ID: 932336663

View in Genome Browser
Species Human (GRCh38)
Location 2:70935684-70935706
Sequence TGGAGGATGTGGAGGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 7754
Summary {0: 1, 1: 0, 2: 14, 3: 332, 4: 7407}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932336663_932336683 27 Left 932336663 2:70935684-70935706 CCCTTCTCCCTCCACATCCTCCA 0: 1
1: 0
2: 14
3: 332
4: 7407
Right 932336683 2:70935734-70935756 GACCTGCACAGCTTGGTGTGGGG 0: 1
1: 0
2: 0
3: 25
4: 175
932336663_932336673 -5 Left 932336663 2:70935684-70935706 CCCTTCTCCCTCCACATCCTCCA 0: 1
1: 0
2: 14
3: 332
4: 7407
Right 932336673 2:70935702-70935724 CTCCAGCTCTCAGGTGACGGGGG 0: 1
1: 0
2: 1
3: 17
4: 169
932336663_932336669 -8 Left 932336663 2:70935684-70935706 CCCTTCTCCCTCCACATCCTCCA 0: 1
1: 0
2: 14
3: 332
4: 7407
Right 932336669 2:70935699-70935721 ATCCTCCAGCTCTCAGGTGACGG 0: 1
1: 0
2: 1
3: 16
4: 263
932336663_932336678 20 Left 932336663 2:70935684-70935706 CCCTTCTCCCTCCACATCCTCCA 0: 1
1: 0
2: 14
3: 332
4: 7407
Right 932336678 2:70935727-70935749 CCTCCCAGACCTGCACAGCTTGG 0: 1
1: 0
2: 1
3: 34
4: 304
932336663_932336670 -7 Left 932336663 2:70935684-70935706 CCCTTCTCCCTCCACATCCTCCA 0: 1
1: 0
2: 14
3: 332
4: 7407
Right 932336670 2:70935700-70935722 TCCTCCAGCTCTCAGGTGACGGG 0: 1
1: 0
2: 0
3: 28
4: 246
932336663_932336682 26 Left 932336663 2:70935684-70935706 CCCTTCTCCCTCCACATCCTCCA 0: 1
1: 0
2: 14
3: 332
4: 7407
Right 932336682 2:70935733-70935755 AGACCTGCACAGCTTGGTGTGGG 0: 1
1: 0
2: 2
3: 11
4: 137
932336663_932336672 -6 Left 932336663 2:70935684-70935706 CCCTTCTCCCTCCACATCCTCCA 0: 1
1: 0
2: 14
3: 332
4: 7407
Right 932336672 2:70935701-70935723 CCTCCAGCTCTCAGGTGACGGGG 0: 1
1: 0
2: 1
3: 26
4: 139
932336663_932336681 25 Left 932336663 2:70935684-70935706 CCCTTCTCCCTCCACATCCTCCA 0: 1
1: 0
2: 14
3: 332
4: 7407
Right 932336681 2:70935732-70935754 CAGACCTGCACAGCTTGGTGTGG 0: 1
1: 0
2: 2
3: 13
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932336663 Original CRISPR TGGAGGATGTGGAGGGAGAA GGG (reversed) Intergenic
Too many off-targets to display for this crispr