ID: 932337982

View in Genome Browser
Species Human (GRCh38)
Location 2:70941930-70941952
Sequence AAGGCCAAGGAGAGGGTGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 908
Summary {0: 1, 1: 0, 2: 4, 3: 67, 4: 836}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932337969_932337982 25 Left 932337969 2:70941882-70941904 CCCAGGCTCTGAGTGTAGCCATC 0: 1
1: 0
2: 2
3: 13
4: 133
Right 932337982 2:70941930-70941952 AAGGCCAAGGAGAGGGTGGAAGG 0: 1
1: 0
2: 4
3: 67
4: 836
932337975_932337982 -3 Left 932337975 2:70941910-70941932 CCACTGAAGCCAGAGTGGAGAAG 0: 1
1: 0
2: 2
3: 39
4: 321
Right 932337982 2:70941930-70941952 AAGGCCAAGGAGAGGGTGGAAGG 0: 1
1: 0
2: 4
3: 67
4: 836
932337973_932337982 7 Left 932337973 2:70941900-70941922 CCATCGGAGGCCACTGAAGCCAG 0: 1
1: 0
2: 2
3: 16
4: 153
Right 932337982 2:70941930-70941952 AAGGCCAAGGAGAGGGTGGAAGG 0: 1
1: 0
2: 4
3: 67
4: 836
932337970_932337982 24 Left 932337970 2:70941883-70941905 CCAGGCTCTGAGTGTAGCCATCG 0: 1
1: 0
2: 0
3: 3
4: 96
Right 932337982 2:70941930-70941952 AAGGCCAAGGAGAGGGTGGAAGG 0: 1
1: 0
2: 4
3: 67
4: 836

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932337982 Original CRISPR AAGGCCAAGGAGAGGGTGGA AGG Exonic
900032393 1:381084-381106 AGAGGCAAGGAGGGGGTGGATGG + Intergenic
900052943 1:609270-609292 AGAGGCAAGGAGGGGGTGGATGG + Intergenic
900165401 1:1242442-1242464 AAGGCAGTGGGGAGGGTGGAGGG + Exonic
900980207 1:6041911-6041933 AAGGCCAGGGAGCGGGTGGGAGG + Intronic
901215790 1:7554679-7554701 GACGCTAAGGAGAGGGTGGGAGG - Intronic
901381170 1:8875513-8875535 AGGGCCAAAAAGAGGGTGGCGGG + Intronic
902090301 1:13897845-13897867 AAGGACCTGGAGAGGGAGGAAGG - Intergenic
902371274 1:16008553-16008575 GAGGCCAAGGAGGGGGAGGCGGG + Exonic
902534302 1:17110297-17110319 GAGGCTAAGGAGAGCATGGATGG + Intronic
902830466 1:19009191-19009213 AAGGCCAGTGGGAGGGTGGGGGG - Intergenic
903175042 1:21575693-21575715 AAGGCCTCGGTGAGGGAGGAGGG - Intronic
904325406 1:29724632-29724654 AAGGCCAAGAAGAGGCTGAGGGG - Intergenic
904334737 1:29789615-29789637 AAGGACAAGGAGAAGGGAGAGGG + Intergenic
904441711 1:30535982-30536004 AAGGACAGGGAGAGGATTGATGG + Intergenic
904682583 1:32239838-32239860 AGGGCCTGGGAGAGGGTGGGAGG + Intergenic
904866001 1:33579421-33579443 CAGGGAAAGGAGAGGTTGGATGG + Intronic
904973552 1:34437888-34437910 AAGGCCCTAGACAGGGTGGAGGG + Intergenic
904986817 1:34557582-34557604 GAGGCCTAATAGAGGGTGGAGGG + Intergenic
905010323 1:34742647-34742669 AAGGCTCAGGGGAGAGTGGAAGG + Intronic
905462016 1:38128117-38128139 GAGGACAAGGAGGGGGAGGAAGG + Intergenic
905934145 1:41810476-41810498 AGGGACTAGGAGATGGTGGATGG - Intronic
906017293 1:42593226-42593248 AAACCCAAGGAGAGGGTTGTGGG - Intronic
906140453 1:43531135-43531157 GAGGGCAAGGAGAGCGGGGAAGG - Intronic
906380464 1:45329054-45329076 GGGGCTAGGGAGAGGGTGGAAGG + Intergenic
906675834 1:47693175-47693197 AAGGCCAAGGAGGGGTGGGCAGG + Intergenic
906764803 1:48418856-48418878 GAGGGGAAGGAGAGGGAGGAAGG + Intronic
907062906 1:51449426-51449448 GGGGCCAATGTGAGGGTGGAGGG + Intronic
907319899 1:53595599-53595621 AAGGCCACGGAGAGGGAGCAGGG - Intronic
907965084 1:59321227-59321249 AAGGGCAAGTACAGGGTGGTAGG - Intronic
908438839 1:64133164-64133186 AAGGAGAACGAGGGGGTGGAGGG + Intronic
908833640 1:68206931-68206953 AAGGACAAGGAGGGGGAGGAGGG - Intronic
909221507 1:72968283-72968305 AAATCCAAGGCCAGGGTGGAGGG + Intergenic
910354585 1:86340780-86340802 AAGCCTCAGGAGAGGGTGGTGGG - Intergenic
911115319 1:94240027-94240049 AAGGCCAAGGAGAGTGGGGTTGG + Intronic
911227876 1:95326994-95327016 AAAGCATAGGAGAGGGTTGAGGG - Intergenic
912257391 1:108074400-108074422 AAGGCCAAGTAGACACTGGAAGG - Intergenic
912519000 1:110232679-110232701 AAGGCCAGGAAGAGCATGGATGG - Exonic
912775624 1:112504777-112504799 AAGGCCAAGAAGGGGCTGGGGGG - Intronic
912822489 1:112879049-112879071 AAGGACCAGGAGAGGATGCAAGG - Intergenic
913076852 1:115347456-115347478 AAGGCACATGAGAGGGTGTAGGG + Intergenic
913231899 1:116746878-116746900 AAGGTTTAGGAGAGGGAGGAGGG - Intergenic
913960586 1:143335759-143335781 AAGGCCATGGAGAGGGCAGCTGG + Intergenic
914324872 1:146602789-146602811 GAGGCCTAGTGGAGGGTGGAGGG - Intergenic
914918392 1:151831822-151831844 AGGGCCCAGGGGAGGGAGGAGGG + Exonic
915135519 1:153728590-153728612 AAGGTCAGGGAGTGGATGGATGG - Exonic
915156512 1:153881029-153881051 ATGGACAAGGAGAGGGAGGGGGG - Intronic
915259217 1:154664222-154664244 GGGGCCAAGGAGAGGGAGAAAGG - Intergenic
915438256 1:155925764-155925786 AATGTCAAGGAGAAGGTGGAAGG - Exonic
915724927 1:158010719-158010741 CAGGCAAAGGGGAGGGAGGAGGG - Intronic
915865515 1:159494693-159494715 GAGCCCACGGAGAGGGTGGGAGG + Intergenic
915946648 1:160157340-160157362 AAGGCCTACTTGAGGGTGGAGGG - Intronic
916211428 1:162363215-162363237 GAGTCCAAGGAGAGGGTAGTGGG - Intronic
916672602 1:167036651-167036673 AAGGCCAGGGAGATAGTGCAGGG - Intergenic
917243695 1:172976818-172976840 CAGGTCAAGGACAAGGTGGAGGG + Intergenic
917709623 1:177671125-177671147 AAGACCAAGGGAAGGGTAGAGGG - Intergenic
918469966 1:184861726-184861748 AAGGAGAAGGGGAGGGAGGAAGG + Intronic
918991395 1:191701187-191701209 AGGGCAAAGGAGAGGGAAGAGGG - Intergenic
919092324 1:192990886-192990908 GAGGCCATGGAGAGGGGAGAGGG + Intergenic
919840503 1:201605781-201605803 AGGGCTAAGGAGAGGGGGAATGG + Intergenic
919940288 1:202281632-202281654 CAGGCCTCGGAGAGGGTCGATGG + Intronic
921903797 1:220475754-220475776 GAGCCCACGGAGAGGGTGGGAGG + Intergenic
921961266 1:221036863-221036885 GAGGCCTACCAGAGGGTGGAGGG - Intergenic
921983635 1:221285743-221285765 GAGCCCACGGAGAGGGTGGGAGG + Intergenic
922597341 1:226824127-226824149 AAGGGGAAGGTGAGAGTGGAGGG + Intergenic
922945557 1:229510860-229510882 AAGGCTAAGGTGTGGGAGGATGG + Intergenic
923089527 1:230729189-230729211 AAGTCCAGAGAGAGAGTGGAAGG - Intergenic
923570485 1:235108787-235108809 AATGCTTTGGAGAGGGTGGAAGG - Intergenic
924388848 1:243528476-243528498 AAGGCCTACTTGAGGGTGGAGGG - Intronic
1062955692 10:1538911-1538933 GAGGCCTCGGTGAGGGTGGATGG - Intronic
1063434343 10:6018308-6018330 GAGGACAGGGTGAGGGTGGAGGG + Intronic
1063561813 10:7135202-7135224 GAGGCCTATCAGAGGGTGGAGGG - Intergenic
1063690211 10:8280079-8280101 AAGGAAGAAGAGAGGGTGGAAGG + Intergenic
1063862186 10:10323076-10323098 AAGGTTAAGTAGATGGTGGATGG + Intergenic
1064297693 10:14093050-14093072 AAGGCCAAGGCCAGGGTAGGGGG + Intronic
1064960472 10:20958318-20958340 GGGGGCAAGGAGAGGGTGGATGG + Intronic
1065377463 10:25058155-25058177 GAGGACAAGTAGAGGGAGGAAGG - Intronic
1065695301 10:28374272-28374294 CTGGGCAAAGAGAGGGTGGATGG - Intergenic
1065805049 10:29386363-29386385 AAGCCAAAGGAGAGTGTAGAAGG + Intergenic
1066190010 10:33047486-33047508 AAGGGAGAGAAGAGGGTGGATGG + Intergenic
1066369814 10:34811078-34811100 AAGGGGAAGGAGAGAGTGAAGGG - Intronic
1066457488 10:35585015-35585037 AGGGCCAGGGAGTGGGAGGAAGG - Intergenic
1066598498 10:37078147-37078169 AGGGGCAGGGAGAGGGAGGAAGG - Intergenic
1066687167 10:37992302-37992324 AAGGCCAGAGAAAGGGTCGATGG - Intergenic
1066700553 10:38123122-38123144 CAGGGCAAAGAGAGGGGGGAAGG + Exonic
1067092532 10:43275764-43275786 AAGGACTGGGAGGGGGTGGAAGG - Intergenic
1067780812 10:49205459-49205481 GAGCTCAAGGAGAGGGAGGAAGG - Intergenic
1067826097 10:49574121-49574143 AAGGACCAGAAGAGGGTGAATGG + Intergenic
1068262610 10:54601972-54601994 GAGGCCAACCAGAAGGTGGAGGG + Intronic
1068459430 10:57307569-57307591 AATTCCAAGGAGAGTCTGGAGGG - Intergenic
1069178762 10:65329030-65329052 AAGGCCAAGAAGATGGTGTTTGG + Intergenic
1069877039 10:71569237-71569259 ACAGCCAATGAGAGGGTGGGAGG - Intronic
1070028418 10:72653969-72653991 GAGGCAAGGGAGAGGTTGGAAGG - Intergenic
1070263343 10:74879124-74879146 AAGGCAAAGGAGAAGATGGTGGG + Intronic
1070270931 10:74954161-74954183 GAGGCCATGGAGAGACTGGATGG - Intronic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1071603897 10:86971707-86971729 AAAGACATGGAGCGGGTGGACGG - Intronic
1071736705 10:88309110-88309132 AGGGCCTATCAGAGGGTGGAGGG + Intronic
1073063999 10:100747960-100747982 ACGGCCAAGCAGAGGTCGGAGGG + Intronic
1073405081 10:103290535-103290557 GAGGCCAAGGTGGGGGTGGTGGG + Intergenic
1073440513 10:103549881-103549903 AAGGCCACACAGTGGGTGGAAGG - Intronic
1073445592 10:103578486-103578508 AAGGCCAGAGAGAGGGTGAGGGG + Intronic
1074296736 10:112196075-112196097 AAGGCCAAGCAGAGCCTGGGAGG + Intronic
1075162525 10:120037085-120037107 AAGGCCTACTTGAGGGTGGAAGG + Intergenic
1075285855 10:121185300-121185322 AATGTAAAGGAAAGGGTGGAAGG + Intergenic
1075772532 10:124952069-124952091 AAGCCCAAAGAGGGGGTAGAGGG - Intronic
1075914611 10:126156760-126156782 CAGGCCCAGGACAGGGTGGAAGG + Intronic
1075923334 10:126231550-126231572 CAGGGCAAGGAGAGGATGGAAGG - Intronic
1076110834 10:127858090-127858112 AAGGCCTTGGCAAGGGTGGAAGG + Intergenic
1076261623 10:129071437-129071459 GAGCCCATGGAGGGGGTGGAAGG + Intergenic
1076272514 10:129166468-129166490 ACGGCCCAAGGGAGGGTGGAGGG + Intergenic
1076478261 10:130767436-130767458 AAGGCTGAGGAGAGGGAGGGGGG - Intergenic
1076566124 10:131400666-131400688 AGTGCAAAGGGGAGGGTGGAGGG + Intergenic
1076629775 10:131845614-131845636 GAGGCCACGGGGAGGGTGGCGGG - Intergenic
1076629795 10:131845701-131845723 GAGGCCACGGGGAGGGTGGCGGG - Intergenic
1077020149 11:413760-413782 CAGGCAGAGGAGAGGGTGCAGGG - Intronic
1077020256 11:414107-414129 TAGGCAGAGGAGAGGGTGCAGGG - Intronic
1077020284 11:414191-414213 TAGGCAGAGGAGAGGGTGCAGGG - Intronic
1077020312 11:414275-414297 TAGGCAGAGGAGAGGGTGCAGGG - Intronic
1077222523 11:1423935-1423957 AAGGCCGAGGAAAGTGTGGCTGG - Intronic
1077358161 11:2128115-2128137 AAGGGAAGGGAGAGGGTGGGCGG - Intergenic
1077411752 11:2406942-2406964 ACGGCCAAGCTGCGGGTGGACGG + Intronic
1077522352 11:3043778-3043800 CAGGCCAAGGGGAGGAAGGAGGG + Intronic
1077949085 11:6934922-6934944 AAGGCAAATGAGAGGTTGCAGGG + Intronic
1077961938 11:7084775-7084797 AAACCCAAGGAGAGGGTTGTGGG + Intergenic
1078185042 11:9044939-9044961 CAGGCCAAGGTGAGGGGTGAGGG - Intronic
1078733041 11:13993257-13993279 AAGGCCGAGGAGAAGGGGGTGGG + Intronic
1079107254 11:17579433-17579455 GAGGCCAGGGGAAGGGTGGAGGG + Intronic
1079345347 11:19646938-19646960 GAGGCCTAGGAGAGGGAGTATGG - Intronic
1080442511 11:32308032-32308054 ATGGGCAAGGAGAGGCTGGCGGG + Intergenic
1080617742 11:33959790-33959812 AGGGTCACGGGGAGGGTGGAGGG - Intergenic
1080775109 11:35378869-35378891 AAGGGGAAGGAGAAGATGGAGGG + Intronic
1081597310 11:44467869-44467891 AGGGCCAAGGAGTGGGAGGGAGG - Intergenic
1081647241 11:44798623-44798645 AAGGCCAAGGGGAGGGCAGGGGG - Intronic
1081733434 11:45387323-45387345 AAAGCCCAGGAGTGGGTGTAGGG + Intergenic
1081875203 11:46403833-46403855 AGGGCCAAGGGGAGTGGGGAGGG + Intronic
1082764325 11:57155217-57155239 AGGGTAAAGGAGAGGGTAGAAGG - Intergenic
1083059171 11:59851470-59851492 GGGGCCTATGAGAGGGTGGAGGG - Intergenic
1083306559 11:61764819-61764841 AGGGCCCAGGAGAGGGCGGCAGG + Intronic
1083668712 11:64288815-64288837 AAGGCCATGGCAGGGGTGGAAGG - Intronic
1083723785 11:64618032-64618054 AGGGCCAAGTAGAGGATGAAGGG - Intronic
1083807425 11:65083459-65083481 AAGGCTAAGGAGAGTGTTGTGGG - Intronic
1083992516 11:66255516-66255538 AAGGCCAATGTGAGGGCTGAAGG + Intergenic
1084032506 11:66489214-66489236 GGGGACAAGGAGAGGCTGGAGGG - Intronic
1084482314 11:69429109-69429131 AGAGCCAAGGAGAGCGTGGTTGG + Intergenic
1084691879 11:70732353-70732375 AGGGCCCAGGAGAGAGAGGAAGG - Intronic
1084777809 11:71388886-71388908 AAGGGCAAGGAGGGGTTGGCTGG - Intergenic
1084860508 11:72014930-72014952 GAGGCAAAGGAGAAGGTGGCAGG - Exonic
1085453496 11:76653113-76653135 AAGGCCACGTATAGGGTGGTGGG - Intergenic
1085612512 11:77964714-77964736 AAGGGCAAGTGGAGGGAGGAAGG + Intronic
1086129605 11:83387094-83387116 AGGGTGAAGGAGAGGGTGGAAGG - Intergenic
1086403557 11:86480942-86480964 AAGCCCAAGGTGAGGGTGTAAGG - Intronic
1086850594 11:91802936-91802958 AAGGCCCTGGAGTGGGTGGGGGG + Intergenic
1087068204 11:94047361-94047383 GGGGCCTAGCAGAGGGTGGAGGG - Intronic
1087497920 11:98914339-98914361 AAAGACAAGGAAAGGATGGATGG - Intergenic
1087940724 11:104093753-104093775 AAGGAGAAGGAGAAGGTGGGTGG - Intronic
1088418537 11:109617304-109617326 AAGGCCTACTTGAGGGTGGAGGG + Intergenic
1088476000 11:110240365-110240387 AAGGCCAGGAAGTGGGTGGGGGG + Intronic
1088715397 11:112544379-112544401 AATGGCAATGAGAGGGAGGAAGG + Intergenic
1088735329 11:112723738-112723760 AAGGGTAAGGGGAGGGAGGATGG + Intergenic
1088796527 11:113270358-113270380 AAGGGCAAGGACATGGAGGAGGG + Exonic
1088935810 11:114399569-114399591 AATGCCAAGGAAAAGATGGAAGG + Intronic
1089076876 11:115745499-115745521 AAGGCACTGGAGAGGGTGGCGGG - Intergenic
1089549993 11:119266757-119266779 AAGGCGAAGGTTAGAGTGGAAGG + Intronic
1090243220 11:125198337-125198359 AAGGCGAAGGTGGGGGTAGAGGG + Intronic
1090855581 11:130607319-130607341 AAGGCTGAGGAGGAGGTGGAGGG + Intergenic
1091406837 12:214433-214455 AAGGGCAAGGAGGAGGAGGAGGG - Intronic
1091667570 12:2430504-2430526 AAGGCAAGTGTGAGGGTGGATGG - Intronic
1091792312 12:3278922-3278944 GAGGACAAGGAGGGTGTGGAAGG - Intronic
1091968616 12:4766561-4766583 ATGACCAAGGACAGGGCGGAGGG + Intronic
1092378187 12:7973060-7973082 GAGGCCAAGGAGCGGGGGGCGGG - Intergenic
1092529143 12:9329866-9329888 GAGGCCTAGCAAAGGGTGGAGGG - Intergenic
1092572382 12:9739661-9739683 GAGCCCACGGAGAGGGTGGGAGG + Intergenic
1092660644 12:10734528-10734550 AAGGCCCAGGAGAGAGTTGATGG + Intergenic
1093145944 12:15567184-15567206 AAGGAAAATGAGAGGGGGGAAGG - Intronic
1093520798 12:20047683-20047705 TAGGGCAAGGTTAGGGTGGAAGG + Intergenic
1093639622 12:21511298-21511320 TAGGGCAAGGAAAGGGGGGAGGG + Intronic
1094171261 12:27494813-27494835 AAGGCCAAAGGGAAGGAGGAAGG - Intronic
1094298883 12:28938790-28938812 AAGGCAAAGAAGTGGGTGGGGGG + Intergenic
1094679991 12:32659416-32659438 AACTCGAAGGAGAGGGTGGGAGG + Intergenic
1095469890 12:42525380-42525402 AAACCCAAGGAGAGGGTCGAGGG + Intronic
1095473940 12:42566026-42566048 AAGGCCAGGGAGAGACTGGCAGG + Intronic
1095653908 12:44647138-44647160 AATGCCAAGGAGTGGGTAGCAGG + Intronic
1096600332 12:52724415-52724437 ATGGCCACGGAGAGGAGGGAGGG - Intergenic
1096744276 12:53715342-53715364 AAGGAAAATGGGAGGGTGGAGGG + Intronic
1096982417 12:55736126-55736148 AAGGCCAAGGTGAGTGTGAGGGG - Intergenic
1097097549 12:56561756-56561778 GAGGCCAAGGAGGGGGGGGGTGG - Intronic
1097434194 12:59539996-59540018 ATAGCCATGGAGAGAGTGGATGG + Intergenic
1097566490 12:61276003-61276025 GAGGTCAAGGAGTGGGAGGAGGG + Intergenic
1097658286 12:62396649-62396671 AAGGGGAAGGAGAACGTGGAGGG - Intronic
1098081508 12:66790887-66790909 AAGGGGAAGGAGCGGGAGGAAGG + Intronic
1098213054 12:68186342-68186364 AAAGTGAAGGAGAGGGTGGAGGG + Intergenic
1098803044 12:74985806-74985828 AAGGCCAAGGGCAGGGCTGAGGG - Intergenic
1099027400 12:77482735-77482757 AAGGCCAAGGTTAAGCTGGAAGG + Intergenic
1099335978 12:81358105-81358127 AAGACCAAGGAGAGGCCGCATGG - Exonic
1100871648 12:98915977-98915999 AAGACCTAGGAGATGGTGAAGGG - Intronic
1100874291 12:98945976-98945998 AAGGGGATGGAGAAGGTGGATGG - Intronic
1101241883 12:102847141-102847163 AAGGGCCAAGTGAGGGTGGAAGG - Intronic
1101433477 12:104645650-104645672 TAAGCCAAGGGGAGGGTGGGGGG - Intronic
1101631376 12:106498308-106498330 CAGCCCGAGGTGAGGGTGGAGGG + Intronic
1101760810 12:107657303-107657325 AAGGCCAAGGAGTGGAGGAATGG + Intronic
1102021761 12:109688179-109688201 AGGGCCAAGGAGGAGGTGCAGGG + Intergenic
1102556385 12:113729472-113729494 ATGGTGAAGGTGAGGGTGGATGG + Intergenic
1102724741 12:115051233-115051255 AAGCCCAAGGAGAGAGCTGATGG + Intergenic
1103195785 12:119042674-119042696 AAGGGCAGGAAGAGGGAGGAAGG + Intronic
1103219475 12:119231884-119231906 AAGGAGAAGGAGGGGGAGGAGGG - Intergenic
1103451319 12:121031397-121031419 AGGGGCAAGGAGAGGGAAGAGGG - Intronic
1103653013 12:122447885-122447907 GAGGCCAAGGAGAGGATGCCTGG + Intergenic
1103735897 12:123060700-123060722 AAGGCCCAAGGCAGGGTGGAAGG + Intronic
1103746287 12:123126665-123126687 GAGGCCACGGAAGGGGTGGATGG - Intronic
1105950424 13:25224758-25224780 GATGCCCAGGAGAGGGTTGAAGG + Intergenic
1106267868 13:28125986-28126008 AAAGTCTAGGGGAGGGTGGAGGG + Intergenic
1106466233 13:30016813-30016835 GAGGCAAAGGAGATGGGGGAGGG - Intergenic
1106573997 13:30957397-30957419 AAGGGCAAAGGGAGGGTTGAGGG + Intronic
1107480531 13:40782212-40782234 AAGGGCAAGGAAAGGGTTGTTGG - Intergenic
1107814533 13:44232481-44232503 AAGGCCAAGGGGAGGGACAAAGG + Intergenic
1108590886 13:51912045-51912067 AAGGCTAGGGTGAGGGTGGGAGG - Intergenic
1108813046 13:54253578-54253600 GAGGCCCATCAGAGGGTGGAAGG + Intergenic
1109311911 13:60705116-60705138 AAGGCCTATCAGAGGGTAGAAGG + Intergenic
1109736675 13:66494985-66495007 AAGACAGAGGAGAGGATGGAAGG + Intronic
1110368904 13:74718664-74718686 GAGCCCATGGAGGGGGTGGAAGG - Intergenic
1110387270 13:74928030-74928052 AAGGCCTACTTGAGGGTGGAAGG - Intergenic
1110417517 13:75268724-75268746 GAGCCCATGGAGAGGGTGGGAGG - Intergenic
1110637552 13:77783395-77783417 GAGGAGAAGGAGAGGGAGGAGGG + Intergenic
1110788963 13:79566486-79566508 GTGGCCGAAGAGAGGGTGGAGGG + Intergenic
1110792363 13:79600243-79600265 GAGCCCACGGAGAGGGTGGGAGG + Intergenic
1112470027 13:99679719-99679741 AATGGGAAGGAGAGGGTGGGGGG + Intronic
1112585626 13:100716277-100716299 AAGGGCCAGGTGAGGGTGGGAGG - Intergenic
1113088419 13:106592236-106592258 TAGGCCAAGGAGGAGGAGGAGGG - Intergenic
1114397113 14:22374289-22374311 AGGGCCCAGTTGAGGGTGGAAGG - Intergenic
1114551281 14:23534174-23534196 AGGGGCAAGAAGAGGATGGAGGG - Exonic
1114613242 14:24055461-24055483 GAGACCAAGGATAGGGTGGTTGG - Intronic
1114654512 14:24308026-24308048 AAGTCCAAGGGGAGGGATGAGGG + Exonic
1114659734 14:24336441-24336463 AAGGCCAAGTTGGGGGTGGGTGG + Intronic
1114854397 14:26420578-26420600 AGGGCCTATCAGAGGGTGGAGGG + Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115918229 14:38341973-38341995 ACTGCCAAGGAAAGGGGGGAGGG - Intergenic
1115969821 14:38932661-38932683 AAGGCCAATGAGATGGGGGCAGG - Intergenic
1116390560 14:44385018-44385040 GAGCCCACGGAGGGGGTGGAAGG - Intergenic
1116810594 14:49536391-49536413 AGGGCCTACTAGAGGGTGGAGGG + Intergenic
1117165646 14:53029937-53029959 GAGGCCTAGCAGAGGGTGGAGGG - Intergenic
1117397905 14:55329092-55329114 AAGGCCCAGGAAAGGGCTGAGGG + Intronic
1117656184 14:57959053-57959075 AAGGACAAGGAGAGAGGGAAGGG + Intronic
1118171774 14:63395704-63395726 AGGGGGGAGGAGAGGGTGGAAGG + Intronic
1119034532 14:71218435-71218457 AAGGGCCAGGAGGGGGTGGAGGG - Intergenic
1119117920 14:72044491-72044513 AAGGAGAGGGAGAGGGAGGAAGG - Intronic
1119957055 14:78809710-78809732 CAACCTAAGGAGAGGGTGGAGGG + Intronic
1120281949 14:82450352-82450374 AAAGCAAAGGGGAGGGTGGGAGG - Intergenic
1121406379 14:93721572-93721594 AAGGCAAAGGAGGGGGAGGCAGG + Intronic
1121798755 14:96756132-96756154 AGGGCCAGGGAGGGGATGGAGGG - Intergenic
1121963183 14:98280475-98280497 CAGGCCAAGGGTGGGGTGGAGGG - Intergenic
1122422657 14:101587273-101587295 AAGGCCTAGGCGTGGGAGGAGGG + Intergenic
1122579390 14:102762146-102762168 AAGGACTAGGAGAGTGGGGAGGG + Intergenic
1122655141 14:103253680-103253702 GAGGCCAAGGATTGGGAGGAGGG - Intergenic
1202852408 14_GL000225v1_random:30010-30032 AAGGGCAGAGAGAGGCTGGAGGG - Intergenic
1123451379 15:20363769-20363791 GTGGCCAAAGAGAGAGTGGAAGG - Intergenic
1123878923 15:24656198-24656220 GAGGCCTATGGGAGGGTGGAAGG + Intergenic
1123998717 15:25736735-25736757 AAGGCTTAGGAGTGGGGGGAAGG + Intronic
1124041546 15:26110198-26110220 AAGAAGGAGGAGAGGGTGGAGGG + Intergenic
1124092220 15:26616180-26616202 GGGGCCAAGGAGAGGATGGAGGG + Intronic
1125190496 15:36986955-36986977 CAGGCCAAGGGGTGTGTGGAAGG + Intronic
1125914515 15:43473957-43473979 GAGCCCACGGAGGGGGTGGAAGG + Intronic
1126871990 15:52999467-52999489 GGGGCCTAGAAGAGGGTGGAGGG + Intergenic
1126908127 15:53389397-53389419 CAGGCTGAGGAGAGAGTGGAAGG + Intergenic
1127296232 15:57610972-57610994 AAGACCAAGAAGAAGGTGGACGG + Intronic
1128732100 15:70028300-70028322 AAGGCCTAAGAGTGGGTGGGTGG + Intergenic
1128777176 15:70329412-70329434 ATGTCCAAGGGGAGGGAGGAGGG - Intergenic
1129175589 15:73837699-73837721 AAGGCCAGGAGGAGGGTGGCAGG + Intergenic
1129350005 15:74950469-74950491 AAGGCAAAGGAAAGGAAGGAAGG - Intergenic
1130602204 15:85283839-85283861 AGGGCCAAAGAGAGGATGAATGG + Intergenic
1130748559 15:86684074-86684096 AAGGCAAAGGAGAGAAGGGATGG + Intronic
1130766803 15:86879155-86879177 AGGGCCAAAGAGAGGATGAATGG - Intronic
1131314813 15:91326014-91326036 AAGGCCTACCTGAGGGTGGAGGG - Intergenic
1131694344 15:94859095-94859117 ACTGCCAGGTAGAGGGTGGAGGG - Intergenic
1131994608 15:98122096-98122118 AAGGTGAAGGAGCGGGTGAATGG - Intergenic
1132110159 15:99096966-99096988 CAGGCCTAGCAGAGGGCGGATGG + Intergenic
1132203206 15:99969230-99969252 AAGGTCAAGTAGAGACTGGAAGG - Intergenic
1132619204 16:856414-856436 AAGGCCCAGGAGAGTGTGCAGGG - Intronic
1132794657 16:1713685-1713707 AAGGCCAAGAAGAGCCTGGTGGG + Intronic
1132799929 16:1747004-1747026 AAGGCCAAACACAGGGAGGAGGG - Intronic
1132885353 16:2179889-2179911 AAGGCCAAGGAGCGGGAGGCCGG - Exonic
1133867068 16:9654255-9654277 AAGGAGAAGGAGAGGAAGGAAGG + Intergenic
1134231723 16:12435073-12435095 CAGGCCCAGGAGAGGGTTGGAGG + Intronic
1134258362 16:12630302-12630324 AAGGCTAGGGGGAGGCTGGATGG - Intergenic
1134770605 16:16806050-16806072 AAGGGGAAGGAGAAGGGGGAAGG - Intergenic
1135352211 16:21738602-21738624 AAGGCCAAGAAGAGTTTGGCTGG - Intronic
1135450701 16:22554724-22554746 AAGGCCAAGAAGAGTTTGGCTGG - Intergenic
1135690452 16:24533084-24533106 GAGGCCAAGGGGTGGGGGGAGGG + Intergenic
1135847088 16:25928721-25928743 AAGCCCATGGAGAGGGTTCAGGG - Intronic
1136028660 16:27486633-27486655 AGGGCCATGGAGAGGGTGGAAGG + Intronic
1136241825 16:28949373-28949395 GAGGCCAAGGCGGGGGCGGAGGG + Intergenic
1136665792 16:31811223-31811245 ACGGCCAGGGAGTGTGTGGAGGG + Intergenic
1136783165 16:32919870-32919892 TAGGCCTAGGAGAGGCTGGAGGG - Intergenic
1136886621 16:33933979-33934001 TAGGCCTAGGAGAGGCTGGAGGG + Intergenic
1137975170 16:53025124-53025146 GAGGCCAAGGCCAAGGTGGAAGG + Intergenic
1137985133 16:53100701-53100723 AAGGCCAAGGCCAAGGTGGGTGG - Intronic
1138105831 16:54286800-54286822 AAGGCGAGGGAGGGGGTGGAAGG - Intergenic
1139370932 16:66469036-66469058 AAGGCCAAGGTGATCTTGGAGGG - Intronic
1139788466 16:69413106-69413128 AAGGCGAGGGAGAGGTTGGGGGG - Intergenic
1140034462 16:71361681-71361703 AATCCCAACGAGAGGGAGGATGG + Intronic
1140382630 16:74504235-74504257 AGGGCCAAGGAGAGACAGGAGGG + Intronic
1140398966 16:74654498-74654520 AATCCCAAGGAGAGGGAGGGAGG - Intronic
1140480650 16:75261265-75261287 AAGGCCAAGGCCAGGGGTGAAGG + Intronic
1140852999 16:78952142-78952164 AAGCCAAAAGAGAGGGTAGAGGG - Intronic
1141155185 16:81592472-81592494 AAGGGCAAGGACAGGAGGGAGGG - Intronic
1141523998 16:84599635-84599657 AAGGCCAAAGAAAGGGGGAAGGG + Intronic
1141775829 16:86121976-86121998 AGGGACAAGGAGAAGGAGGAGGG - Intergenic
1141934776 16:87229953-87229975 AAGGGCAAGGACAGGGAGGCAGG - Intronic
1142189246 16:88710107-88710129 AAGGCCAAGGAGGAGCTGGCGGG - Intronic
1142284795 16:89167336-89167358 AGGGCCAGGGAAAGGGTGGTGGG + Intergenic
1203085818 16_KI270728v1_random:1183855-1183877 TAGGCCTAGGAGAGGCTGGAGGG - Intergenic
1142498982 17:321797-321819 AAGGCCCAGGAGCTGGCGGATGG - Intronic
1143377253 17:6474096-6474118 CAGGAGAAGGAGAGGGTGGGAGG + Intronic
1143779273 17:9220946-9220968 CAGGCCAGGGAGGGGGTGGGTGG + Intronic
1143880296 17:10024673-10024695 GAGGCCCAGGTGAGGGTGGATGG - Intronic
1143951339 17:10634925-10634947 AAGACCAAGCAGAGGCTGCAAGG - Exonic
1144044135 17:11439716-11439738 AAAGGGAAGAAGAGGGTGGAAGG - Intronic
1145037772 17:19553173-19553195 ATGCCCTCGGAGAGGGTGGAGGG + Intronic
1145783230 17:27577650-27577672 CAGGCAAGGGAGAGGGTGGCAGG - Intronic
1145928490 17:28666031-28666053 AAGGCCCAGGAGAGGAAGAATGG - Intronic
1146396058 17:32467955-32467977 AAGGCCTATCAGAGGGTGGGAGG - Intronic
1147012087 17:37458079-37458101 AGGGCCTATCAGAGGGTGGAGGG - Intronic
1147143426 17:38472051-38472073 TAGGCCTAGGAGAGGCTGGAGGG - Intronic
1147434608 17:40401842-40401864 TAGGCCAAGGACAGTGTGGCTGG + Intronic
1147464319 17:40599040-40599062 AGGAGGAAGGAGAGGGTGGAAGG - Intergenic
1147794589 17:43033451-43033473 AGGGGGAAGGACAGGGTGGATGG + Intergenic
1147890048 17:43710781-43710803 AAGGGCAAAGAGAGGGAGAAAGG + Intergenic
1148327326 17:46790679-46790701 GAGGCCAAGGAGAGAGATGATGG - Intronic
1148657264 17:49296095-49296117 AATGCCAAGGAGACTGTGGAGGG + Exonic
1148835115 17:50461846-50461868 AACTCCAAGGAGAGCGTGGTTGG + Intronic
1149079245 17:52633566-52633588 AAGGCAAAAGAGAGAGTGAAGGG - Intergenic
1149317814 17:55455451-55455473 AAGGCTAAGGTGACAGTGGATGG - Intergenic
1149368570 17:55969889-55969911 AAGTTCAAGGAGAGAGTGGTTGG + Intergenic
1149470071 17:56909208-56909230 AAGGTCCAGGAGAAGGGGGAAGG + Intronic
1149567471 17:57650312-57650334 AAGGCCCAGGGGATGCTGGAGGG - Intronic
1150000694 17:61437134-61437156 AAGGAGAGGGAGAGGGAGGAAGG - Intergenic
1150137175 17:62702410-62702432 AAGGCCAAGGGGCGGGGGGCGGG + Intronic
1150280994 17:63929549-63929571 AGGGCCAGGGAGAGGGGTGAGGG + Intronic
1150364961 17:64573966-64573988 ATGGCCTATCAGAGGGTGGAAGG + Intronic
1150458243 17:65325620-65325642 TTGGCCAGGGATAGGGTGGAGGG + Intergenic
1150885656 17:69082659-69082681 ATGGCCAAGGAGAGTGTGCCTGG + Intronic
1151049191 17:70957468-70957490 AGGGCCTATCAGAGGGTGGAGGG - Intergenic
1151157002 17:72132050-72132072 AATGCAGAGGAGAGGGAGGAGGG + Intergenic
1151956505 17:77382822-77382844 GAGGCAAAGGCGAGGGAGGAGGG + Intronic
1152596643 17:81240984-81241006 CAGGCCAAGAAGACGCTGGAGGG + Exonic
1152891586 17:82884632-82884654 AAGGCCCAGGCGAGTGTGGCGGG - Intronic
1152947534 17:83206030-83206052 AGAGGCAAGGAGGGGGTGGATGG - Intergenic
1153051143 18:904656-904678 AAGGCAAGGGAGAGGGCGGGCGG - Intergenic
1153301360 18:3594766-3594788 ACAGCCAAGGGTAGGGTGGATGG + Intronic
1153662088 18:7333919-7333941 AAGGTAGAGGAGAGGGCGGAGGG + Intergenic
1154325412 18:13387466-13387488 GAGGCCATGGCGCGGGTGGAGGG - Exonic
1154358509 18:13640816-13640838 AAGGCCAATGAGAGAGGGAACGG + Intronic
1155208013 18:23577714-23577736 GAGGCCACGGAGGGGGTGGGAGG + Intronic
1155494898 18:26433116-26433138 AAGGCCAAGGAGCAGGCTGAGGG - Intergenic
1155709092 18:28853524-28853546 AGGGCCTTGGAGAGTGTGGAGGG + Intergenic
1155976804 18:32140098-32140120 GAGCCCACGGAGAGGGTGGGAGG - Intronic
1156067871 18:33166932-33166954 AAGGCCTACTTGAGGGTGGAGGG - Intronic
1156461903 18:37326020-37326042 AAGGACCAGGGGAGGGAGGAAGG - Intronic
1156510337 18:37631158-37631180 AAGGCCATGTTGATGGTGGAAGG + Intergenic
1156631536 18:38975295-38975317 AAGGAAAAGGAGAGTGTGGAAGG - Intergenic
1156863690 18:41866033-41866055 GAGCCCATGGAGTGGGTGGAAGG - Intergenic
1156894926 18:42235149-42235171 AAGGCAGAGGAGAGGCTGGCTGG - Intergenic
1157340186 18:46771409-46771431 AAGGCTGATGAGAGGGAGGATGG - Intergenic
1157452534 18:47799490-47799512 AAGTCCATGGTGGGGGTGGAAGG - Intergenic
1157493166 18:48137859-48137881 AAGGCCTGGGAGAGGGTGTTTGG - Intronic
1157555515 18:48610591-48610613 GAGGCCCTGGAGAGGGAGGAAGG - Intronic
1157690590 18:49678696-49678718 GAGGACAAGGCTAGGGTGGACGG + Intergenic
1157804081 18:50645059-50645081 CAGGCCAGGGAGTGGGTGGCTGG + Intronic
1158249132 18:55467265-55467287 AAGTTCAAGGAGAGGGAAGATGG - Intronic
1158435780 18:57435140-57435162 AACGTCAAGGAGAGGGAGGGAGG - Intergenic
1159472912 18:68880080-68880102 GAGCCCATGGAGGGGGTGGAAGG + Intronic
1159550627 18:69892442-69892464 AAGGGCAAGGAAAGTGGGGACGG - Intronic
1159625086 18:70683677-70683699 AATGTCAAAGAGAGGGAGGAAGG - Intergenic
1159872684 18:73776222-73776244 AAGGGCAAAGAGAGGGTGAGAGG - Intergenic
1160147274 18:76375690-76375712 AAGACCAGGTAGAGGATGGATGG + Intronic
1160203056 18:76810894-76810916 ATAGCTAAGGAGAAGGTGGAAGG - Intronic
1160218110 18:76951910-76951932 AGGCCCAAGGAGAGGTGGGATGG + Intronic
1160392649 18:78546907-78546929 ATGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160392658 18:78546926-78546948 AGGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160392667 18:78546945-78546967 AGGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160843570 19:1157016-1157038 ATGGCCGAGGACAGGGTGGGAGG - Intronic
1161077756 19:2294587-2294609 AAGCTAAAGGAGAGAGTGGAGGG + Intronic
1161478605 19:4499623-4499645 AAGGCCGAGGAGAAGCTGGCCGG + Exonic
1161973703 19:7597156-7597178 AAGGCCAGGGAGAGGGGGGATGG - Intronic
1162346060 19:10118854-10118876 AAGTTCAAGGTGAGGGTGGGGGG - Exonic
1162723175 19:12674421-12674443 AAGGCCCATAAGAGGATGGAGGG + Intronic
1162733096 19:12730677-12730699 ATGGCTAAGGGGAGGGAGGAGGG + Exonic
1163181039 19:15602175-15602197 AAGGCCTACTTGAGGGTGGAGGG - Intergenic
1163495241 19:17642741-17642763 GAGGGCCAGGAGAGTGTGGATGG + Intronic
1163879551 19:19905368-19905390 GAGGCCTAGTTGAGGGTGGAGGG - Intronic
1163884274 19:19952065-19952087 GAGGCCTAGATGAGGGTGGAGGG + Intergenic
1163904782 19:20142939-20142961 GAGGCCTAGTAGAGGGTGGAGGG + Intergenic
1163908968 19:20171872-20171894 GAGGCCTAGTTGAGGGTGGAGGG - Intronic
1163927114 19:20356402-20356424 GAGGCCTAGTTGAGGGTGGAGGG + Intergenic
1163933368 19:20420390-20420412 GAGGCCTAGTTGAGGGTGGAGGG + Intergenic
1163969827 19:20781386-20781408 GAGGCCTAGTTGAGGGTGGAGGG - Intronic
1164043637 19:21514339-21514361 GAGGCCTAGTTGAGGGTGGAGGG - Intronic
1164095322 19:22004748-22004770 GAGGCCTAGTAGAGGGTGGAGGG + Intronic
1164680415 19:30130788-30130810 AGGGAGAAGGAGAGGGAGGAAGG - Intergenic
1164731065 19:30504625-30504647 AGGGCCAGAGAGAGGGTGGGAGG - Intronic
1164866846 19:31611510-31611532 AAGGGAAAGGAGAGAGAGGAGGG + Intergenic
1164885253 19:31773243-31773265 TAGGTCAAGGAAAGGCTGGAAGG + Intergenic
1165016635 19:32886012-32886034 AAGGCCTAGGAGGGTGTGGGAGG - Intronic
1165124127 19:33581986-33582008 AAGGGCAAAGAGAGGGTGAGAGG - Intergenic
1165751678 19:38264317-38264339 AAGCCCAAGGGAAGGGTGGCAGG + Intronic
1166097315 19:40549061-40549083 CTGAACAAGGAGAGGGTGGAAGG + Intronic
1166381796 19:42358624-42358646 AAGGCCAAGGAGAATGTGTGTGG + Intronic
1166631251 19:44409948-44409970 AAGCCCTAGGGGAGGGTGAACGG - Intergenic
1166778142 19:45324608-45324630 GGGGCCAAGGAGAGAGTGGGAGG + Intergenic
1166874877 19:45891075-45891097 GAGGCCGAGGAGGGGGTGGGGGG + Exonic
1167327738 19:48835770-48835792 AGGGCCAAGGTGAGGGCTGAGGG + Intronic
1167341938 19:48921549-48921571 AAGGCCCAGGAGGGGGAGAAAGG + Intronic
1167459777 19:49618756-49618778 CAGGCCTGGGAAAGGGTGGAGGG - Intronic
1167698645 19:51029522-51029544 AAGGCCCAGGACTGGGTTGAAGG - Intronic
1167795510 19:51705629-51705651 GAGGCCAAGGAGGTGGTGGGGGG - Intergenic
1167862704 19:52297957-52297979 ATGGCAAAGTAGAGAGTGGATGG + Intronic
1168287538 19:55342113-55342135 CAGGCTAAGGAGAGGGCCGAGGG - Intronic
1168306662 19:55439579-55439601 GAGGCCAGGGAGAGGGTGGTTGG - Intronic
1168464866 19:56594530-56594552 ATGGGTAAGGAGAGGGAGGAGGG - Intergenic
925206868 2:2014472-2014494 GAGTCAAAGGAGTGGGTGGAAGG + Intronic
925225287 2:2178828-2178850 AAGGCCCAGGACAGGGTGACAGG + Intronic
925939684 2:8804992-8805014 AAAGCCAAGGAGGGGGTTGTGGG - Intronic
925953455 2:8937727-8937749 AAGGCAAAGGAGTCGGTAGAGGG + Intronic
925957049 2:8977034-8977056 GAGGCCAGGGAGAGGCAGGAGGG + Intronic
926056661 2:9777737-9777759 AAGGCCAAGGACAGGGCCAAGGG - Intergenic
926107652 2:10162511-10162533 CAGGCCAAGGAGAGTGTGGCCGG - Intronic
926389014 2:12368387-12368409 AAGACCAAGGTGGAGGTGGAAGG - Intergenic
927420278 2:22923876-22923898 AGGGCCAAGAGGAGGGTGCATGG - Intergenic
927429740 2:23017386-23017408 AAGGTAAAGGAGGTGGTGGAAGG - Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
928132129 2:28660185-28660207 AAGGCCTAAGAGAGGCAGGAGGG + Intergenic
928371175 2:30741280-30741302 GAGGCCAAGGACAGGAAGGATGG - Intronic
928876866 2:36050063-36050085 GAGGCCTAGTTGAGGGTGGAAGG - Intergenic
929322324 2:40559174-40559196 AAGGCCAATGAGTGGGTTTATGG - Intronic
929778885 2:44944773-44944795 GAGGGGAAGGAGAGGGAGGAGGG - Exonic
930021400 2:47004143-47004165 ATGGCCCAGGAGAGGGTGCCGGG - Intronic
930233373 2:48865307-48865329 CAGTCAAAGGAGAGGCTGGAGGG + Intergenic
930423814 2:51187982-51188004 TAGGAAATGGAGAGGGTGGAAGG - Intergenic
930494479 2:52124300-52124322 AAAGACAAGGAGATGGGGGAAGG - Intergenic
930752757 2:54948618-54948640 AAGGTTAAGCAGAGGGAGGAGGG + Intronic
931557904 2:63525233-63525255 AAGGCCTACCTGAGGGTGGAGGG + Intronic
931708723 2:64969280-64969302 GAGCCCATGGAGTGGGTGGAAGG - Intergenic
931884377 2:66599769-66599791 AAGAGCAAGGAGAGGGTGGAAGG - Intergenic
932239967 2:70148581-70148603 GAGCCCATGGAGTGGGTGGAAGG - Intergenic
932319497 2:70811268-70811290 AAGGCCAAGATGAAGGTGTATGG - Intronic
932330173 2:70894292-70894314 AAGGGCAGGGAGAGGATGGCTGG - Intergenic
932337982 2:70941930-70941952 AAGGCCAAGGAGAGGGTGGAAGG + Exonic
933545484 2:83706070-83706092 AAGGCCTACCAGAGGGTGGAGGG - Intergenic
933866581 2:86523675-86523697 GAGGCAGAGGAGAGAGTGGAAGG - Intronic
933895373 2:86806437-86806459 CAGGCCAAGGACAAGGAGGAAGG - Intronic
934547963 2:95234458-95234480 GAGGCCAAGGAGACTCTGGACGG + Intronic
934743680 2:96744276-96744298 GAGGCCGAGGTGGGGGTGGAGGG + Intergenic
935084346 2:99830111-99830133 AGGGCCTATCAGAGGGTGGAGGG + Intronic
935784139 2:106533625-106533647 AAGGAACAGGGGAGGGTGGAAGG + Intergenic
935786028 2:106549679-106549701 CAGGGCAAGGAGAGGTGGGAGGG + Intergenic
936465415 2:112744382-112744404 AAGGCTAAGGAATGGGTGGTAGG + Intronic
936479625 2:112873960-112873982 AAGGTAGAGGAGAGTGTGGAGGG - Intergenic
936533317 2:113291818-113291840 AAGGCCATGTAGATGGTGGCAGG + Intergenic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938104411 2:128520348-128520370 CACGCCAAGCAGAGGCTGGAAGG + Intergenic
939729511 2:145764717-145764739 AAGGTTGAGGAGAGGATGGATGG - Intergenic
939882468 2:147645927-147645949 AAGGCCTTGGAGGTGGTGGAGGG - Intergenic
939961465 2:148569373-148569395 GAGGCCAGGCTGAGGGTGGAGGG + Intergenic
939994257 2:148905703-148905725 AGGGTCAAGGAGTGGGAGGATGG + Intronic
940018635 2:149133399-149133421 AAGTCAAAGGACAGGGAGGAAGG - Intronic
940037794 2:149329504-149329526 AAATCCAAGGAGAAGGTGGAGGG + Intergenic
940982083 2:160014902-160014924 AAGGACAGGGAGAGGGAGGCTGG + Intronic
941719649 2:168799773-168799795 AAGGACAAGGAGCAGGTGGCTGG - Intronic
941809214 2:169738953-169738975 AAGGGGGAGGAGAGGGAGGAGGG - Intronic
942120099 2:172768236-172768258 AAGGCCATTGAGAGGATGTATGG + Intronic
943060950 2:183040775-183040797 AAGGAGGAGGAGAGGGAGGAGGG + Intergenic
943121719 2:183744011-183744033 AAGGCATAGGACAGGTTGGAAGG + Intergenic
943604528 2:189961275-189961297 GAGGGCCAGGAGAAGGTGGAGGG + Intronic
943645047 2:190401084-190401106 AGGAACAAGGGGAGGGTGGAGGG + Intergenic
944494001 2:200288076-200288098 AGGGCCTATCAGAGGGTGGAGGG - Intergenic
944601976 2:201312683-201312705 AAGGCTACAGAGATGGTGGACGG + Intronic
944686325 2:202121087-202121109 AAGTCCAAGGAGAACGAGGAGGG - Intronic
945013102 2:205485813-205485835 AAGGATAAAGAGAGGGTGGCTGG - Intronic
945137297 2:206642221-206642243 AAGGCCAATGAGAGTGTGTGTGG + Intergenic
946130921 2:217606229-217606251 AAGGCCATGGAGCTGGTGCATGG - Intronic
946292421 2:218755190-218755212 CAGTCCAGGGGGAGGGTGGAAGG + Exonic
946669784 2:222090255-222090277 GAGGCCATGGAGAGGGAGAATGG + Intergenic
947105896 2:226667624-226667646 AAGGCCAGAGAGATGGTGAAGGG + Intergenic
947199603 2:227602953-227602975 AAGGAGAAGCAGAGGGTAGAGGG - Intergenic
947817698 2:233049007-233049029 AAGGCAGGGGAGAGGCTGGAAGG + Intergenic
947997888 2:234544193-234544215 ATGACCTTGGAGAGGGTGGAAGG + Intergenic
948236119 2:236391962-236391984 AAGGACAAGGTGAGTGGGGAAGG - Exonic
948336402 2:237210817-237210839 AAGGGCAAGGACATGGAGGAAGG + Intergenic
948366489 2:237458192-237458214 ACACCCATGGAGAGGGTGGAGGG - Intergenic
948428354 2:237902408-237902430 AAGGACAGGGAGATGGAGGAGGG + Intronic
948493956 2:238333265-238333287 CAGGCCAACCAGAGGTTGGAGGG - Intronic
948612117 2:239176374-239176396 AAGGCCAGGCAGAGGGAGGGAGG - Intronic
1169792364 20:9425025-9425047 AAGACAAAGGAGAAGGAGGAAGG - Intronic
1169804665 20:9547127-9547149 AAGGCAAAGCAGAGACTGGAGGG + Intronic
1169855785 20:10101142-10101164 AAGGACCAGGCAAGGGTGGAAGG + Intergenic
1169979075 20:11363416-11363438 AAGGAGAAGGAGAGAATGGAAGG - Intergenic
1170248332 20:14249416-14249438 AAAACCAAGGAGAAGGTGGCAGG + Intronic
1170655856 20:18287643-18287665 AAGGGCAGTGAGAGGGTGCACGG + Intergenic
1170705242 20:18738568-18738590 ATGGCCAAGGATAGGAAGGAAGG + Intronic
1171168671 20:22995881-22995903 ATGGCCAAGCAGAGGGAGGGAGG - Intergenic
1171239665 20:23554949-23554971 AGGGCCTAGTTGAGGGTGGAGGG - Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171444985 20:25196486-25196508 AGGGCCCAGGGGAGCGTGGAAGG + Intronic
1172181109 20:33004186-33004208 ATCTCCAAGGACAGGGTGGAGGG + Intronic
1172289989 20:33769345-33769367 AGGGCCAGGGAGGGGGTGAAGGG + Intronic
1172471154 20:35197430-35197452 AGGGCCAAGAAGAGGGAGAAAGG - Intergenic
1172762813 20:37333897-37333919 AAGGCCAAGGGGAAGGGGAAGGG + Intergenic
1172872656 20:38145237-38145259 AAGGCCCAGGAAAGGGTGCCTGG - Intronic
1173098022 20:40056018-40056040 AAGGCAAAGGAGGAGGTAGAAGG + Intergenic
1173827044 20:46054816-46054838 AAGGCCAAGGGAAGGAAGGAAGG - Intronic
1174066660 20:47870736-47870758 AAGGCAAAGAGGAGGGAGGAAGG + Intergenic
1174416734 20:50372556-50372578 AATGCCAAGGGGAAGATGGAGGG + Intergenic
1174701833 20:52617071-52617093 AAGGCCAAGGAGGGGAGAGAGGG - Intergenic
1174751215 20:53112959-53112981 AAGGACAGGGCAAGGGTGGAAGG + Intronic
1175031423 20:55958406-55958428 TAGGTCAAAGTGAGGGTGGAGGG - Intergenic
1175665230 20:60852946-60852968 TAGGCCAAGAAGAGGGAGGAGGG + Intergenic
1175876516 20:62232801-62232823 GAGGTCAGGGAGGGGGTGGAGGG - Intronic
1176270506 20:64233427-64233449 AAGGGGAAGGTGAGGGGGGAGGG - Intronic
1177496966 21:21902700-21902722 GAGCCCACGGAGAGGGTGGGAGG - Intergenic
1177565797 21:22818943-22818965 GAGCCCACGGAGAGGGTGGGAGG + Intergenic
1177744949 21:25200772-25200794 ATGGCCAAGTAGAAGGTTGAAGG - Intergenic
1177785919 21:25671360-25671382 AAGGCCCAAGTGAGGGTGGGTGG - Intronic
1178721779 21:35016923-35016945 AAGGCCTAGGGGTGGGTGGCAGG + Intronic
1179122032 21:38556732-38556754 AAGGCTAGGTAGAGGCTGGATGG + Intronic
1179141851 21:38732669-38732691 TTTGCCAAGGAGATGGTGGAAGG - Intergenic
1179294804 21:40052151-40052173 AAGGCCAGGGAGTGGTTGGAAGG - Intronic
1179485120 21:41705160-41705182 AAAGCCAAGCCGAGGGTGGTGGG + Intergenic
1179603918 21:42499683-42499705 AAGGCCCTCGAGAGAGTGGAGGG + Intronic
1179666033 21:42913156-42913178 AAGGCCAAGGTCAGGGGGAAAGG - Intronic
1180590166 22:16930604-16930626 AAGGGCAAGGGGAGTGTGGATGG + Intergenic
1180651998 22:17385450-17385472 AAGCCCAAGGAGAGGGAGACAGG + Intronic
1180864174 22:19106343-19106365 AAGGGCAAAGAGAGGATGGGAGG + Intronic
1181282202 22:21728039-21728061 AATGCCAGGGAGAGCGGGGAAGG + Intronic
1181728705 22:24829370-24829392 AAGGCCTATGGAAGGGTGGAAGG + Intronic
1181902391 22:26167618-26167640 GAGGCCTACCAGAGGGTGGAAGG + Intergenic
1182073030 22:27476746-27476768 GAGGCCGAGAAGAGGGTGGGAGG - Intergenic
1182573142 22:31254173-31254195 CAGGCCCAGGAGAGGGAGCAGGG - Intronic
1182576753 22:31278231-31278253 AGGGCCATGGGGTGGGTGGAAGG - Intronic
1182623459 22:31630311-31630333 AGGGCCAGGGAGCGGGTGGCCGG - Intronic
1182623685 22:31631024-31631046 AAGGCCAGGGAGAAGGGGAAGGG + Intronic
1182855671 22:33515842-33515864 GAGGCCAAGGGGAGGGTGAGGGG - Intronic
1183432478 22:37774188-37774210 AAGCCCAAGCAGAGGGTGGCTGG - Exonic
1183615707 22:38944075-38944097 GAGGAGAAGGAGAGGGAGGAAGG - Intergenic
1183971996 22:41484398-41484420 CAGGCCAGGGAGCTGGTGGATGG + Intronic
1184169862 22:42752470-42752492 AAGGCCAGGGCCAGGCTGGAAGG + Intergenic
1184286851 22:43476811-43476833 AAGGACAAGGAGAGGAGGGGAGG + Intronic
1184667094 22:45994937-45994959 AAGGTTAAGGACAGGGTGAAGGG - Intergenic
1184835722 22:47019880-47019902 AAGGGAGAGGAGAGGATGGAGGG - Intronic
1184976224 22:48064302-48064324 AAGGCTAAGGCAAGTGTGGATGG + Intergenic
949777964 3:7653111-7653133 CAGGCTAAGGAGATGCTGGAGGG - Intronic
950074540 3:10177879-10177901 AAGTCCATGGAGCGGGTGCAGGG + Exonic
950199730 3:11034514-11034536 CACGCCCTGGAGAGGGTGGAGGG - Exonic
950429188 3:12941150-12941172 AAGACCCAGGAGAGGGCTGAGGG - Intronic
950429519 3:12942894-12942916 CAGGCCAAGGAGAGGGGCCATGG + Intronic
950439908 3:13004533-13004555 TAATCCAAGGAGAGGGAGGAGGG - Intronic
950447473 3:13046650-13046672 CGGGCCATGGAGAGGGAGGAGGG - Intronic
950504485 3:13386035-13386057 AAGGGCTGGGAGAGGGTGAAGGG + Intronic
950625412 3:14242959-14242981 AAGGCCAAGTAGAGAGCCGAAGG - Intergenic
951448351 3:22808204-22808226 AAGGACAAGAAGAGAGTGGCTGG + Intergenic
951766562 3:26205897-26205919 AAAGCCAACTAGAAGGTGGAGGG - Intergenic
951881178 3:27483380-27483402 CAGGCCAAGTAGAAGGAGGAGGG - Intronic
951968870 3:28420459-28420481 AGGGCCTACTAGAGGGTGGAAGG - Intronic
952484217 3:33793278-33793300 CAGAATAAGGAGAGGGTGGAGGG - Intergenic
952512224 3:34069161-34069183 AGGGCCAAAGAGAGGATGGAGGG + Intergenic
952795278 3:37233279-37233301 GAGCCCATGGAGAGGGTGGGAGG - Intergenic
952901076 3:38112089-38112111 CTGACCAAGGAGAGGCTGGAGGG + Intronic
952932016 3:38367825-38367847 AATGCCAAGGAGATAGAGGAAGG + Intronic
952993286 3:38852168-38852190 AAGGGCAATGAGAGGAAGGAGGG + Intronic
953124478 3:40078011-40078033 GAGCCCATGGAGAGGGTGGGAGG + Intronic
953338602 3:42115308-42115330 AGGGCAAAGGAAAGGGAGGAAGG - Intronic
954155138 3:48681273-48681295 GAGGGCAAGGTGAGGGTGGGCGG - Exonic
954596513 3:51829934-51829956 AAGGCCCAGGAGAATGAGGAGGG + Intronic
954763774 3:52896749-52896771 AGGGCCACGGAGAGGGAGGCGGG + Intronic
954775229 3:53011228-53011250 AAGGTAGAGGAAAGGGTGGAAGG + Intronic
954795598 3:53160076-53160098 AGGGCAGAGGAGAGGCTGGATGG - Intronic
955687653 3:61562467-61562489 GAGACCCTGGAGAGGGTGGAGGG + Intronic
955703123 3:61701913-61701935 AAGAGGAAGGAGAGGGAGGAAGG + Intronic
955753748 3:62207431-62207453 AGGGCAAAGGACAGGGTGAATGG - Intronic
955791534 3:62593269-62593291 AAGGTCAAAGAGAGATTGGAAGG + Intronic
956105980 3:65819417-65819439 ATGACCAATGTGAGGGTGGAGGG - Intronic
957134890 3:76273962-76273984 AAGGGCAAAGAGAGGGTGAAAGG + Intronic
958105045 3:89061097-89061119 AAGGACAAAGAGAGTGTTGATGG - Intergenic
958591279 3:96161226-96161248 GGGGCCAATCAGAGGGTGGAGGG + Intergenic
960639652 3:119813372-119813394 AAGGCCATGGGGAGGGCGGGTGG + Intronic
961478384 3:127163325-127163347 CAGGCTTTGGAGAGGGTGGAAGG + Intergenic
961612502 3:128152457-128152479 AAGGAGCAGGAGAGGGAGGATGG - Intronic
962621665 3:137186310-137186332 AAGGAGAAGGAGAGGGAGGTAGG + Intergenic
962942151 3:140134747-140134769 TGGGGGAAGGAGAGGGTGGAGGG + Intronic
963246407 3:143067703-143067725 AAGGGAAAGGAGAGGAGGGAGGG - Intergenic
963298593 3:143574530-143574552 AAAGCCAAGGAGAGTGTAGGGGG + Intronic
963367826 3:144361526-144361548 TAGGGCATGGAGTGGGTGGAAGG - Intergenic
963832018 3:150018264-150018286 AAGGCAAAGGAGAGAGAAGAGGG + Intronic
963840455 3:150099619-150099641 AAGGCTGAGGAGAGGATGGAAGG + Intergenic
964367317 3:155964103-155964125 AAGGCCAAGGAGAGCAGGGTAGG - Intergenic
964435116 3:156643367-156643389 AAGTCCAGGGAGTGGTTGGAGGG - Intergenic
965044100 3:163552406-163552428 AAGCCCATGGAGTGGGTGGGAGG + Intergenic
965107796 3:164380338-164380360 GAGGCCAAGGAGAATCTGGAAGG - Intergenic
965245205 3:166258552-166258574 GAGCCCACGGAGGGGGTGGAAGG + Intergenic
965256809 3:166424209-166424231 GAGGCCATGGAGGGGGTGGGAGG - Intergenic
966313969 3:178625099-178625121 AGGGCCAGGCAGAGGGTGCAAGG - Intronic
966568641 3:181413423-181413445 AAGGGCAAGCAGAGGAAGGAAGG + Intergenic
966765052 3:183453677-183453699 AAGGAGGAGGAGAGAGTGGAGGG + Intergenic
966833200 3:184028863-184028885 GAGGCCTATCAGAGGGTGGAGGG + Intergenic
966928156 3:184658887-184658909 AAGGCCTGGGAGAGGGAGGAGGG - Intronic
966975633 3:185080805-185080827 AAGGCCCAGGAGAGGGCAGTTGG - Exonic
967148225 3:186624843-186624865 AACGACAAGGTGAAGGTGGAGGG + Intergenic
967778236 3:193406835-193406857 AAGGCCCAGGAGAAGGCAGAAGG + Intronic
968808600 4:2790160-2790182 AAGGCCAAAGAGAAGGGGGCCGG - Intergenic
969056290 4:4404892-4404914 AAGGGCAAGGAGAGAGGGCAGGG + Intronic
969685410 4:8671266-8671288 AAGAAGAAGGTGAGGGTGGAAGG + Intergenic
969705821 4:8790614-8790636 AAGGCCCAGGTGAGGATGAAAGG + Intergenic
970145232 4:13029002-13029024 AAGGCCTAGGAAAGGGTCCATGG + Intergenic
970451064 4:16166865-16166887 ATGGCTAAGGAGAAGGTGGGGGG + Intronic
970501222 4:16679294-16679316 AAGGAGGAGGAGAGGGAGGAAGG + Intronic
970889004 4:21020832-21020854 AAAGCCAAGGAGAAGTTGGGAGG + Intronic
972373599 4:38449521-38449543 GGGGCCCAGCAGAGGGTGGAGGG - Intergenic
972497254 4:39645492-39645514 AATTCCAAGGGGAGGGTGGGAGG - Intergenic
973318713 4:48788062-48788084 AAAGTGAAGGAGAGGGAGGAAGG + Intergenic
973611187 4:52637272-52637294 TGGGCCTGGGAGAGGGTGGAGGG - Intronic
973716669 4:53683662-53683684 AAGGACAATGTGAGTGTGGAAGG + Intronic
974023400 4:56711396-56711418 GAGGCCAAGGTGAGGGCTGAAGG + Intergenic
974088871 4:57289672-57289694 CAGGCCAAGGAGAGGGGGCTCGG + Intergenic
974131663 4:57763608-57763630 AAGGTCAGGGAGATTGTGGAGGG - Intergenic
974484751 4:62491980-62492002 GAGCCCATGGAGAGGGTGGGAGG + Intergenic
974749723 4:66121729-66121751 GAGGCCTATCAGAGGGTGGAGGG - Intergenic
974827795 4:67152156-67152178 GAGCCCAAGGAGGGGGTGGGAGG - Intergenic
975031374 4:69621995-69622017 AAGGCCTACTTGAGGGTGGATGG + Intronic
975160741 4:71121213-71121235 ACAGCCAAGGGGAGGGGGGAGGG - Intergenic
975504595 4:75124089-75124111 AAGGCAAAGGAGGTCGTGGAGGG + Intergenic
975561782 4:75715423-75715445 ATGGACAAAGAGAGGGTAGAAGG - Intronic
976437562 4:85035434-85035456 AAAGCTAAGGAAAGGGAGGAAGG - Intergenic
976902575 4:90197083-90197105 AAGCCCAAGGAGGGGGTCGTGGG - Intronic
977445799 4:97130434-97130456 AAGGCCTACTTGAGGGTGGAAGG + Intergenic
977917972 4:102614560-102614582 GAGGCCAAGCAGAGGGTGGAAGG - Intronic
978080286 4:104582257-104582279 GAGCCCAAGGAGGGGGTGGGAGG - Intergenic
978491005 4:109312307-109312329 GAGGCCTACTAGAGGGTGGAGGG - Intergenic
978572786 4:110157121-110157143 AAGGCCAAGAAGAAGGAGGAGGG + Intronic
978689440 4:111488785-111488807 GAGGCCTATGAGAGGGTAGAGGG + Intergenic
979349467 4:119628070-119628092 AGGGCCAGGGCGAGGGGGGACGG + Intronic
979532589 4:121784941-121784963 AAGGACAATGGGTGGGTGGATGG + Intergenic
979704088 4:123700303-123700325 AGGGGCAAGGAGAGGTTGCAAGG + Intergenic
981734892 4:147938200-147938222 GAGGCCTATGGGAGGGTGGAGGG + Intronic
981790096 4:148526689-148526711 AAGTCCCAGGAGCGAGTGGAAGG - Intergenic
982225860 4:153165771-153165793 AAGGAAAAGGAGAGTGAGGATGG - Intronic
982773992 4:159423564-159423586 ATTGCCACGGAAAGGGTGGATGG - Intergenic
983144977 4:164202250-164202272 TAAGCTAAGGAGATGGTGGAGGG + Intronic
986016395 5:3761319-3761341 AAGGCCAGGGAGATGGAGGGAGG - Intergenic
986016409 5:3761374-3761396 AAGGCCAGGGAGATGGAGGGAGG - Intergenic
986016440 5:3761525-3761547 AAGGCCACGGAGATGGAGGGAGG - Intergenic
986210187 5:5664760-5664782 ATGGCCAAGGAGAAGAGGGAGGG + Intergenic
986436876 5:7742866-7742888 ACATCCAAGGAGAGGTTGGATGG - Intronic
986681001 5:10232748-10232770 ATGGCCCAGGGGAGGCTGGAGGG + Intronic
987011455 5:13770329-13770351 AAGGGCAAGAAGAGGGAAGAGGG + Intronic
987882994 5:23774229-23774251 AAGGACAAGCAGAGGTTAGAGGG - Intergenic
989003106 5:36782101-36782123 AAAACCAAAGAGAGGGTGGAGGG + Intergenic
989665227 5:43846301-43846323 AAGGAAAAAGAGAGGGAGGAAGG - Intergenic
989727052 5:44598953-44598975 GGGGCCAATCAGAGGGTGGAGGG - Intergenic
990863734 5:60357107-60357129 AAGGGCAAGGAGAGGGTACCAGG + Intronic
991292087 5:65042920-65042942 AAGGACAGAGAGAGAGTGGAAGG + Intergenic
991426551 5:66498374-66498396 AAGGTCACAGAAAGGGTGGAAGG + Intergenic
992129267 5:73675028-73675050 AAACCCAAGGAGAGGGTTGTGGG + Intronic
992380001 5:76227463-76227485 AGGCACAAGGAGAGGGTGGTAGG - Intronic
992384828 5:76274642-76274664 AAGGCCAAGTAGTAGGTGGAGGG - Intronic
992838960 5:80668455-80668477 GAGGCCAAGGAGAGGGCTGAGGG - Intronic
993247130 5:85465420-85465442 AAGGACAAGAAGAAGGTGGTAGG - Intergenic
994359183 5:98830956-98830978 GGGGCCTAGCAGAGGGTGGAGGG + Intergenic
994737626 5:103575131-103575153 AAGGCAAAGGTGAAGGTGAAGGG - Intergenic
995615666 5:113960476-113960498 AAGGTCAAGGAGAGAGATGAGGG + Intergenic
996423266 5:123285661-123285683 AAGGGGAAGGGGTGGGTGGAGGG - Intergenic
996656095 5:125938386-125938408 AAGGCGAAGGAGAAGGAAGAAGG - Intergenic
996854949 5:127995340-127995362 ATTGCCAAGGAGAGGGGGTAAGG - Intergenic
997286911 5:132686543-132686565 AGAGCCAAGGAGAGGGTGTCTGG - Intergenic
997681096 5:135751232-135751254 CAGGCCCAGGAGAAGGAGGAGGG - Intergenic
998069001 5:139181999-139182021 AAGGCAGAGAAGGGGGTGGAAGG + Intronic
998359641 5:141573839-141573861 CAGGCAAAGAAGAGGGTGAAGGG + Exonic
998359653 5:141573875-141573897 CAGGCAAAGGAGGGGGTGGAGGG + Exonic
998595906 5:143530232-143530254 AAGGATGAGGATAGGGTGGATGG - Intergenic
998646296 5:144066061-144066083 AAGGCCAAGGTGTGGTTGGAGGG + Intergenic
998825272 5:146095231-146095253 AAGGCCATGGATAGGGTTCAAGG - Intronic
999220933 5:149976943-149976965 AAGGGCATGAAGAGGGTCGATGG - Intronic
999323793 5:150630699-150630721 GAGGGAGAGGAGAGGGTGGATGG - Intronic
999458620 5:151738889-151738911 GGGGGCAAGGAGAGGGTGGGAGG + Intergenic
999592745 5:153166819-153166841 AAGGCCAATAAAAGGGGGGAGGG - Intergenic
999783756 5:154872700-154872722 AAGGCTAAGGAGGTAGTGGATGG + Intronic
1000019796 5:157309443-157309465 AAGGCCAAGGACTGGATGGATGG - Intronic
1000145401 5:158448785-158448807 ATGAACAAGGAGAGGGTGGTTGG - Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1001207778 5:169780081-169780103 AAGGCCAAAGCCATGGTGGAAGG - Intronic
1001305101 5:170566701-170566723 AAAGCCAAGGAGGGGGAGGATGG + Intronic
1001479958 5:172081874-172081896 AAGGGGAAGGGGAGGATGGAAGG - Intronic
1001765377 5:174241882-174241904 AAGGTCAGGGGGAGGGAGGAAGG - Intronic
1002046793 5:176545999-176546021 AAGGGCAGGGAGAGGGGGCAGGG + Intronic
1002741427 5:181437784-181437806 AGAGGCAAGGAGGGGGTGGATGG - Intergenic
1003020615 6:2505766-2505788 AAGGACAAGGAGAGGTAGGTGGG - Intergenic
1003100227 6:3171041-3171063 GAGCCCATGGAGAGGGTGGGAGG - Intergenic
1003255434 6:4471017-4471039 AAGGGCAAGAAGAAGATGGAAGG + Intergenic
1003751922 6:9068610-9068632 CAAGCCAAGGAGAGGGTTGCAGG - Intergenic
1003946021 6:11076757-11076779 AAGGGCACAGGGAGGGTGGAAGG - Intergenic
1004235510 6:13872005-13872027 GAGCCCACGGAGAGGGTGGGAGG + Intergenic
1004418227 6:15444774-15444796 AAGGGCAAGGAAAGGGTGGGAGG - Intronic
1004632296 6:17433523-17433545 AGGGCAGAGGAGAGGGTGGAAGG + Intronic
1004673943 6:17823437-17823459 AAGGAAAAAGAGAGGGAGGAAGG - Intronic
1005406902 6:25498996-25499018 AAGGTCAGGGAGTGGGAGGAGGG + Intronic
1005467152 6:26126327-26126349 TAGGGAAAGGAGGGGGTGGAGGG - Intronic
1005559535 6:27024242-27024264 AAGGTCAAAGAGTGGGTGGTGGG + Intergenic
1005804566 6:29462244-29462266 AAGGGCAAGTGGAGGGTGGATGG - Exonic
1005973572 6:30780058-30780080 AAGGCCCAGGACAGGATGGCTGG + Intergenic
1006008341 6:31020997-31021019 AAGCCCATGGAGGGGGTGGGAGG - Intronic
1006091356 6:31630896-31630918 ACGGGAAAGGAGAGGCTGGATGG + Intronic
1006133477 6:31882407-31882429 AAGGGCGAGGAGGGGGTGGAGGG + Intronic
1006134743 6:31888603-31888625 ATGGCCACTGAGAGTGTGGACGG - Exonic
1006143629 6:31945552-31945574 CAGGCCAAGGAGCGGGAGGTGGG - Exonic
1006175173 6:32117126-32117148 AAGGACTTGGAGAGGGTGAAGGG + Intronic
1006277784 6:33019947-33019969 AAAGCCAAGGGGAGGTTTGATGG + Intergenic
1006303921 6:33207969-33207991 GAGCCAAAGCAGAGGGTGGAGGG + Intergenic
1006388048 6:33742956-33742978 AAGGGCAAGGAGATGGTGGGAGG + Intronic
1006717998 6:36132272-36132294 AAGCATAAGGGGAGGGTGGAAGG - Intronic
1006730107 6:36230316-36230338 AAAGCCAGGGAGAGGGTACAGGG - Intronic
1006929663 6:37680160-37680182 AAGGCAAAGGTGGGGATGGAAGG + Intronic
1007002368 6:38326176-38326198 AAGGATAAGGAGAGGGTGAGGGG + Intronic
1007076965 6:39074269-39074291 CCAGCCAAGGAAAGGGTGGACGG + Intronic
1007267687 6:40609740-40609762 AAGCCCAAGGGGAGGGGGCAGGG - Intergenic
1007581719 6:42963930-42963952 AAGCCCTGGGAGAGGGTGGGGGG - Exonic
1007695833 6:43733915-43733937 CACCCCAAGGACAGGGTGGAGGG - Intergenic
1007727755 6:43926969-43926991 ATGGCCACAAAGAGGGTGGATGG + Intergenic
1008490839 6:52085497-52085519 GAGGCCACGGAGAGAGTTGAGGG - Intronic
1008660077 6:53658564-53658586 TAGACCGAGGAGAGGGTGGAAGG + Intronic
1008695222 6:54028277-54028299 AAGACCAAGCTGGGGGTGGAGGG - Intronic
1008759613 6:54837916-54837938 TAGGACAAGGAGAGGTGGGAGGG + Intergenic
1011632357 6:89339586-89339608 AGGGGGAAGGAGAGGGGGGAAGG + Intronic
1012008153 6:93743104-93743126 GAGGCCTATTAGAGGGTGGAGGG + Intergenic
1012814008 6:103999101-103999123 AGGGCCTATCAGAGGGTGGAGGG - Intergenic
1012860799 6:104556755-104556777 AAACCCAAGGAGAGGGTTGTGGG + Intergenic
1013187590 6:107773876-107773898 AAGGCCCAGGCCAGGGTGTAGGG - Intronic
1013627389 6:111951420-111951442 AAGGCCAAGGAGGGGGAGAAAGG + Intergenic
1015047621 6:128795307-128795329 GGGGCCTATGAGAGGGTGGAGGG + Intergenic
1016067332 6:139697998-139698020 GAGCCCAAGGAGTGGGTGGGAGG + Intergenic
1016225125 6:141725390-141725412 AAAGAAAAGGAGATGGTGGAAGG - Intergenic
1016813996 6:148286970-148286992 AAGCGCATGGAGAGGGTGCAGGG - Intronic
1017669517 6:156756648-156756670 AAGGAGAAGGAGAGGAAGGAAGG + Intergenic
1018006039 6:159622895-159622917 AAGGGCAAAGAGAGGGTGAGAGG + Intergenic
1018998472 6:168727763-168727785 CAGGCCAAGGAGAGGCTGCCTGG - Intergenic
1019054375 6:169213082-169213104 AGGGCCCAGGAGAGGGCGCAGGG + Intergenic
1019226356 6:170513322-170513344 AAAGCTAGGGAGAGAGTGGAAGG + Intergenic
1019246561 6:170713549-170713571 AGAGGCAAGGAGGGGGTGGATGG - Intergenic
1019629192 7:2037771-2037793 AGGCCCAAGGAGAGGGAGGGAGG - Intronic
1019944230 7:4314021-4314043 GAGCCCACGGAGAGGGTGGGAGG + Intergenic
1020080026 7:5282203-5282225 AAGGGGAAGGAGAGGGAGGGAGG + Intronic
1020260047 7:6526168-6526190 AAGGCCCAGGATGGGGTGAAGGG - Intronic
1020808055 7:12815034-12815056 TAGGCTAAGGAGAAGGTGCATGG + Intergenic
1021115693 7:16744499-16744521 AAGGCCCAGGTGAGGGGAGAGGG - Intergenic
1022485628 7:30775416-30775438 TAGGGCAAGGTGTGGGTGGAGGG + Intronic
1022634359 7:32118117-32118139 AGGGCTAAGGAGAGAGTGGAGGG + Intronic
1022953960 7:35364410-35364432 GAGTCCAGGCAGAGGGTGGAAGG - Intergenic
1023042003 7:36180454-36180476 AAGGCCAAGGAGGGGCACGATGG - Intronic
1023348212 7:39293209-39293231 CATGCCAAGGAGAGGGAGGGTGG - Intronic
1023911143 7:44557680-44557702 AAGGGGAAGGGGAGGGAGGAAGG + Intergenic
1023915093 7:44582546-44582568 AGCACCAAGGAGACGGTGGACGG + Intergenic
1023998383 7:45175752-45175774 AAGGCCAAAGGAAGGCTGGAGGG - Intronic
1024257613 7:47550167-47550189 AAGGGCAGGGTGAGGGTGCAGGG - Intronic
1024301754 7:47892337-47892359 AAGTCCAAGGAGGGGCAGGAAGG + Intronic
1025194925 7:56925278-56925300 CAGGACCAGAAGAGGGTGGAGGG - Intergenic
1025198890 7:56950013-56950035 AAGGGGAAGGAGAGGGAGGGAGG - Intergenic
1025253961 7:57370527-57370549 AATGCCAAGGGGAAGGTGGATGG - Intergenic
1025673056 7:63626920-63626942 AAGGGGAAGGAGAGGGAGGGAGG + Intergenic
1025677027 7:63651665-63651687 CAGGACCAGAAGAGGGTGGAGGG + Intergenic
1025789223 7:64672108-64672130 GAGGCCTAGCTGAGGGTGGAAGG - Intronic
1025815627 7:64908402-64908424 GAGGCCAAGTTGAGGGTGGAGGG - Intronic
1025936218 7:66039809-66039831 GAGGCCAAGGAGAATCTGGATGG - Intergenic
1026502387 7:70953725-70953747 AAGGCAAAGGAGAAGCAGGATGG + Intergenic
1027698248 7:81437173-81437195 GAGCCCACGGAGAGGGTGGGAGG + Intergenic
1027875361 7:83761626-83761648 AAGGCCTACTTGAGGGTGGAGGG - Intergenic
1027915619 7:84316791-84316813 AAGGACAAGGAGAGGTTGCGGGG + Intronic
1028016349 7:85719008-85719030 TTAGCCAAGGAGAGGGTGGAAGG + Intergenic
1028913392 7:96232423-96232445 ACGGCCTACCAGAGGGTGGAGGG + Intronic
1029022193 7:97376453-97376475 AGGGCCTATCAGAGGGTGGAGGG + Intergenic
1029309641 7:99650730-99650752 GAGGCAGAGGAGAAGGTGGACGG - Intronic
1029546277 7:101212137-101212159 GAGGCCCAGGAGGGGCTGGATGG + Intronic
1029673203 7:102048214-102048236 CAGGACCAGGAGAGGGTGGAGGG - Intronic
1030176771 7:106661558-106661580 GAGGCCTTTGAGAGGGTGGATGG - Intergenic
1031083483 7:117280152-117280174 AAGGCCGGGGTCAGGGTGGAGGG + Intronic
1031834542 7:126667604-126667626 AAAGCTGAGGAGAAGGTGGAAGG + Intronic
1032427480 7:131833273-131833295 GAGCCCAAGAAGAGGGTGGAGGG + Intergenic
1032795308 7:135271540-135271562 AAGCCCAAAGAGAGGGAGCAAGG + Intergenic
1033418198 7:141182848-141182870 ATGGCTAAGGAAACGGTGGAAGG - Intronic
1033595227 7:142854552-142854574 AAGGAAAAGCAGGGGGTGGAGGG - Intergenic
1033899368 7:146116583-146116605 AAGGCAAAGGAGGGGGAAGAGGG - Exonic
1034248945 7:149672742-149672764 AAGGCCCTGGAAAGGGTGGTGGG - Intergenic
1034273845 7:149815609-149815631 AAGGCCATGGGGTGGGAGGAGGG + Intergenic
1034412095 7:150947123-150947145 AAGGGGAAGGGGAGGGGGGAGGG + Intronic
1034889501 7:154827613-154827635 AAGCCCAAGCAGAGTGAGGAGGG + Intronic
1035501578 8:94412-94434 AGAGGCAAGGAGGGGGTGGATGG + Intergenic
1035553339 8:545563-545585 AAGGCTGAGGGGAAGGTGGAGGG + Intronic
1035981242 8:4374788-4374810 ATGGCCCAGGAGAGGATGGCAGG + Intronic
1036436905 8:8743083-8743105 AGTGCCAAGGAGTGGGTGAAGGG - Intergenic
1038192172 8:25333199-25333221 AAGCCAGAGGTGAGGGTGGAGGG + Intronic
1038750427 8:30290010-30290032 AGGGCCTAGTTGAGGGTGGAGGG - Intergenic
1039099373 8:33924487-33924509 AGGGCAAAGGAGAGGGAAGAAGG - Intergenic
1040909181 8:52501209-52501231 AAGGACAAAGAGAGGGGGAATGG + Intergenic
1041005649 8:53494948-53494970 AAGGCCTAGAGGAGGGAGGAGGG + Intergenic
1041170644 8:55138910-55138932 AAGTCCTAGAAGAGAGTGGAGGG + Intronic
1041179779 8:55235638-55235660 TAGGTCAAGGAGAGGGAGGTAGG - Intronic
1041567274 8:59293115-59293137 CAGGCCAAGAAGAAGGGGGAAGG + Intergenic
1041861555 8:62519213-62519235 AAGGTCAAGGAAAAGATGGAAGG + Intronic
1041969089 8:63716211-63716233 GGGGCCTATGAGAGGGTGGAGGG - Intergenic
1042272857 8:66973108-66973130 AAGGCAAAGAAGAGGGGGCAAGG - Intronic
1042576041 8:70219671-70219693 AAGGGCAGGAGGAGGGTGGAGGG + Intronic
1042806565 8:72776680-72776702 ATGGCCAAGAAAAGGGTGTAGGG + Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043282796 8:78489338-78489360 AAGGCCTATTGGAGGGTGGAGGG - Intergenic
1043346493 8:79303771-79303793 GAGCCCACGGAGAGGGTGGGAGG - Intergenic
1043796672 8:84550234-84550256 AAGGAAAAGGAGAAAGTGGAGGG - Intronic
1044075855 8:87821111-87821133 GAGCCCAAGGAGGGGGTGGGAGG - Intergenic
1044628352 8:94256206-94256228 CAGGCCAAGGAGCAGGTGGGAGG - Intronic
1044874255 8:96648768-96648790 AAGACCAAGCAGAGGGAGAAGGG + Intronic
1045127462 8:99108000-99108022 AAGGCCTACTTGAGGGTGGAGGG - Intronic
1045142178 8:99298897-99298919 AAGGCCAAGGAGTGAGTGGCAGG + Intronic
1045460244 8:102419096-102419118 AATGCAAAGGAGAGAGTGGCAGG - Intergenic
1047702272 8:127461148-127461170 AAGGCCAAGGCCATGGTGGGAGG - Intergenic
1047966927 8:130051829-130051851 CAGGGCAAGAAGAGGGTGGAGGG - Intergenic
1048763179 8:137819207-137819229 GAGGCCTACTAGAGGGTGGAGGG - Intergenic
1049090705 8:140511638-140511660 AAGGCCACGGTGAGGGGGCAGGG + Exonic
1049415251 8:142492072-142492094 CAGACAGAGGAGAGGGTGGATGG - Intronic
1049731691 8:144181479-144181501 AGGGCTGAGGAGAGGGTGGCAGG - Intronic
1049932562 9:470787-470809 AAGGCCAATGAGTGGTGGGAAGG - Intronic
1051123170 9:13774016-13774038 AAGGCCAAGGAAATGGGAGAAGG + Intergenic
1051339655 9:16099897-16099919 ATGGCCAGTGAGAGGGTGGGTGG - Intergenic
1052340609 9:27360913-27360935 AGAGCCAAGGAGAAGGTGGAGGG + Intronic
1052412156 9:28135786-28135808 GAAGCCAGGGAGAGGGTAGAGGG - Intronic
1053274930 9:36776108-36776130 AAGATCAAGGAGAGACTGGAAGG - Intergenic
1053474384 9:38371457-38371479 AAGGCAAAGGTGAAGGTGGTGGG + Intergenic
1053527184 9:38842063-38842085 AGAGACACGGAGAGGGTGGAAGG + Intergenic
1054199407 9:62066494-62066516 AGAGACACGGAGAGGGTGGAAGG + Intergenic
1054638948 9:67521863-67521885 AGAGACACGGAGAGGGTGGAAGG - Intergenic
1055166297 9:73199512-73199534 AAGGGCACTGAGAGGGAGGATGG + Intergenic
1055246339 9:74248514-74248536 GGGGCCTAGCAGAGGGTGGAAGG + Intergenic
1055370480 9:75593199-75593221 AAGGCAAAGAAAGGGGTGGATGG - Intergenic
1055531394 9:77187866-77187888 AAGGCCTACTTGAGGGTGGAGGG - Intronic
1055575935 9:77660330-77660352 AAGGGAAGGAAGAGGGTGGAGGG - Intergenic
1056080928 9:83093381-83093403 AAGCCCATGGAGGGGGTGGGAGG + Intergenic
1056456754 9:86767869-86767891 AAGGACAAAGAGAGGGAAGAGGG - Intergenic
1056502638 9:87224745-87224767 AAGGCCAAGGAGGTGGTGGGTGG + Intergenic
1056805902 9:89728780-89728802 AAGGCCAAGGAGGGGAAGAAGGG + Intergenic
1056985272 9:91358250-91358272 ACTACCAAGGTGAGGGTGGAGGG + Intronic
1058764399 9:108167309-108167331 AAGGCCAAGGTTAAAGTGGAAGG + Intergenic
1059139082 9:111835015-111835037 AAGGTCAAGGAGCTGTTGGATGG - Intergenic
1059354279 9:113687234-113687256 AAGGCAGAGAAGAGGGAGGAGGG + Intergenic
1059854003 9:118375136-118375158 GAGGCCAAGGAGAGAGTGACAGG - Intergenic
1059934788 9:119298815-119298837 AAGGGAAAGGAGAGGGTTGTGGG - Intronic
1061073469 9:128326376-128326398 GAGGACAAGGAGAGGGGGAAAGG + Intronic
1061391831 9:130321019-130321041 GGGGCCAAAAAGAGGGTGGAAGG - Intronic
1061425357 9:130494914-130494936 AAGTCCCAGGAGCGAGTGGAAGG + Exonic
1061569873 9:131470649-131470671 AAGACCAAGGAGGGGAGGGATGG - Intronic
1061630550 9:131869620-131869642 AAGCCCAAGGAAAGGGAGGGAGG + Intronic
1061803749 9:133127098-133127120 CTGGCCAAGGAATGGGTGGAAGG - Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062132006 9:134901350-134901372 GAGGCCAAGGTGGGGGTGGGAGG - Intergenic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1203607338 Un_KI270748v1:69000-69022 AGAGGCAAGGAGGGGGTGGATGG - Intergenic
1185790924 X:2928220-2928242 AAGGCCAAGGCGCCGGGGGATGG + Intronic
1186185624 X:7016959-7016981 AAGCCCAAGGTGATGGTGCATGG - Intergenic
1186309533 X:8302674-8302696 AAAAGCAAGGAGAGGGTGCATGG - Intergenic
1186465275 X:9779910-9779932 GAGGGCTTGGAGAGGGTGGAGGG - Intronic
1186540964 X:10399280-10399302 CAGGCCAGGCAGTGGGTGGAAGG + Intergenic
1187274432 X:17805636-17805658 CAGGCCAAGGTGTGGGTAGAGGG + Intronic
1187279916 X:17850353-17850375 ATGGCTGAGGAGAGGGTGAAGGG + Intronic
1187381665 X:18807478-18807500 AAGAGCAAGAAGAGGGTGGAAGG - Intronic
1187425650 X:19175327-19175349 ACGGGCAAGGAGAGGGGAGAGGG - Intergenic
1188850790 X:35129287-35129309 AAGGCCTACTAGAGGATGGAGGG - Intergenic
1189142348 X:38620036-38620058 AGGGACATGGCGAGGGTGGATGG + Intronic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189369181 X:40414269-40414291 AAGGCGAAGGAAATGCTGGAAGG + Intergenic
1189463457 X:41260747-41260769 AAGGCCAAGAAGATGGGGCATGG - Intergenic
1189571235 X:42300088-42300110 AAGGCCTACTGGAGGGTGGAGGG - Intergenic
1190407608 X:50103212-50103234 GAGGACAAGGTGAGGGCGGATGG - Intergenic
1190774695 X:53543397-53543419 AAGGCAGAGGGCAGGGTGGAGGG + Intronic
1191148170 X:57190651-57190673 GAGTGCAAGGAGCGGGTGGAGGG - Intergenic
1191618605 X:63192656-63192678 CAGCCCACGGAGAGGGTGGGAGG + Intergenic
1191777525 X:64832414-64832436 GAGGCCTATCAGAGGGTGGAGGG - Intergenic
1192206994 X:69102929-69102951 AAGGCCAAGGAGAGGAGAGTGGG - Intergenic
1192261490 X:69508443-69508465 AAGACAAAGGAGAGGAGGGAGGG - Intronic
1192832671 X:74767161-74767183 TAGGCCCAGCAGAGGGTGGCTGG + Intronic
1193144156 X:78060026-78060048 CAGACCCAGGAGAGGGAGGAGGG + Intergenic
1194370967 X:93070915-93070937 GGGGCCTATGAGAGGGTGGAGGG + Intergenic
1194407192 X:93511273-93511295 AAGGCCTACTTGAGGGTGGAGGG - Intergenic
1194465996 X:94236359-94236381 AAGGGAAAGGAGAGAGAGGAAGG - Intergenic
1195570426 X:106393693-106393715 AAGACCAGGGAAAGGGAGGAGGG - Intergenic
1195751860 X:108167896-108167918 AAGGGAAGGAAGAGGGTGGAGGG - Intronic
1195966378 X:110433475-110433497 AAGGGCAGGGAGATGGGGGAAGG + Intronic
1196264180 X:113622240-113622262 AGGGTCAGGGAGGGGGTGGAAGG + Intergenic
1196434938 X:115665913-115665935 AAGTCCCAGGAGTGAGTGGAAGG + Intergenic
1196597609 X:117563559-117563581 AAGGACTAGGAGAAGTTGGAAGG - Intergenic
1196741546 X:119029790-119029812 GAGCCCATGGAGTGGGTGGAAGG - Intergenic
1196845089 X:119890867-119890889 GAGCCCACGGAGAGGGTGGGAGG - Intergenic
1197112678 X:122795292-122795314 AGGGTCAGGGAGAGGGAGGAGGG + Intergenic
1197862043 X:130981135-130981157 AAGGGTAGTGAGAGGGTGGAGGG + Intergenic
1197929633 X:131680860-131680882 AAAGCCCAGGAGAGGAGGGAGGG - Intergenic
1197945830 X:131839537-131839559 AAAGCCCAGGAGAGGAGGGAGGG + Intergenic
1198268104 X:135029836-135029858 GAGGCCTATCAGAGGGTGGAGGG - Intergenic
1198501187 X:137248815-137248837 GAGGCCTATCAGAGGGTGGAGGG + Intergenic
1198769458 X:140114070-140114092 GGGGCCTAGTAGAGGGTGGAGGG - Intergenic
1199433786 X:147789745-147789767 AAGGCCATAGGGAGGGAGGAAGG + Intergenic
1199608591 X:149595318-149595340 CAGGCCGAGGAGAGGCAGGAAGG - Intergenic
1199630531 X:149774042-149774064 CAGGCCGAGGAGAGGCAGGAAGG + Intergenic
1199680037 X:150217881-150217903 AAGGGAAAGGAGGGGGTGGGGGG + Intergenic
1200678761 Y:6182807-6182829 GGGGCCTATGAGAGGGTGGAGGG + Intergenic
1201237176 Y:11922732-11922754 AAGTCCCAGGAGTGAGTGGAAGG - Intergenic
1201285449 Y:12375094-12375116 GAGCCCATGGAGGGGGTGGAAGG + Intergenic
1201423015 Y:13820290-13820312 GAGCCCATGGAGTGGGTGGAAGG + Intergenic