ID: 932335053

View in Genome Browser
Species Human (GRCh38)
Location 2:70925971-70925993
Sequence CTCTGAGTATCCAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 263}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932335053_932335058 -10 Left 932335053 2:70925971-70925993 CCTTCTTCCCTGGATACTCAGAG 0: 1
1: 0
2: 3
3: 25
4: 263
Right 932335058 2:70925984-70926006 ATACTCAGAGGACCCAGGCATGG 0: 1
1: 0
2: 3
3: 24
4: 280
932335053_932335064 28 Left 932335053 2:70925971-70925993 CCTTCTTCCCTGGATACTCAGAG 0: 1
1: 0
2: 3
3: 25
4: 263
Right 932335064 2:70926022-70926044 AGAAAACACAGAGCTTGCTCAGG 0: 1
1: 0
2: 9
3: 20
4: 323
932335053_932335060 2 Left 932335053 2:70925971-70925993 CCTTCTTCCCTGGATACTCAGAG 0: 1
1: 0
2: 3
3: 25
4: 263
Right 932335060 2:70925996-70926018 CCCAGGCATGGTCCCAATTCAGG 0: 1
1: 0
2: 0
3: 17
4: 167
932335053_932335065 29 Left 932335053 2:70925971-70925993 CCTTCTTCCCTGGATACTCAGAG 0: 1
1: 0
2: 3
3: 25
4: 263
Right 932335065 2:70926023-70926045 GAAAACACAGAGCTTGCTCAGGG 0: 1
1: 0
2: 5
3: 53
4: 542

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932335053 Original CRISPR CTCTGAGTATCCAGGGAAGA AGG (reversed) Intronic
900120686 1:1047490-1047512 CTCTGGGTATCTGGGGAGGAAGG - Intronic
900437078 1:2635839-2635861 CCCTGGGTATCCAGGGCAGGAGG + Intergenic
900932654 1:5746860-5746882 CTCTGACTTTCCCGGGAAGGCGG - Intergenic
901308779 1:8252966-8252988 CTCTGAGTTTACAGGGGAGCTGG - Intergenic
901606511 1:10463383-10463405 CTCTGAGAATTCAGGGCTGATGG - Intronic
901652142 1:10749131-10749153 CTATGAGCACTCAGGGAAGACGG - Intronic
901758458 1:11455560-11455582 TGCTGTGGATCCAGGGAAGACGG + Intergenic
904319661 1:29688860-29688882 GTCTGAGCCTCCAGGGTAGAAGG - Intergenic
904645931 1:31966305-31966327 CTCTGAGAATGGAGGAAAGAGGG + Intergenic
906680644 1:47723518-47723540 TTCTGAGGAGCCAGGGAAGCAGG - Intergenic
908267133 1:62390447-62390469 GTCTGAGTTTTCAGTGAAGAAGG - Intergenic
910039247 1:82828436-82828458 CTCTGAGAATCCCTGGTAGATGG - Intergenic
910308897 1:85800676-85800698 CTCCCAGTTTCCAGGGATGACGG - Intronic
911685194 1:100767713-100767735 CTGTGAGTATGCAGAGAAAAAGG + Intergenic
912552740 1:110494666-110494688 CGCTGAGGATTCAGGGAGGAAGG - Intergenic
912754957 1:112316667-112316689 CTTGGAGTTTCCAGGGGAGAGGG + Intergenic
914005792 1:143731390-143731412 CTGTCAGTATCCAGGGAATGGGG - Intergenic
914258912 1:145982622-145982644 CTCTTTGTATCTAGGAAAGAAGG + Intergenic
916799305 1:168200795-168200817 CTCTGAGGTTGCATGGAAGATGG - Exonic
917147235 1:171905326-171905348 TTCTGAGTATGCAGGGAGTAAGG + Intronic
917186479 1:172362294-172362316 CTATGAGTGTCTAGGAAAGAGGG + Intronic
917380341 1:174399547-174399569 CTCAGATTACACAGGGAAGAAGG + Intronic
918557636 1:185822410-185822432 CTCTCAGTTTCCTGGAAAGATGG - Intronic
921341717 1:214140611-214140633 CTATAAGTACCCAGGGATGAAGG - Intergenic
921698789 1:218244078-218244100 GCCTGATTATCCTGGGAAGAAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924111927 1:240708636-240708658 CACTGACTTTCCAGGGAATAAGG - Intergenic
924584859 1:245353386-245353408 CTCTGAGAAGCCAGTAAAGATGG + Intronic
1063477010 10:6337697-6337719 CACCGAGGATGCAGGGAAGAAGG + Intergenic
1065020167 10:21496408-21496430 CTCTGAGGTCCCCGGGAAGAGGG + Intronic
1068251643 10:54449864-54449886 CTCTCAGTATCCATGGGGGATGG - Intronic
1068571317 10:58632525-58632547 TTCTGAGGACTCAGGGAAGATGG + Intronic
1068657052 10:59586747-59586769 CTCAGAGAAGCCAAGGAAGAAGG - Intergenic
1070145815 10:73772593-73772615 CTCCGAGTCTCCCGGGAAGTGGG - Exonic
1071334382 10:84589261-84589283 CTCTGAGACACCAGGGATGAGGG - Intergenic
1072314407 10:94188009-94188031 CTGTGAGTACCTAGGGAAGGGGG - Intronic
1073184506 10:101607611-101607633 CTCTGAGTCCCCAGGGCATAGGG + Intronic
1074538385 10:114345190-114345212 CTCTGTGTATCGGGGGAACATGG + Intronic
1074692080 10:116015402-116015424 CACATAGTCTCCAGGGAAGAGGG - Intergenic
1075816914 10:125271591-125271613 CTCTGAGGACCCTGGGAAAAGGG + Intergenic
1075856106 10:125631600-125631622 GTGTGAGGATCCAGAGAAGATGG + Intronic
1077360487 11:2138408-2138430 GTCTGATTGTCCAGGGAGGACGG + Intronic
1077613654 11:3660217-3660239 CTCTTCCTCTCCAGGGAAGAAGG - Exonic
1077866022 11:6222665-6222687 CTCTTAGAATCCAGGGAAAATGG - Intronic
1078467045 11:11558138-11558160 ATCTGAGAATCCAGGGGCGATGG - Intronic
1078730696 11:13971370-13971392 CTCTGAGTATCTGGAGAAGTAGG + Intronic
1079016092 11:16870184-16870206 CTCAGAATGTCCAGGGACGATGG + Intronic
1079022627 11:16922499-16922521 CTGTGAGTACCCAGGAATGAGGG - Intronic
1079523152 11:21352900-21352922 CACAGAGTACCCAGGTAAGAGGG - Intronic
1080860865 11:36149166-36149188 TTGGGAGTAGCCAGGGAAGATGG + Intronic
1083710620 11:64546236-64546258 CTTTGAGTAGCAAGGGTAGAGGG + Intergenic
1083760067 11:64810715-64810737 CCCTGAGTATCTCGGGAAGGAGG - Intronic
1084639981 11:70419813-70419835 CTTTGAGTATCAAGGCAAAACGG + Exonic
1085809209 11:79665375-79665397 CTTTGTGTATCCAGGTAAGATGG + Intergenic
1086047689 11:82552088-82552110 CTCTGAGTACACAGGAAGGAGGG + Intergenic
1086432673 11:86750381-86750403 TGCTGAGTATACAGTGAAGAGGG - Intergenic
1086514797 11:87599462-87599484 TTCTGAGTATACAGGGCAGGGGG - Intergenic
1088194554 11:107260551-107260573 CTCTGAGAGTCCAGGAAAGATGG + Intergenic
1088223991 11:107599009-107599031 CTCTGAGTATTTATGGAATAAGG + Intronic
1088624882 11:111722912-111722934 ATCTCAGTATCCATGGAGGATGG + Intronic
1089001951 11:115059564-115059586 CTCTTACTATGCTGGGAAGATGG - Intergenic
1089667583 11:120030233-120030255 CTCCAAGTGTCCAGGGAAGGAGG - Intergenic
1090737621 11:129624101-129624123 CTCTGTGCATCCAGGGAAGCTGG + Intergenic
1091663719 12:2403397-2403419 CTGTGAGGACCCAGGGAGGAGGG + Intronic
1091822801 12:3489307-3489329 CTGTGACTAACCAGGGAGGAGGG - Intronic
1096229011 12:49887277-49887299 TCCCGAGGATCCAGGGAAGAGGG + Intronic
1097013754 12:55971057-55971079 CTCAGAATCTCCAGGGAATAGGG - Exonic
1097343055 12:58461486-58461508 CCCTCAGTATCCATGGGAGATGG + Intergenic
1098096365 12:66960894-66960916 GTCAGAGTAGCCAGGGAAGGAGG - Intergenic
1098440837 12:70516077-70516099 CTCTGAAAATCCAGTTAAGATGG - Exonic
1100231929 12:92617729-92617751 CTCGAAGTGTCCATGGAAGATGG + Intergenic
1100426182 12:94488731-94488753 TTTTGACTATCCAGAGAAGAAGG + Intergenic
1101833942 12:108281923-108281945 CTCAGAGTATGCAGGGAACGTGG - Intergenic
1103860920 12:124013122-124013144 CTCTGAGCATCCACGCAGGATGG + Exonic
1104646866 12:130503762-130503784 CTCCGAGTTTCCAGGGAGGCTGG - Intronic
1104862953 12:131934294-131934316 CTCTGACTACCCTGGGGAGAGGG + Intronic
1105507469 13:21022984-21023006 CTCTGATTAGCCAGGAAAGGGGG + Intronic
1106175967 13:27331940-27331962 CCCTCAGTATCCATGGAGGATGG - Intergenic
1109932831 13:69238274-69238296 CTCAAAATATCCAGGGCAGATGG + Intergenic
1112433356 13:99372618-99372640 CTCTGAGTCTAAAGGGAAAATGG + Intronic
1114228842 14:20762460-20762482 CTCTGAGTTTCCTGGTAGGAGGG - Intergenic
1114327948 14:21608632-21608654 CTCTCAGTGTCCAGAGAAGTGGG - Intergenic
1114539255 14:23442781-23442803 CTCTGAGAAGCCAGGGCAGGGGG + Intergenic
1117004179 14:51402011-51402033 ATCTGAGTAACCAGGAAAGCTGG + Intergenic
1120687857 14:87559129-87559151 CTCTGAGTGTTCAGAGGAGAAGG + Intergenic
1121044199 14:90776032-90776054 CTCTGTGTATGCAGAAAAGAAGG + Intronic
1121288863 14:92758153-92758175 GTATGAGTACCCAGGGAAGGGGG - Intergenic
1124575626 15:30905418-30905440 ATCTGAGAATCCAGGGGTGAGGG - Exonic
1124591419 15:31057103-31057125 TTGAGAGCATCCAGGGAAGATGG + Intronic
1125501916 15:40245189-40245211 CTCTGGGTGTCCAGGGAAGCAGG + Intronic
1125687818 15:41573814-41573836 GTGTGAGTATCCTGGGAAGGGGG + Exonic
1128880283 15:71236251-71236273 CTCTCAGTTTCCAGGACAGAGGG - Intronic
1131707136 15:95009490-95009512 TTCTGAGTATAGAGGTAAGAAGG - Intergenic
1132138721 15:99370468-99370490 CTATGAGTATCTTGGGAAGGGGG + Intronic
1132154368 15:99485394-99485416 CTCTGAGTCCCCAGGGATGCAGG - Intergenic
1132605993 16:793974-793996 CTCTGAGTGTCCCGGGGAGACGG + Intronic
1132655886 16:1041501-1041523 CTGAGAGTCTCAAGGGAAGAAGG - Intergenic
1133301286 16:4784216-4784238 CTCTGATGATGCAGGGAAGTGGG - Intronic
1134045271 16:11096391-11096413 CTGTGGTTATCCAGGGAAGTGGG - Intronic
1135424353 16:22324923-22324945 CTCTGAGGGCTCAGGGAAGAGGG + Intronic
1136604730 16:31325600-31325622 CTCTGAGTTTTCCGGGAAGATGG - Exonic
1138491958 16:57382262-57382284 CTCTGTGCTTCCTGGGAAGAAGG - Exonic
1138700678 16:58859643-58859665 TTCTCACAATCCAGGGAAGAGGG - Intergenic
1140075373 16:71693829-71693851 CTCTGATTTTCCAGAGAACAGGG + Intronic
1141222344 16:82082961-82082983 CACTGAGTCACCAGGGAAGGAGG - Intronic
1141423969 16:83933780-83933802 ATCTGAGGACCCAGGGAAGGCGG - Intronic
1143965149 17:10751655-10751677 CACTGAGCATCCAGGAAAGGAGG - Intergenic
1144018811 17:11222108-11222130 CTCTGCTTTTCCAGGGAATAGGG - Intergenic
1146506311 17:33408882-33408904 CTCAGAGAGCCCAGGGAAGAGGG + Intronic
1147347914 17:39815444-39815466 CTCTGAGTATCAAGGCTAGAGGG - Intronic
1148073215 17:44920816-44920838 CTCTGAGTCTCCAGGGCCGGCGG - Intergenic
1148153725 17:45411095-45411117 CTCTAAGGACCCAGAGAAGAGGG + Intronic
1149478683 17:56984549-56984571 CTGTGAGCATCCATGGGAGAGGG - Intronic
1151082341 17:71343329-71343351 GTTTGAGAATCAAGGGAAGAAGG + Intergenic
1152270350 17:79320910-79320932 CTCTGAATGTGCAGGGAAGGTGG - Intronic
1152515831 17:80824066-80824088 CTCTGGGTTTCCAGGGTTGAGGG - Intronic
1156006901 18:32452809-32452831 CTTTGAGGATCCAGAGAAGGGGG + Intronic
1159101192 18:63961175-63961197 CTCTAAGTATCCAAGCAGGAGGG + Exonic
1159576070 18:70179609-70179631 CTATGAGTATCCTGTGAGGACGG - Intronic
1159689725 18:71471538-71471560 CTGTGAATATCCGGGGGAGATGG + Intergenic
1160053407 18:75457029-75457051 CTCTGAGTCTCCTGGGCAGAAGG + Intergenic
1160246250 18:77162546-77162568 CTCTCAGCAGCCAGGGAGGAAGG - Intergenic
1161970888 19:7579469-7579491 CTCTGAGCTTCCAGGGAGGGAGG - Intergenic
1162063612 19:8111408-8111430 CTCTCTGGATCCAGGGAGGAGGG + Intronic
1162736227 19:12748569-12748591 CTCTGAGCCTCCAAGGAAGTGGG - Intergenic
1163748011 19:19059427-19059449 CTGGGAGTCTCCAGGGAGGAGGG - Intronic
1164826426 19:31287890-31287912 ATCTGAGTATTCAGGGAAGCAGG - Intronic
1166844561 19:45718692-45718714 CCCAGAGTAGGCAGGGAAGAGGG - Intronic
1167556474 19:50199351-50199373 TTCTGAGCCTCCAGGGAAGCTGG - Intronic
1168479801 19:56710185-56710207 CTCTGAGCATCCAAGGAGAAGGG - Intergenic
926057431 2:9782423-9782445 CTGTGAGTTTCCTGAGAAGAAGG - Intergenic
926229197 2:10990084-10990106 TTCTTAGTGACCAGGGAAGAGGG + Intergenic
926334589 2:11853717-11853739 CTCTCAGCATCTAGGTAAGATGG - Intergenic
927968561 2:27288306-27288328 CTCTGGATAGCCAGGGAAGAGGG + Intronic
928451180 2:31379924-31379946 CTTTCTGTAGCCAGGGAAGAAGG + Exonic
929777127 2:44936523-44936545 CTCCGACTGTCCAGGGAAAAGGG + Intergenic
930751984 2:54943242-54943264 CTCTGAGAAGAGAGGGAAGAAGG - Intronic
930917910 2:56716451-56716473 CTCTCAGTATCCAGGCAGGTTGG - Intergenic
932216482 2:69969528-69969550 CTGTGAGTATCCAGGGAGAGAGG - Intergenic
932335053 2:70925971-70925993 CTCTGAGTATCCAGGGAAGAAGG - Intronic
932881634 2:75507486-75507508 CTCTGATTATCTCTGGAAGATGG - Intronic
934937636 2:98476881-98476903 CTGTGAGTACCCAGAGAACAGGG - Intronic
935839141 2:107089976-107089998 CCATGAGTATCCAGGAATGATGG + Intergenic
935859064 2:107308037-107308059 CTTTGAGGATCCAGAGAAAAGGG - Intergenic
936032934 2:109086740-109086762 GTCTGAGTGAACAGGGAAGACGG - Intergenic
936516632 2:113185318-113185340 CTCTGTGTATCCAGGGCTCATGG + Intronic
938318771 2:130348071-130348093 CACTGGGTACCCAGGGAGGAGGG + Intergenic
938951515 2:136258985-136259007 CTCTTAATATCCAGGAGAGAAGG - Intergenic
941509478 2:166387726-166387748 CTCTGATAATGCTGGGAAGAAGG + Intergenic
943117964 2:183696617-183696639 GTCTAAGTATCCAGGGGAAAAGG - Intergenic
945324653 2:208468477-208468499 CTCTGATAATCCAGCAAAGATGG + Intronic
948786198 2:240354221-240354243 CTCTCAGGACCCTGGGAAGAAGG - Intergenic
1169731515 20:8790545-8790567 CTCTGATTCTCCAGGGGAAACGG - Intronic
1171380688 20:24731833-24731855 CTCTGACTCTACAGGGAAGCAGG + Intergenic
1172005825 20:31818749-31818771 CCCTGAGTAGCCATGGGAGATGG - Intergenic
1172596249 20:36153222-36153244 CTATGAGGACCCAGGGTAGAAGG + Intronic
1176127038 20:63480205-63480227 CTGTGAGAAACCAGGGAAGAGGG - Intergenic
1176249387 20:64113026-64113048 CTTTGAGTCTCCAGGGGAGGGGG + Intergenic
1176295433 21:5069640-5069662 AGCTGTGTGTCCAGGGAAGAAGG + Intergenic
1178165913 21:29976641-29976663 ATCTGAGTATCCAGAGACGAGGG + Intergenic
1178705064 21:34866180-34866202 CTCTGAGCCCCCAGGGCAGACGG - Intronic
1179861617 21:44192484-44192506 AGCTGTGTGTCCAGGGAAGAAGG - Intergenic
1181342779 22:22196010-22196032 GTCGGAGTCTCCGGGGAAGACGG + Intergenic
1181867947 22:25874071-25874093 CACTGAGTATCCAGGGCCTAGGG + Intronic
1181954804 22:26580403-26580425 CCCTGGGTATCCAGGGAAGAAGG + Intronic
1182053951 22:27334997-27335019 ATCTCAGTATTCTGGGAAGATGG + Intergenic
1182301913 22:29341790-29341812 CTCAGAGTAGCCAGGTGAGAAGG + Intronic
1182433389 22:30314454-30314476 CTGTGACTATCCTGGGAGGATGG + Intronic
1182656881 22:31897719-31897741 CTCTGGGTATCCAGTCAACACGG + Intronic
1183706258 22:39476493-39476515 CTCTGGCCATCCAGGGAAGATGG + Intronic
1183806458 22:40215585-40215607 CCCTGAGGATGCAGCGAAGATGG - Intronic
1185182754 22:49372663-49372685 CTCGGAGTGCGCAGGGAAGAAGG - Intergenic
949650603 3:6154741-6154763 GTTTGGGTATCCAGGGAAGGTGG - Intergenic
949738341 3:7200330-7200352 ATCAGAATATCCAGGGAAGGGGG + Intronic
950508055 3:13408007-13408029 CTCTGAGTGTCCATGGAAGATGG - Intronic
950698998 3:14727137-14727159 GTCTGAATGTCCAGGGAAGTAGG + Intronic
951031214 3:17884011-17884033 CTCTGAATCTGCAGGGAATATGG + Intronic
951465721 3:22998598-22998620 CTGGGAGTAGCCTGGGAAGAGGG - Intergenic
952672232 3:35983767-35983789 CTTTGAGAATCTAGGGAAGAAGG - Intergenic
953669556 3:44951318-44951340 CTCTGAGTTTTCAGTGCAGAAGG + Intronic
954493664 3:50931691-50931713 GGCTGAGTATCTGGGGAAGATGG - Intronic
954614932 3:51964621-51964643 CTCGGAGCATCCAGGGAGGCAGG + Intronic
955462456 3:59198986-59199008 CTCTGAGGATCCAGGGTGGGTGG + Intergenic
956110611 3:65866853-65866875 CTCGGTGTAAACAGGGAAGAAGG + Intronic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
959982150 3:112528544-112528566 TTCATAGTATCCAGGGAAAAAGG + Intergenic
961701523 3:128748428-128748450 CTTTGAGTAGACAGGGAAGGTGG + Intronic
962825544 3:139096969-139096991 CTCTGAGTCTCTGAGGAAGAGGG - Intronic
963438124 3:145298305-145298327 CTCTGAGGCTCCAGGGATGGTGG + Intergenic
965529264 3:169754664-169754686 GTCATTGTATCCAGGGAAGAGGG + Intergenic
966772634 3:183517671-183517693 CCCTGAGTTTCCAGAGAAGACGG + Intronic
969350728 4:6596614-6596636 CTCTGGGCGTCCAGGGAGGATGG - Intronic
969387775 4:6867301-6867323 ATCTGAGTGTCCAGAGTAGAAGG + Intronic
972905985 4:43747549-43747571 CCCCCAGTCTCCAGGGAAGAGGG - Intergenic
973808492 4:54548009-54548031 CTCTGAGTCAGCAGGTAAGAAGG - Intergenic
975358989 4:73444576-73444598 TTCTGAGAATCCAGGAAAGGAGG - Intronic
975470693 4:74762708-74762730 CTCTCAGTATCTAAGGTAGATGG - Intronic
976173334 4:82326892-82326914 CTTTCAGTATCCATGGAAGGAGG - Intergenic
976395474 4:84550532-84550554 GTCTGAGTTCCCAGGGAGGATGG + Intergenic
977212450 4:94234989-94235011 ATCTGAGTATCCAGTAAAAATGG - Intronic
978669767 4:111232659-111232681 CTCTGAGAACCTGGGGAAGATGG - Intergenic
980750136 4:137077247-137077269 CTCTGAGCCTGCAGGGATGAGGG + Intergenic
981686681 4:147462406-147462428 CACTGGATATCCATGGAAGATGG + Intergenic
983888472 4:173006859-173006881 CTCTGAGAATCCAAGGAAAGTGG - Intronic
984059042 4:174968636-174968658 TTCTGACTATCCAGTGAATAGGG + Intronic
984792784 4:183629518-183629540 CTCTGAGTGTCTATGGAACAGGG + Intergenic
984876044 4:184368577-184368599 CTCTCAGTATCAGGGCAAGAAGG - Intergenic
985689586 5:1299683-1299705 GGCTGAGTCTCCAGGGCAGATGG + Intergenic
986664229 5:10086201-10086223 CTCTGAGAATTCAGAGGAGATGG + Intergenic
987268422 5:16279879-16279901 CTCTGGGTCTCCAGGGATCATGG - Intergenic
987704910 5:21450342-21450364 CTCTGAGTATTCAGGGAGAAGGG + Intergenic
990341014 5:54823228-54823250 CTCTGAGTCATCAGAGAAGAGGG - Intergenic
991976250 5:72186217-72186239 GTCTGCGAAACCAGGGAAGACGG - Intronic
992777599 5:80102180-80102202 CTATGAGTATTTAGAGAAGAAGG - Intergenic
994391691 5:99198669-99198691 CTCGTAATATCCAGGGAAGGAGG - Intergenic
995406867 5:111807868-111807890 CTCTGAATATCATGTGAAGATGG + Intronic
996228762 5:121034524-121034546 CTCTGGGTCTCTAGGAAAGATGG + Intergenic
996273841 5:121640556-121640578 CCCTGATTATCCAAGGAAGCAGG - Intergenic
996385057 5:122902129-122902151 CCATGAGTACACAGGGAAGATGG - Intronic
997685269 5:135784134-135784156 CTCCCAATATCCAGGGAAAAAGG + Intergenic
997809990 5:136957643-136957665 CTATGAGTAGCAAGGCAAGAGGG + Intergenic
998057610 5:139092248-139092270 GTCTGAGTGTCCAAGAAAGAAGG - Intronic
999811505 5:155131623-155131645 CTGTGAGTATCCAGGCTTGAGGG + Intergenic
1000186057 5:158859237-158859259 CTCTGATTTTCCAGTGAACATGG - Intronic
1001272686 5:170327418-170327440 CTCTGAGTCTCGAAGGAAGGGGG - Intergenic
1001285440 5:170419797-170419819 CTCACAGTATCCATGGGAGAAGG + Intronic
1001652149 5:173323681-173323703 CACAGAGTAGCCAGGGAGGAAGG - Intronic
1001804443 5:174571211-174571233 CTGCAACTATCCAGGGAAGAAGG - Intergenic
1001879666 5:175232417-175232439 CTTTCACTATCCAGGGAACACGG - Intergenic
1002689525 5:181040711-181040733 CTCTTAGTCTCTAAGGAAGATGG - Intronic
1004571615 6:16851265-16851287 CACTGTGTATGCATGGAAGAGGG + Intergenic
1005133556 6:22540131-22540153 CTCTGAGGACTCAGGGAAAATGG - Intergenic
1006788926 6:36686211-36686233 GTCTGAGTGTCCAGGAAAGGGGG - Exonic
1007606158 6:43119587-43119609 CCCTGATCACCCAGGGAAGATGG - Intronic
1010849223 6:80750854-80750876 ATAGGAATATCCAGGGAAGACGG - Intergenic
1012004572 6:93696281-93696303 CTCTGAGTATCCATGAAAGAGGG - Intergenic
1014041740 6:116835125-116835147 CTCTGAGTAGGCTGAGAAGAAGG - Intergenic
1014728460 6:125002451-125002473 CTCTAAGTCTCAAGGGAAGATGG - Intronic
1016447874 6:144151155-144151177 CACTCAGTAGCCAGGAAAGACGG + Intronic
1017017450 6:150113274-150113296 CTCTGAGTCTTCATGGTAGATGG - Intergenic
1017135362 6:151142956-151142978 CTCTGAGTATCCAGGGGCAGAGG + Intergenic
1017678962 6:156844341-156844363 GTCTGTGTATCCAGAGAGGATGG + Intronic
1018168232 6:161120796-161120818 CTCTGAGAAAACAGAGAAGAGGG - Intergenic
1020429626 7:8105682-8105704 CTCTGAGCAACCAGGGCAGAGGG - Intergenic
1020505285 7:8979248-8979270 CCCTGAACAACCAGGGAAGATGG + Intergenic
1021351997 7:19605407-19605429 ATGTGAGGATCCTGGGAAGATGG + Intergenic
1022322131 7:29297448-29297470 ATCTGAGGATCCCCGGAAGAAGG + Intronic
1024509186 7:50189794-50189816 GTTTCATTATCCAGGGAAGATGG + Intergenic
1025733280 7:64125225-64125247 CTGTCATTATTCAGGGAAGAGGG + Intronic
1026534359 7:71227967-71227989 CTATGCATATCCAGGGAAGAAGG - Intronic
1027575361 7:79923624-79923646 ATGTGAGTATTCATGGAAGAAGG - Intergenic
1027822777 7:83069175-83069197 CTCTGAATATACATGGCAGATGG + Intronic
1029328613 7:99832147-99832169 CTCTGAGAAAACAGGAAAGAAGG + Intronic
1031597643 7:123666493-123666515 CTATGAGTTTCCAGGGAGGATGG - Intergenic
1031869460 7:127076353-127076375 CTCAGAGTATCTGGGGGAGAAGG + Intronic
1032488912 7:132309298-132309320 CTCTGAGGACCCAGGGAGGATGG + Intronic
1033954685 7:146832031-146832053 ATTAGAGTAGCCAGGGAAGAGGG - Intronic
1034784991 7:153917491-153917513 CCCTCAGTGGCCAGGGAAGAGGG - Intronic
1037584859 8:20269344-20269366 CTCTGTCTCTCCAGGTAAGACGG - Intronic
1038711349 8:29949880-29949902 CTCTGAATCTCCTGGGAAGCAGG - Intergenic
1040598358 8:48861361-48861383 CACTGAGTATGCAGTGATGACGG + Intergenic
1044413331 8:91909572-91909594 CCCTGAGTGGCTAGGGAAGATGG - Intergenic
1044459393 8:92427541-92427563 CTCTTAGTTCCCAGGGAATATGG + Intergenic
1045346221 8:101295949-101295971 ATCTGCCTCTCCAGGGAAGATGG - Intergenic
1046138600 8:110061884-110061906 CCCTGAGTATTCACTGAAGAAGG + Intergenic
1046200524 8:110921846-110921868 ATCTGAGTCTATAGGGAAGAAGG + Intergenic
1047688870 8:127330377-127330399 TTCTGAGTCTCCTGGGAGGAGGG + Intergenic
1047942878 8:129843219-129843241 CTCTGGGTGTCCATGGGAGATGG - Intronic
1048196317 8:132334785-132334807 GCCTCAGTGTCCAGGGAAGAGGG - Intronic
1048937477 8:139368901-139368923 CTCTGAGTCACCCAGGAAGAGGG - Intergenic
1049601023 8:143507737-143507759 CTCTCACTATCCAGGTAGGAAGG - Exonic
1049768188 8:144365264-144365286 CTCTGAGAATCAAGGGCAGGAGG - Intergenic
1053073595 9:35115244-35115266 CTCTGAGTGCCCAGGCCAGAAGG + Intronic
1058704362 9:107626475-107626497 CTCTGATTATCCAAAGAAGCTGG + Intergenic
1058705129 9:107631549-107631571 ATCTGAGTCTCTAGGGAACAGGG - Intergenic
1059746368 9:117205618-117205640 CACTGAGCATCAAGGAAAGATGG + Intronic
1061265454 9:129502199-129502221 CTCTGAGAGTCCAGGCAAGTGGG + Intergenic
1061593397 9:131613376-131613398 CTCTGAAGAGCCAGGGAAGCTGG + Intronic
1062148234 9:135002625-135002647 GCCTCAGTCTCCAGGGAAGAGGG - Intergenic
1185609960 X:1388389-1388411 CTGTGAGGACACAGGGAAGACGG + Intronic
1187940308 X:24374689-24374711 CTCTGAAGCTGCAGGGAAGAGGG + Intergenic
1194270469 X:91807878-91807900 CTCTGTCGATCCAGGGATGAAGG + Intronic
1194335888 X:92645247-92645269 CTCTTAGAATCCAGTGAGGATGG - Intergenic
1197529579 X:127606362-127606384 CTGTAACTAGCCAGGGAAGAAGG + Intergenic
1200587703 Y:5029306-5029328 CTCTGTCGATCCAGGGATGAAGG + Intronic
1200644325 Y:5761998-5762020 CTCTTAGAATCCAGTGAGGATGG - Intergenic
1200849635 Y:7869717-7869739 CTCTGTGTATTCATGGTAGAAGG - Intergenic
1201271275 Y:12257621-12257643 CACTGTGTATCCCGTGAAGATGG + Intergenic
1202199544 Y:22331772-22331794 GCCTGAGTCTCCAGGGAAGTTGG - Intronic
1202232215 Y:22669306-22669328 TCCTGAGTCTCCAGGGAAGATGG - Intergenic
1202310941 Y:23526852-23526874 TCCTGAGTCTCCAGGGAAGATGG + Intergenic
1202559861 Y:26143742-26143764 TCCTGAGTCTCCAGGGAAGATGG - Intergenic