenic
973316997 4:48771767-48771789 AAATGACAGCATGTTCTTCTGGG - Intronic
974122970 4:57662478-57662500 CAAAGACATCATCTGCTGCTGGG - Intergenic
974364347 4:60926970-60926992 GAATAATTTCAGCTGCTTCTGGG - Intergenic
975991658 4:80264985-80265007 GACTGAAATCACCTTCTTCTGGG - Intergenic
976284541 4:83358616-83358638 GAATGACATAATCTTTTCCTTGG + Intergenic
976306116 4:83560920-83560942 GCATGGCAGCATCTGCTTCTGGG - Intronic
977008720 4:91607814-91607836 GAATGGCTTCATCAGTTTCTGGG - Intergenic
977034185 4:91928382-91928404 GTATGGCAGCATCTGCTTCTGGG - Intergenic
978226904 4:106346927-106346949 GCATGGCAGCATCTGCTTCTGGG + Intronic
978322827 4:107516662-107516684 GAAGCATAGCATCTGCTTCTGGG - Intergenic
978872297 4:113594031-113594053 GTATGGCAGCATTTGCTTCTGGG + Intronic
979027833 4:115598796-115598818 GCATGACAGCATCTGTTTCTGGG - Intergenic
979166544 4:117539679-117539701 GTATGGCAGCATCTGCTTCTGGG - Intergenic
979352638 4:119662988-119663010 GCATGGCAGAATCTGCTTCTGGG - Intergenic
979603011 4:122606700-122606722 GCATGGCTGCATCTGCTTCTGGG - Intergenic
979669503 4:123347173-123347195 GGATGCCACCATCTGCATCTGGG - Intergenic
980666311 4:135941247-135941269 CAGTGCCAGCATCTGCTTCTGGG - Intergenic
980910439 4:138989166-138989188 GCATGGCAGCTTCTGCTTCTGGG - Intergenic
980910817 4:138992811-138992833 TAATGAAACCTTCTGCTTCTAGG - Intergenic
980953354 4:139403861-139403883 GCATGGCAGCATCTGCTTCTGGG + Intronic
981333303 4:143537979-143538001 GATTGTCAGCCTCTGCTTCTAGG + Intronic
981631364 4:146822399-146822421 GAATGAGATCATGTGCTTTGTGG - Intronic
982503563 4:156190646-156190668 GTAAGACATCATCAGCTTCTTGG + Intergenic
983010529 4:162540150-162540172 GCATGGCAGCATCTGCTTCTGGG + Intergenic
983357340 4:166680477-166680499 GAATGCCAGCATCTGTTTTTGGG - Intergenic
983804924 4:171982971-171982993 GAATGTAACCATCTGCTTCATGG + Intronic
984365413 4:178793084-178793106 GCATGGCGGCATCTGCTTCTGGG - Intergenic
984693901 4:182759833-182759855 TAGAGATATCATCTGCTTCTTGG + Intronic
985436280 4:189932324-189932346 TAGTGCCAACATCTGCTTCTGGG + Intergenic
986046863 5:4046428-4046450 GCATGGCAGCTTCTGCTTCTGGG - Intergenic
986916237 5:12624175-12624197 GCATAACAGCATCTGTTTCTGGG - Intergenic
986969103 5:13311273-13311295 GAGTTACATCATTTGCTTCCCGG - Intergenic
986975575 5:13389453-13389475 GCATGGCATCATCTGCTTCTGGG + Intergenic
987275759 5:16360975-16360997 GCATGGAAGCATCTGCTTCTGGG + Intergenic
987342431 5:16950668-16950690 GCATGGCAGCATCTGCTTCTGGG - Intergenic
987463606 5:18245578-18245600 GTATGGCAGCTTCTGCTTCTGGG - Intergenic
987693785 5:21302131-21302153 GCATAGCAGCATCTGCTTCTGGG + Intergenic
988934063 5:36065489-36065511 AAATGACATCAACTCCTTCTTGG + Intronic
989165587 5:38430838-38430860 GACTTACATCATCAGCTTCCTGG - Intronic
990095486 5:52107175-52107197 GCATGGCAGCATCTGCTTCTAGG + Intergenic
990318168 5:54603539-54603561 AAATTACATCATCTTCCTCTGGG - Intergenic
990405910 5:55490750-55490772 GAATGACATCAAGTTGTTCTGGG + Intronic
990439717 5:55832451-55832473 GTATAGCAGCATCTGCTTCTGGG - Intergenic
990560871 5:56981550-56981572 GTATAACAGCATCTGCTTCTGGG - Intergenic
991028594 5:62058447-62058469 GCATAGCAACATCTGCTTCTAGG + Intergenic
991140886 5:63241140-63241162 GAATTTCATCATATGCTTTTTGG + Intergenic
991302008 5:65137855-65137877 CAACGTCATCCTCTGCTTCTTGG - Intergenic
991364425 5:65853504-65853526 GCATATCAGCATCTGCTTCTTGG - Intronic
991746472 5:69747408-69747430 GCATAGCAGCATCTGCTTCTGGG - Intergenic
991751233 5:69807833-69807855 GCATAGCAGCATCTGCTTCTGGG + Intergenic
991798073 5:70327353-70327375 GCATAGCAGCATCTGCTTCTGGG - Intergenic
991825850 5:70622722-70622744 GCATAGCAGCATCTGCTTCTGGG - Intergenic
991830521 5:70682727-70682749 GCATAGCAGCATCTGCTTCTGGG + Intergenic
991890413 5:71326675-71326697 GCATAGCAGCATCTGCTTCTGGG - Intergenic
992942756 5:81778901-81778923 GTATGATGTGATCTGCTTCTTGG + Intergenic
993005553 5:82425036-82425058 GCATGGCAGCATCTGCTTCTAGG + Intergenic
993686763 5:90946777-90946799 GAATGAGATCATGTCCTTTTCGG - Intronic
994077340 5:95668017-95668039 GCATGGCAGCATCAGCTTCTGGG - Intronic
994413917 5:99443572-99443594 TAGTGCCAGCATCTGCTTCTGGG - Intergenic
994507830 5:100664574-100664596 GCATGGAAGCATCTGCTTCTAGG + Intergenic
994739999 5:103606172-103606194 GCATGGCACCATCTCCTTCTGGG + Intergenic
994841118 5:104926233-104926255 GAATGAGATCATGTCCTTTTCGG - Intergenic
995533415 5:113112673-113112695 GAATGAAATCATCAACTTTTAGG - Intronic
997183669 5:131859605-131859627 ACATGGCAGCATCTGCTTCTGGG - Intronic
998661693 5:144245840-144245862 GCATGGCAGCATTTGCTTCTGGG - Intronic
999571442 5:152924406-152924428 GCATAGCAGCATCTGCTTCTGGG - Intergenic
1000561221 5:162791894-162791916 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1000767544 5:165310402-165310424 GCATGGCAGAATCTGCTTCTGGG - Intergenic
1001323589 5:170702713-170702735 TAATCACATCATCTGCTTGATGG - Intronic
1001655124 5:173343450-173343472 GCATGGCAGCACCTGCTTCTGGG + Intergenic
1003168849 6:3704441-3704463 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1003190730 6:3872079-3872101 GCGTGGCAGCATCTGCTTCTGGG + Intergenic
1003403209 6:5807772-5807794 CAGTGCCAACATCTGCTTCTGGG - Intergenic
1003745943 6:9002221-9002243 GCATGACAGTATCTGCTTCTGGG - Intergenic
1004143012 6:13038158-13038180 TAATAACAGCATCTGCTTCATGG - Intronic
1004776346 6:18850190-18850212 AAATGACATCATGTGCCTCCTGG - Intergenic
1005113871 6:22315099-22315121 TAGTGCCAGCATCTGCTTCTGGG + Intergenic
1005221327 6:23592092-23592114 GAAGGATAGCATCTGCTTCTGGG - Intergenic
1005557124 6:26997806-26997828 GCATAGCAGCATCTGCTTCTGGG - Intergenic
1006117166 6:31781537-31781559 TCATGACATCCTCTTCTTCTGGG - Exonic
1006239745 6:32666759-32666781 GAAGGACCTCATCTGTCTCTGGG + Intronic
1006248901 6:32763634-32763656 GAAGGACCTCATCTGCCTCTGGG + Intergenic
1007361692 6:41361279-41361301 GCATGGCAGCGTCTGCTTCTGGG - Intergenic
1007975120 6:46093954-46093976 GCATAGCAGCATCTGCTTCTGGG + Intergenic
1008976834 6:57437040-57437062 GCGTGGCAACATCTGCTTCTGGG + Intronic
1009813620 6:68702107-68702129 GTATAGCAACATCTGCTTCTGGG + Intronic
1010249306 6:73691904-73691926 GCATGTCAGCATCTGCTTCTAGG + Intergenic
1010935129 6:81851349-81851371 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1010942978 6:81941066-81941088 GATTGACATCACCTGCTGATAGG - Intergenic
1011157062 6:84344553-84344575 GCATAGCAGCATCTGCTTCTGGG - Intergenic
1011176216 6:84563785-84563807 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1011381641 6:86748279-86748301 GAATGACATATTCTCCTGCTTGG - Intergenic
1012017835 6:93874435-93874457 GCATGACAGTATCTGCTTCTGGG - Intergenic
1014044023 6:116862728-116862750 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1014124950 6:117766424-117766446 GCATAGCAGCATCTGCTTCTAGG - Intergenic
1014281246 6:119444499-119444521 GCATGACAAGATCTGCTTCTGGG - Intergenic
1015256780 6:131186334-131186356 TAATGCCAGCATCTCCTTCTGGG - Intronic
1015390692 6:132678247-132678269 CAGTGCCAGCATCTGCTTCTGGG + Intergenic
1015672578 6:135706866-135706888 TGATGCCAGCATCTGCTTCTGGG - Intergenic
1016200673 6:141403461-141403483 GAAATTCAACATCTGCTTCTGGG + Intergenic
1016414625 6:143819932-143819954 GCATAGCAGCATCTGCTTCTGGG + Intronic
1017330389 6:153191623-153191645 GCATGGCAGCATCTGCTTTTGGG + Intergenic
1017363637 6:153605952-153605974 TAATGCCAGCATCTGCTTCTGGG + Intergenic
1017812901 6:157996853-157996875 GCATGGCAGCATCTGCTTCTTGG - Intronic
1018074508 6:160200025-160200047 GCATAGCAGCATCTGCTTCTGGG + Intronic
1020336947 7:7069429-7069451 GAATAACGTCATCTCCTCCTTGG - Intergenic
1020375019 7:7475399-7475421 GAATGAAATATTCTGATTCTGGG + Intronic
1020421567 7:8012238-8012260 GCATCACTTCATCTGCTTTTTGG + Intronic
1020545147 7:9518760-9518782 GAATCACATCATCTGCAAATAGG - Intergenic
1020962953 7:14828859-14828881 GTAGGACATTATCTGCATCTGGG + Intronic
1021425158 7:20491175-20491197 GCATAGCATCTTCTGCTTCTGGG - Intergenic
1021607224 7:22420301-22420323 GGAGGACACCATCTGGTTCTAGG - Intronic
1021615287 7:22497791-22497813 GCATGGCAACATCTGCTTCTGGG + Intronic
1021779131 7:24084699-24084721 TAGTGCCAGCATCTGCTTCTGGG + Intergenic
1022377039 7:29823892-29823914 GCATAACGGCATCTGCTTCTGGG - Intronic
1022385544 7:29895636-29895658 TAATGCCAGCATTTGCTTCTTGG + Intronic
1023118263 7:36883698-36883720 GCATCACAGCTTCTGCTTCTGGG - Intronic
1023269487 7:38446027-38446049 GCATGGCAGCATTTGCTTCTGGG - Intronic
1023524835 7:41089635-41089657 GCATAGCAGCATCTGCTTCTAGG - Intergenic
1023538885 7:41243420-41243442 AAATGACATCAGATGGTTCTAGG - Intergenic
1024115260 7:46186922-46186944 TAATGCCAGCATCTGCTGCTGGG + Intergenic
1024736874 7:52314760-52314782 GAAAGACATCTTGTGCTTATTGG + Intergenic
1024839671 7:53571055-53571077 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1024895979 7:54262865-54262887 GCATAACAGCATCAGCTTCTGGG + Intergenic
1025205710 7:56992358-56992380 GCATGCCATCATCTGCCACTTGG - Intergenic
1025666230 7:63584580-63584602 GCATGCCATCATCTGCCACTTGG + Intergenic
1025937492 7:66048944-66048966 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1025946542 7:66109117-66109139 GAAAGGCAGCATCTTCTTCTGGG - Intronic
1026205920 7:68257323-68257345 GAATGAGCCCATCTCCTTCTGGG - Intergenic
1026487589 7:70834894-70834916 GCATGGCAGTATCTGCTTCTGGG + Intergenic
1026509351 7:71015648-71015670 CGATGACCTCATCTGCTTCAGGG - Intergenic
1026547533 7:71336652-71336674 GAATGACATCATGTCCTTTGCGG - Intronic
1026932931 7:74234824-74234846 TGATGCCAGCATCTGCTTCTAGG - Intronic
1027713894 7:81644722-81644744 GAATGAGATCATCTCCTTTGCGG + Intergenic
1028206738 7:88026226-88026248 GCATGGCATCATCTGCTTCTGGG + Intronic
1028377206 7:90156841-90156863 GCATGGCAACATCTGCTTCTGGG - Intronic
1028448439 7:90952067-90952089 GAATGACTTGGTCTCCTTCTGGG - Intronic
1028634506 7:92972158-92972180 GAAGCATAGCATCTGCTTCTGGG + Intergenic
1029034348 7:97503366-97503388 GCATGGCAGCATCTGCTTCCGGG + Intergenic
1029917736 7:104229793-104229815 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1030272808 7:107687841-107687863 GCATGACATCACCTGCTAGTTGG - Intronic
1030304951 7:108008391-108008413 GAAAGACAGTCTCTGCTTCTGGG - Intergenic
1030577993 7:111314070-111314092 GCATAGCAGCATCTGCTTCTAGG - Intronic
1031078119 7:117232277-117232299 GCATAGCAGCATCTGCTTCTGGG + Intergenic
1031248368 7:119347569-119347591 GAATGATATCATCTGCAAATAGG + Intergenic
1032017387 7:128388778-128388800 CATTGACAACATCAGCTTCTGGG - Intergenic
1032288058 7:130558419-130558441 GCATGGCAGCATCTGCTTCTGGG - Intronic
1032856189 7:135835440-135835462 GCATGGCAACATCTGCTTTTGGG + Intergenic
1033313438 7:140279133-140279155 GCATAGCAGCATCTGCTTCTGGG - Intergenic
1033763433 7:144461707-144461729 TCATGTCAGCATCTGCTTCTGGG - Intronic
1033822039 7:145146731-145146753 GAATTACACCACCAGCTTCTTGG + Intergenic
1034108482 7:148513225-148513247 GCATAACAGCATCTGCTTCTAGG + Intergenic
1034875351 7:154720387-154720409 GAATGATAACATCTGCTTTGTGG - Intronic
1035827605 8:2661241-2661263 GGATGACATCATCTTCCACTTGG - Intergenic
1035865230 8:3075160-3075182 GTATGGCAGCATCTGCTTCTGGG - Intronic
1035983972 8:4404905-4404927 GACTGACATCATAGGCTTTTTGG - Intronic
1037008525 8:13810920-13810942 TAATGACTTCATTTGCCTCTAGG + Intergenic
1037072927 8:14674866-14674888 GCATGATGGCATCTGCTTCTGGG - Intronic
1037344077 8:17879668-17879690 GCATAGCAGCATCTGCTTCTGGG - Intronic
1037746455 8:21649394-21649416 GCATAGCAGCATCTGCTTCTGGG + Intergenic
1037973068 8:23188520-23188542 GCATGGCAGCTTCTGCTTCTAGG - Intergenic
1038172122 8:25145125-25145147 GCATGACAGCATTTGCTTCTGGG + Intergenic
1038687475 8:29731690-29731712 GCGTGGCAGCATCTGCTTCTGGG + Intergenic
1038823681 8:30977541-30977563 GCATGACAGCATCTGCTTCCGGG + Intergenic
1039161282 8:34624676-34624698 GCATAGCTTCATCTGCTTCTGGG + Intergenic
1040018659 8:42720954-42720976 AAATGAAATCACCTGCTTCTTGG - Intronic
1040098019 8:43467153-43467175 GCATGGCAGCATCTGTTTCTAGG + Intergenic
1041604889 8:59769858-59769880 GGATGCCATCTTCTTCTTCTGGG + Intergenic
1041834219 8:62193728-62193750 GGTTGACTTCATTTGCTTCTGGG + Intergenic
1041907936 8:63054047-63054069 TCATGTCATCATCTGCTTCTAGG + Intronic
1041964057 8:63654021-63654043 GCATAGCAGCATCTGCTTCTGGG + Intergenic
1042197264 8:66241709-66241731 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1042202086 8:66289020-66289042 GAAGGACATCAACAGCCTCTGGG + Intergenic
1042312090 8:67388878-67388900 GCATGGCAGCATCTGCTTCTAGG - Intergenic
1042733833 8:71965491-71965513 GCACGACAGCATCTGCTTCTGGG - Exonic
1042749234 8:72140026-72140048 GCATGGCAGCATCTGCTTCAGGG - Intergenic
1042996619 8:74706844-74706866 GAAGGGCATATTCTGCTTCTAGG + Intronic
1044046687 8:87444128-87444150 CAAGGACATCTTCTCCTTCTTGG + Intronic
1044566801 8:93670981-93671003 ACATGGCAGCATCTGCTTCTGGG - Intergenic
1044618900 8:94169888-94169910 GAATTATATTATCAGCTTCTTGG + Intronic
1044761331 8:95520780-95520802 GGATGGCAGCATCTGCCTCTGGG + Intergenic
1044894899 8:96881262-96881284 GCATGGCGGCATCTGCTTCTGGG + Intronic
1045495806 8:102707519-102707541 AGATGACATCAGCTGCTTCTGGG + Intergenic
1045925077 8:107573197-107573219 TAATATCATCATCTCCTTCTTGG - Intergenic
1045925331 8:107574969-107574991 GAGTAATATCATCTTCTTCTTGG - Intergenic
1046307302 8:112386116-112386138 GAATGACAGCATCTCTTCCTTGG - Intronic
1046659758 8:116937227-116937249 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1048025190 8:130579404-130579426 GCATGGCGGCATCTGCTTCTGGG - Intergenic
1049005224 8:139851066-139851088 CCATGACATCATCTGCTGCTTGG - Intronic
1049589085 8:143447640-143447662 GCATGGCAGCATCTGCTTCTGGG + Intronic
1049929615 9:443795-443817 GAATGACAAAATCTACTTCCAGG - Intronic
1050907941 9:11028363-11028385 TAGTGCCAACATCTGCTTCTGGG + Intergenic
1050918787 9:11172290-11172312 AACTGACATCAACTACTTCTTGG - Intergenic
1051453600 9:17226789-17226811 GCATAGCAACATCTGCTTCTGGG + Intronic
1051845048 9:21442226-21442248 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1051869192 9:21716687-21716709 CATTGACTGCATCTGCTTCTGGG - Intergenic
1052004422 9:23329373-23329395 GCATGTCAGCTTCTGCTTCTGGG - Intergenic
1052118848 9:24683250-24683272 GAATGACAGCATTTGATTTTAGG - Intergenic
1052144951 9:25037203-25037225 GCAAGGCAGCATCTGCTTCTGGG + Intergenic
1052193561 9:25684850-25684872 GAGTGCTAGCATCTGCTTCTGGG - Intergenic
1052362892 9:27578823-27578845 GCATGGCAGCATCAGCTTCTGGG + Intergenic
1052584122 9:30402774-30402796 TAATGACATCAAATGCCTCTGGG - Intergenic
1052768439 9:32665625-32665647 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1053387507 9:37706130-37706152 GAAAGACTCCCTCTGCTTCTAGG + Intronic
1053613620 9:39741381-39741403 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1053871661 9:42499337-42499359 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1054239894 9:62601016-62601038 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1054554027 9:66635543-66635565 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1054600772 9:67121347-67121369 GAATTACATCATTTTATTCTGGG - Intergenic
1054812134 9:69443316-69443338 GAATGACCTCATCTGCATCCAGG + Intronic
1054937023 9:70698888-70698910 GCATATCAGCATCTGCTTCTGGG - Intronic
1055089485 9:72348155-72348177 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1055856054 9:80690200-80690222 GTATGGCAGCATCTGCATCTGGG - Intergenic
1056468204 9:86879533-86879555 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1056502974 9:87228634-87228656 GCATGGTAGCATCTGCTTCTGGG - Intergenic
1056525756 9:87441573-87441595 TCATGGCAGCATCTGCTTCTGGG + Intergenic
1056887342 9:90456136-90456158 TAATGTCATCAACTGGTTCTTGG + Intergenic
1057325554 9:94060593-94060615 GCATGGCAGCATCGGCTTCTGGG + Intronic
1057325846 9:94062559-94062581 GCATGGCAGCATCTGCTTTTGGG + Intronic
1057506052 9:95634372-95634394 GTATGGCAGCATCAGCTTCTGGG - Intergenic
1057826748 9:98377696-98377718 GGAGGCCATCATCTGCTTATTGG + Intronic
1057872157 9:98726469-98726491 GACTGGCACCATCTGGTTCTGGG + Intergenic
1057937482 9:99253074-99253096 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1058001900 9:99874359-99874381 TTATGACATCATCTATTTCTTGG - Intergenic
1059011671 9:110468031-110468053 GCATAGCAGCATCTGCTTCTGGG - Intronic
1059716824 9:116921032-116921054 GTATGGCCACATCTGCTTCTGGG + Intronic
1060019717 9:120118519-120118541 GAATGGCAGCTTCTGCTACTGGG - Intergenic
1060178715 9:121516778-121516800 GCACGGCAGCATCTGCTTCTAGG - Intergenic
1060334261 9:122706532-122706554 GCATGGCAGCATATGCTTCTTGG + Intergenic
1060502355 9:124170562-124170584 TAGTGCCAGCATCTGCTTCTGGG + Intergenic
1060625883 9:125110888-125110910 GCATGGCAGCATCTGCTTCTGGG - Intronic
1060699063 9:125734999-125735021 GCATGGCAGCGTCTGCTTCTGGG + Intergenic
1060789051 9:126473489-126473511 GCATGGCAGCATCTGCTTCTGGG + Intronic
1185788964 X:2914017-2914039 GCATGGCAGCATCTGCTTCTGGG - Intronic
1185850092 X:3477144-3477166 GAATGAAATCATGTGCTTTGCGG - Intergenic
1185935796 X:4256485-4256507 GCATGACATCATCTCCTTCTGGG + Intergenic
1186003269 X:5038801-5038823 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1186120649 X:6357677-6357699 GCATGGCAGCATCTGCTTCATGG + Intergenic
1186455274 X:9705912-9705934 GCATGGCAGCATCTGCTTCTGGG + Intronic
1186689962 X:11964846-11964868 GCATGGCATCATCTCTTTCTGGG + Intergenic
1187083399 X:16015500-16015522 TAATGCCATCATCTGCTTCTGGG + Intergenic
1187217283 X:17289419-17289441 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1187633947 X:21205943-21205965 GAAAGACACCATGTGCTTGTGGG + Intergenic
1188495364 X:30777877-30777899 TAATGCCAGCATCTGCTGCTGGG - Intergenic
1188957482 X:36450264-36450286 GAGTAGCAGCATCTGCTTCTGGG + Intergenic
1189353012 X:40291160-40291182 GCATAGCAGCATCTGCTTCTGGG + Intergenic
1189748611 X:44195687-44195709 GAATGATATTATTTTCTTCTAGG + Intronic
1189775984 X:44470537-44470559 TACTGCCAGCATCTGCTTCTGGG + Intergenic
1190404471 X:50073034-50073056 GAATGAGATCATAAGCTTCTTGG - Intronic
1191897396 X:66007518-66007540 GCATAGCAGCATCTGCTTCTGGG - Intergenic
1192090596 X:68151887-68151909 GCATGGCAGCATCTGCTTCTGGG + Intronic
1192309817 X:70001454-70001476 GGCTGTCATCATATGCTTCTGGG + Intronic
1192936870 X:75869615-75869637 CTATGACAGCATCTGCTTCTGGG - Intergenic
1192937122 X:75871671-75871693 GTATGGCAGCATCTGCTTCCGGG - Intergenic
1192962088 X:76142170-76142192 TAATAACATCTTCTGTTTCTGGG - Intergenic
1192963445 X:76152917-76152939 TAATAACATCTTCTGTTTCTGGG + Intergenic
1193593820 X:83421816-83421838 GTATGGCAGCATCTGCTTTTGGG - Intergenic
1193758270 X:85435384-85435406 GCATGATGGCATCTGCTTCTAGG - Intergenic
1194039127 X:88918076-88918098 GCATAGCAGCATCTGCTTCTGGG + Intergenic
1194134354 X:90121449-90121471 GCATGGCATCATCTGCTTCTGGG - Intergenic
1194365065 X:93004679-93004701 TCATGATAGCATCTGCTTCTGGG - Intergenic
1194771362 X:97909828-97909850 GACTGAAATAATCTGTTTCTTGG + Intergenic
1194839104 X:98716202-98716224 GCATGGCAGCATCTACTTCTGGG - Intergenic
1195648341 X:107258392-107258414 GCATAGCAACATCTGCTTCTGGG + Intergenic
1195717207 X:107828217-107828239 TGATGCCAGCATCTGCTTCTAGG - Intronic
1196546764 X:116972579-116972601 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1196970342 X:121101048-121101070 GCATAGCAACATCTGCTTCTAGG + Intergenic
1197460699 X:126737042-126737064 GAGTGTCAGCATCTGCTTCTGGG + Intergenic
1198995430 X:142568524-142568546 GCATGGCAGCATCTGCTTCTGGG + Intergenic
1199088072 X:143652300-143652322 GAATAACATAAATTGCTTCTTGG - Intergenic
1199091942 X:143702824-143702846 TAGTGTCAACATCTGCTTCTAGG - Intergenic
1199242004 X:145557637-145557659 GAATGGCAGCATCTGCTTCTAGG - Intergenic
1199414703 X:147567915-147567937 GAATGACATCATGTTCTTTGTGG - Intergenic
1199474791 X:148233156-148233178 TAATGACATCAACTGCTACTTGG - Intergenic
1199681573 X:150228183-150228205 AGACGCCATCATCTGCTTCTTGG - Intergenic
1200050451 X:153426957-153426979 GCATGGCAGCATCTGCTTCTGGG - Intergenic
1200673293 Y:6120939-6120961 TCATGATAGCATCTGCTTCTGGG - Intergenic
1200758516 Y:7014367-7014389 GCATAACACCTTCTGCTTCTGGG - Intronic
1200844660 Y:7819411-7819433 GAATAACATTATCTGCATGTTGG + Intergenic
1201477404 Y:14397456-14397478 GCATGGCAGCATCTGCTTCTTGG - Intergenic
1201604062 Y:15765704-15765726 GACTGTCATCATCAGCTTTTAGG - Intergenic
1201720209 Y:17088965-17088987 GCATGGCATCATCTGATTCTGGG + Intergenic
1202039655 Y:20668506-20668528 GAAAGACCTCTTCTCCTTCTTGG + Intergenic
1202091754 Y:21198213-21198235 GCATGGTAGCATCTGCTTCTGGG - Intergenic
1202247667 Y:22836232-22836254 GAAACACATCACCTGATTCTTGG - Intergenic
1202259810 Y:22958670-22958692 GAATCACATCACCTGGTCCTGGG - Intergenic
1202400655 Y:24469980-24470002 GAAACACATCACCTGATTCTTGG - Intergenic
1202412796 Y:24592414-24592436 GAATCACATCACCTGGTCCTGGG - Intergenic
1202457985 Y:25077656-25077678 GAATCACATCACCTGGTCCTGGG + Intergenic
1202470125 Y:25200106-25200128 GAAACACATCACCTGATTCTTGG + Intergenic