ID: 932338551

View in Genome Browser
Species Human (GRCh38)
Location 2:70944588-70944610
Sequence AGGTCTGAAGGGCTGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 727
Summary {0: 1, 1: 0, 2: 2, 3: 61, 4: 663}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932338551_932338563 28 Left 932338551 2:70944588-70944610 CCATCCTCCAGCCCTTCAGACCT 0: 1
1: 0
2: 2
3: 61
4: 663
Right 932338563 2:70944639-70944661 CTCCAGTGCCCTCAGCTTACAGG 0: 1
1: 0
2: 2
3: 19
4: 194
932338551_932338558 2 Left 932338551 2:70944588-70944610 CCATCCTCCAGCCCTTCAGACCT 0: 1
1: 0
2: 2
3: 61
4: 663
Right 932338558 2:70944613-70944635 CCCTTGCATCAAATTTGCCCAGG 0: 1
1: 0
2: 1
3: 5
4: 97
932338551_932338560 3 Left 932338551 2:70944588-70944610 CCATCCTCCAGCCCTTCAGACCT 0: 1
1: 0
2: 2
3: 61
4: 663
Right 932338560 2:70944614-70944636 CCTTGCATCAAATTTGCCCAGGG 0: 1
1: 0
2: 0
3: 8
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932338551 Original CRISPR AGGTCTGAAGGGCTGGAGGA TGG (reversed) Intronic
900096938 1:943633-943655 GGCTCTGCTGGGCTGGAGGATGG + Intronic
900494229 1:2969194-2969216 CGGTCTGGATGGATGGAGGAAGG + Intergenic
900608884 1:3536119-3536141 TGGTCTGTTGGGCGGGAGGAAGG - Intronic
901176563 1:7304043-7304065 AGTTCTCAAGGGCTGGGGGAGGG + Intronic
901476360 1:9492670-9492692 AGGTGATCAGGGCTGGAGGATGG - Intergenic
901494612 1:9613927-9613949 AGTTCTCAGGGGCTGGAGGCAGG - Exonic
902513317 1:16977558-16977580 AGGGCTGGTGGGCTGGAGGTGGG - Intronic
902559172 1:17266348-17266370 AGCTCTGAAGGGGTGCAGGAGGG + Intronic
902715317 1:18268767-18268789 AGGTCTCCAGGGTTGGAGAAAGG + Intronic
903019995 1:20387044-20387066 AGGGCTGAGGGGGAGGAGGAAGG + Intergenic
903213411 1:21830764-21830786 TGGTCAGCAGGGCTGGAGGAGGG + Intronic
903267591 1:22167247-22167269 GGGATTGAAGGCCTGGAGGAAGG - Intergenic
903274059 1:22209613-22209635 AGGTCTGAGTGGTTGGAGTAAGG + Intergenic
903285336 1:22273423-22273445 AGGGCTGAGGGGCTGCAGGCTGG + Intergenic
903547604 1:24136471-24136493 AGGTCATCAGGGCTGGAGGTGGG + Intronic
903833235 1:26187253-26187275 GGGTGTGATGGGCTGGGGGATGG + Intronic
904313980 1:29648151-29648173 AGGCCTGATGGACAGGAGGAGGG + Intergenic
904484534 1:30816153-30816175 AGTCCTGAAGGGCAGCAGGATGG - Intergenic
905003051 1:34688514-34688536 AGATCTGAGGGACTGGAGGGAGG - Intergenic
905020544 1:34808056-34808078 AGCTCTCAAGGGCTGGAGTTAGG + Intronic
905631794 1:39522920-39522942 GGCCCTGCAGGGCTGGAGGATGG + Intronic
905665969 1:39763267-39763289 GGCCCTGCAGGGCTGGAGGATGG - Intronic
905791357 1:40791420-40791442 GGCTCTGAGGGGCTGGAGAAAGG + Intronic
905898804 1:41567128-41567150 GGGTGAGAAGGGATGGAGGAGGG - Intronic
906238394 1:44226074-44226096 AGGTCTTAGGGGATGGGGGAGGG + Intronic
907762778 1:57377856-57377878 AGGCCTGAGGGACAGGAGGAAGG + Intronic
907806483 1:57825528-57825550 AGGTGTTAAGGGCAGGAGGAAGG + Intronic
908006568 1:59734547-59734569 AGGTATTAATGGCTGAAGGAGGG - Intronic
908596060 1:65689969-65689991 AGGTCAGATGGACTGGATGAGGG - Intergenic
909524772 1:76610536-76610558 AAGTATGAAGGCCTGGAGGGAGG + Intronic
910553351 1:88501319-88501341 ATGTGTGAAGGCCTGGAGGCAGG + Intergenic
910957403 1:92721527-92721549 AGGGGTGGAGGGCTGGGGGAGGG + Intronic
912449409 1:109760046-109760068 GAGTCTGAGGGGCTGCAGGAGGG + Intronic
912587686 1:110781404-110781426 AGGACCAAGGGGCTGGAGGAAGG - Intergenic
913294898 1:117309904-117309926 AGTTCTGCTGGGCTGCAGGATGG - Intergenic
913668131 1:121069364-121069386 GAGACTGAAAGGCTGGAGGAGGG + Intergenic
913940343 1:125097966-125097988 AGGAATGGAGGGCGGGAGGATGG - Intergenic
914019878 1:143856805-143856827 GAGACTGAAAGGCTGGAGGAGGG + Intergenic
914658374 1:149764710-149764732 GAGACTGAAAGGCTGGAGGAGGG + Intergenic
915010302 1:152679117-152679139 ATCTCTCAAGGGCAGGAGGAGGG + Intergenic
915646455 1:157276221-157276243 AGGTGGGAGGGACTGGAGGAGGG + Intergenic
916511988 1:165480656-165480678 AGGGGTGAAGGGCTAGGGGAGGG - Intergenic
916826451 1:168446319-168446341 AGTTCTGGAAGGCTGGAGGGAGG - Intergenic
917969453 1:180197557-180197579 AGGTCTGAGGAGCTGGAGGCTGG - Exonic
918355693 1:183705235-183705257 AGGTGGGAGGGACTGGAGGAGGG + Intronic
919887858 1:201947842-201947864 GGGACTGAAGGGCAGAAGGAAGG + Intergenic
920225211 1:204433579-204433601 GGAACTGAAGGGCTGGAGCAGGG + Intronic
920298756 1:204975772-204975794 AGGGCTGAAAGGCTGGAGCCTGG - Intronic
920700588 1:208215529-208215551 ATGGATGAAGGGATGGAGGAAGG + Intronic
920773766 1:208915311-208915333 AGGTCTGCAGGGAAGAAGGAAGG + Intergenic
921884992 1:220296613-220296635 AGGACTGCAGGGCAGGAGGCAGG - Intergenic
921944567 1:220877902-220877924 AGAGCTGGAGGGCGGGAGGAGGG + Intergenic
922188313 1:223295579-223295601 AGGTCGGAAGGTATGGAGGTGGG + Intronic
922601155 1:226854905-226854927 GGGTTTGGAGGGCTGGGGGAGGG + Intergenic
922697407 1:227737706-227737728 AGGTCTGAGGAGTTGGAGGGAGG + Intronic
923235667 1:232030751-232030773 AGAGCTGAGGGGCTGGAAGAGGG + Intronic
924166564 1:241289287-241289309 AGGTCTGCAGGGCAGAAAGAGGG - Intronic
1064274968 10:13897449-13897471 AGGTAGGAAGGGATGGAGAAGGG + Intronic
1064323887 10:14330947-14330969 AGGGAGGAAGGGCGGGAGGAAGG - Intronic
1064553834 10:16528689-16528711 AGATGGGAAAGGCTGGAGGAAGG - Intergenic
1065609488 10:27457948-27457970 AGGTCTGTGGGGCAGGGGGAAGG + Intergenic
1066752035 10:38667838-38667860 AGGGGTGGAGGGCTGGGGGAGGG + Intergenic
1067441397 10:46310953-46310975 AGGACTGCAGGGCTGAGGGATGG + Intronic
1067759661 10:49035180-49035202 AGATGTGCTGGGCTGGAGGATGG - Intronic
1068803061 10:61163324-61163346 AGGTCTGCAGGGCAGAAGGGTGG + Intergenic
1069740230 10:70682677-70682699 AGGTCTGAGGGGATGGTGGCAGG + Intronic
1069915121 10:71782614-71782636 AGGCCTGAGGGGCTGGGGGCTGG - Intronic
1070758398 10:79007788-79007810 AAGCCAGAAGGGCTGGAGCAGGG - Intergenic
1071095791 10:81973063-81973085 AGGGGTGAAGGGTGGGAGGAGGG - Intronic
1071602312 10:86964362-86964384 AGGCCTGAAGGCCTGGGGCAAGG - Intronic
1072686054 10:97537616-97537638 AGGTCTGAAAAGAGGGAGGAGGG + Intronic
1072923102 10:99593263-99593285 AGGAAGGAAGGGATGGAGGAAGG + Intergenic
1073337507 10:102720857-102720879 TTGTCTGAAGAGCTGGAAGATGG - Intronic
1074033860 10:109717984-109718006 AGGGCTGAGGGGCAGAAGGAAGG + Intergenic
1074107595 10:110400156-110400178 ACATCTGGAGGGCTGGAAGATGG - Intergenic
1074300853 10:112232288-112232310 TTGTGTGAAGGGCTGGAGGTAGG + Intergenic
1074444866 10:113513387-113513409 AAGTCTGAAAGGCAGAAGGAAGG - Intergenic
1075773107 10:124957565-124957587 AGTTGTCAGGGGCTGGAGGAAGG - Intronic
1075994963 10:126869798-126869820 AGCTTTGGAGGGCAGGAGGAAGG + Intergenic
1076028848 10:127140975-127140997 AGGTCTGCCGGGCAGCAGGAAGG - Intronic
1076201608 10:128563483-128563505 AGGTGTTAAGGGCTGGTGGTTGG - Intergenic
1076558669 10:131346862-131346884 AGGAATGAAGGGAGGGAGGAAGG - Intergenic
1076558682 10:131346909-131346931 AGGAATGAAGGGAGGGAGGAAGG - Intergenic
1076558695 10:131346956-131346978 AGGAATGAAGGGAGGGAGGAAGG - Intergenic
1077048618 11:556776-556798 AGCTCTGAGGGGGTGGAGGGTGG + Intronic
1077081021 11:724826-724848 AGAGGTGAGGGGCTGGAGGACGG + Exonic
1077182784 11:1224002-1224024 TGGTCAGCAGGGCTGGAGGCAGG + Intronic
1077225142 11:1436315-1436337 AGGTGGGCAGGGCTGGAGGGAGG - Intronic
1077358083 11:2127790-2127812 GGGACTGCAGGGCTGGGGGAGGG + Intergenic
1077602296 11:3582016-3582038 AGGACTGTGGGGCTGGAGCATGG + Intergenic
1077607506 11:3621975-3621997 ACGTGTGAAGGCCTGGGGGAGGG + Intergenic
1077640942 11:3880969-3880991 AGGTTTGGACGGCTGCAGGATGG + Intronic
1077899035 11:6475075-6475097 ACCTCTGGAAGGCTGGAGGAAGG - Intronic
1078100775 11:8329129-8329151 AGGTGGGAAGGACTGTAGGAGGG + Intergenic
1078141854 11:8699026-8699048 AGGTCTGGAGGCCTGGCAGAGGG - Intronic
1078559968 11:12363016-12363038 GGGTCAGAGGGGCTGGGGGAAGG - Intergenic
1078833353 11:14998159-14998181 AGGGGTGAAGGGCTAGGGGAGGG + Intronic
1079122687 11:17696598-17696620 AGGTCTGAGGCCCTGCAGGATGG - Intergenic
1079435429 11:20442987-20443009 AGTTCTGGAGGGATGGAGAAAGG + Intronic
1079628169 11:22641118-22641140 CAGTCGGAAGGACTGGAGGAGGG + Intronic
1080104251 11:28495327-28495349 AGTTTAGAAGGGCTGGAGGATGG + Intergenic
1080364443 11:31554735-31554757 AGTTGTGATGGGCTGGAGGGTGG - Intronic
1080711070 11:34748555-34748577 TGGCCTGGAGGGCAGGAGGAAGG + Intergenic
1080814092 11:35737123-35737145 AGATCTGAAAGGTTGGAGCAGGG + Intronic
1081298808 11:41425287-41425309 AGGTGTGAAGGGCAGGGGAAGGG + Intronic
1082272659 11:50188704-50188726 AGGGCTGGGGGGCTAGAGGAGGG + Intergenic
1082833988 11:57639002-57639024 GGGGCCGAAGGGCTGGAGCAGGG + Intergenic
1082975100 11:59063225-59063247 GGGTCTGAAGGCCGGGCGGAGGG - Intergenic
1083326792 11:61877011-61877033 AGGTCTGGAGGCCTGGTGGGTGG + Intronic
1084350234 11:68592443-68592465 AGGACTGGACGGCTGGAAGAAGG - Intronic
1084381802 11:68817607-68817629 AGGCAGGAAGGGCAGGAGGATGG + Intronic
1084478785 11:69404688-69404710 AGGTTACTAGGGCTGGAGGAGGG - Intergenic
1084649911 11:70483077-70483099 ATGGCTCTAGGGCTGGAGGAAGG - Intronic
1084814555 11:71638647-71638669 AGGACTGTGGGGCTGGAGCATGG - Intergenic
1085304508 11:75477550-75477572 AAGCCTGAGGGGCTGGGGGAGGG - Intronic
1085641358 11:78195099-78195121 AGGTGTGCAGGGCTGGAGCGCGG + Intronic
1087048786 11:93866358-93866380 AGGTGGGAGGGACTGGAGGAGGG + Intergenic
1087280475 11:96204064-96204086 AGGCCTGAAGGACTGAGGGAGGG + Intronic
1089313070 11:117572827-117572849 AGGTCTCCAGGGCAGGAGGGTGG - Intronic
1089606631 11:119645167-119645189 AGGTCAAATTGGCTGGAGGAAGG + Intronic
1089695631 11:120214650-120214672 AGGTGGGAAGGGCTGGAGAGAGG - Intronic
1089889200 11:121862692-121862714 TGATCTGGAGGGCTGGATGATGG - Intergenic
1090559978 11:127921289-127921311 AGGTCTGAAGGACGCCAGGATGG + Intergenic
1090661892 11:128888382-128888404 AGGTCTGAAGGACTTAGGGAAGG - Intergenic
1091231029 11:133988222-133988244 AGGACTGGAGGGCAGGAGTAAGG + Intergenic
1091388389 12:109706-109728 AGGTTGGCAGGGCTGGGGGAAGG - Intronic
1091695158 12:2623397-2623419 AGGAGACAAGGGCTGGAGGACGG - Intronic
1091815226 12:3432558-3432580 AGGCAGGAAGGGCTGGAGGGAGG + Intronic
1091826853 12:3519373-3519395 AGGTTGGCAGGGCTGGGGGAAGG + Intronic
1091863506 12:3808481-3808503 AGGTTAGATGGGCTGTAGGAAGG + Intronic
1092218733 12:6699357-6699379 AGGGGTGAAGGGCTGGGAGATGG + Intronic
1092721110 12:11441488-11441510 GGGTGTCAAGGGCTGGGGGAAGG + Intronic
1093014962 12:14146315-14146337 AGGTCTGAAGGGGCAGAGGAAGG + Intergenic
1094056720 12:26275564-26275586 AAGTCTGAGGGGCGGGAGAAAGG + Intronic
1095621487 12:44260745-44260767 GGGTGGGAAGGGGTGGAGGATGG - Intronic
1096504274 12:52082731-52082753 AAATCTCAGGGGCTGGAGGAAGG - Intergenic
1096561462 12:52438741-52438763 GTGTCTGAAGGGCTGGATTACGG - Intergenic
1097080028 12:56423164-56423186 AGGTGTCAAGGGCTGGGAGATGG - Intronic
1098325389 12:69297085-69297107 AGTTTTTAAGGGCTGGAGGTTGG + Intergenic
1098476396 12:70909063-70909085 AGACATGAAGGGCTGGTGGAGGG + Intronic
1098685089 12:73409859-73409881 GGGGGTGAAGGGCTGGGGGAGGG - Intergenic
1099010406 12:77284786-77284808 GGGAGTGAAGGGGTGGAGGAAGG + Intergenic
1099165945 12:79307602-79307624 TGGTCGGAAGGGCTGGGGGTGGG + Intronic
1099861731 12:88231130-88231152 AGGTGGGAGGGACTGGAGGAGGG - Intergenic
1100397256 12:94196007-94196029 AGGCCTGGGGGGCTTGAGGAAGG - Intronic
1101196659 12:102390331-102390353 AGGGCTGGGGGGCTGGGGGAGGG + Intergenic
1101337056 12:103806007-103806029 CAGTCTGGAGGACTGGAGGAAGG - Intronic
1101476263 12:105051461-105051483 AGGTCTGAAGGGACAGGGGAAGG - Intronic
1101495951 12:105254251-105254273 GGGTCAGAGGGGCTGGAGAATGG - Intronic
1101784398 12:107870279-107870301 AGGGCTGATGGGCCGGAGGTGGG + Intergenic
1102198908 12:111044072-111044094 AGGACAGAAGGACAGGAGGAAGG - Intronic
1102407374 12:112685485-112685507 AGGTCTGTGAGGCTGGAGGCAGG - Intronic
1102526578 12:113516263-113516285 AGGGAGGAAGGGATGGAGGAAGG - Intergenic
1102976410 12:117209921-117209943 AGGTCTGAGGGTCTGAGGGAAGG - Exonic
1103944691 12:124519482-124519504 AGATGTGAAGGTCTGGAGGCTGG + Intronic
1104314254 12:127682106-127682128 AGGTCTGGAGCCCTGGAGCATGG - Intergenic
1104620476 12:130308148-130308170 AGGCCTGGGGGGCAGGAGGAAGG - Intergenic
1105818871 13:24062332-24062354 AGGACTAAAGGGCTGGGGGCAGG + Intronic
1106116411 13:26821438-26821460 ATGTCTGAAGGGCTGTATCAAGG + Intergenic
1106356472 13:28988018-28988040 AAGTCAGAATGTCTGGAGGAGGG + Intronic
1106394715 13:29368669-29368691 AGCTCTGGAGGGATGCAGGATGG - Intronic
1106836996 13:33645223-33645245 AGGTCTCAGGGCCTGCAGGAGGG - Intergenic
1107146673 13:37067783-37067805 AGGTTTTAAGAGCTGGAGTAGGG - Intergenic
1108167712 13:47710193-47710215 AGGTCTCACTTGCTGGAGGAGGG + Intergenic
1108201946 13:48053001-48053023 GGGACTAAAGGGCTGGGGGATGG + Intergenic
1109321562 13:60816627-60816649 AGGACGGAAGGGAGGGAGGAAGG - Intergenic
1111349260 13:87004728-87004750 AGGCTTGAACGGCTGGAGGTAGG + Intergenic
1111706881 13:91761507-91761529 TGGTCAGAAGTTCTGGAGGATGG - Intronic
1111816524 13:93160819-93160841 GGGTCTGGAAGGCTGGAAGATGG - Intergenic
1111915150 13:94352605-94352627 AGGCCTGAAGGACTGAAGTATGG - Intronic
1113523556 13:110956747-110956769 AGGGCTGAGGCGGTGGAGGAGGG + Intergenic
1113701710 13:112393488-112393510 AGGGCTGAGGCGGTGGAGGAGGG - Intronic
1113751691 13:112780946-112780968 AGCTCTCCAGGGCAGGAGGATGG - Intronic
1113872132 13:113565815-113565837 AGGTCTGAGGGTCTGAGGGAAGG - Intergenic
1113963024 13:114135816-114135838 ACGTCAGCAGGGCTGGAGCAGGG + Intergenic
1114612937 14:24054007-24054029 AGAGCTGAAGGGCTTAAGGAGGG + Intronic
1114901191 14:27061163-27061185 AGGGGTGGAGGGCTGGGGGAGGG - Intergenic
1115794400 14:36917237-36917259 AGGGGTGAAGGCCTGGATGAGGG - Intronic
1115819881 14:37202585-37202607 AAGTCTGAAGCCCTGGAGGGAGG - Intronic
1116157260 14:41221666-41221688 AGGACTGAAGGGGAGGAGGCTGG + Intergenic
1116157507 14:41225815-41225837 AAGCTTGGAGGGCTGGAGGAGGG + Intergenic
1116734531 14:48671625-48671647 AGCTCTGAAGTGGTGGAGGAAGG - Intergenic
1117629100 14:57671170-57671192 AGGTCACAGGTGCTGGAGGATGG - Intronic
1117775271 14:59177558-59177580 AGGTCTGAATGGTTGGGGAAGGG - Intergenic
1119405640 14:74397124-74397146 AAGTGTGAAGGGCTGAAGGAAGG + Intergenic
1119466672 14:74863677-74863699 GGGTCTGTAGGGCTGGAGCTGGG + Exonic
1119502815 14:75145082-75145104 AGGGGTGAAGGGCAGGAGGGTGG + Intronic
1119650588 14:76380234-76380256 ACTTCTGATGGGCCGGAGGAAGG + Intronic
1119762516 14:77161403-77161425 AGGTCAGAAGTGCTGGCGGTTGG + Intronic
1119889707 14:78173629-78173651 AGATGGAAAGGGCTGGAGGAAGG - Intergenic
1119967451 14:78932602-78932624 AGGTCTTAAGGGTTGGAAAAAGG + Intronic
1120141631 14:80936055-80936077 TGCTCTGAAGTGCTGGAGCAGGG - Intronic
1121867549 14:97377084-97377106 TGGTCTGAAGGGCAAGAGAAGGG + Intergenic
1122158018 14:99762394-99762416 AGGGGTTAATGGCTGGAGGAGGG - Intronic
1122172569 14:99889174-99889196 AGGTCTGGGGACCTGGAGGATGG + Intronic
1122937641 14:104967341-104967363 AGGTCTGCTGGGCTGGGGGTGGG + Intronic
1123680885 15:22762739-22762761 GGGTCTGGAGGGCTGGAGTAGGG - Intergenic
1123744265 15:23306476-23306498 GGGTCTGGAGGGCTGGAGTAGGG - Intergenic
1123987942 15:25661534-25661556 AGGTGTGGGGGGCTGGTGGATGG - Intergenic
1124028911 15:25991408-25991430 AGGACTGGAGGGCTGGGAGAGGG - Intergenic
1124059677 15:26278299-26278321 TGGTTTCCAGGGCTGGAGGAAGG - Intergenic
1124333096 15:28837197-28837219 GGGTCTGGAGGGCTGGAGCAGGG - Intergenic
1124374515 15:29121820-29121842 AGGGATAAAGGACTGGAGGAAGG + Exonic
1124699970 15:31904277-31904299 AGGGCTGAAGGGCTGTATGTGGG + Intergenic
1124803702 15:32860222-32860244 AGGTAGGAAGGGAGGGAGGAAGG + Intronic
1124841110 15:33243055-33243077 TGGTCAGTAGGCCTGGAGGAAGG - Intergenic
1125296584 15:38209611-38209633 AAGTCTAAGGGGCTGGAGGTGGG + Intergenic
1125415623 15:39449348-39449370 AAGACTGAAGGGCAGAAGGAGGG - Intergenic
1125520052 15:40343499-40343521 AGTTCTGGAGGGGTGGAGGTTGG - Intergenic
1125733836 15:41909977-41909999 AGGTCCCAAGGACAGGAGGAGGG + Intronic
1126987160 15:54325551-54325573 AGGGGTGAGGGGCTGGGGGAGGG - Intronic
1127535151 15:59883273-59883295 AGGTCAGGAGAGATGGAGGAGGG + Intergenic
1127854745 15:62945216-62945238 AAGTCTGAAGGGCAGGAGGCTGG + Intergenic
1128319686 15:66684264-66684286 AGGTCAGAATGGGTGGAGAAGGG + Intronic
1128716766 15:69914296-69914318 AGGGCTGCAGGGCAGGAGCAGGG - Intergenic
1128793753 15:70450372-70450394 AGGGATGAAGGGATGGAGGGAGG + Intergenic
1128838633 15:70831776-70831798 GGCCCTGAAGGGCTGTAGGACGG - Exonic
1128866274 15:71117037-71117059 ATCTCTGCAGGGCTGGAGCAGGG + Intronic
1129170001 15:73801813-73801835 AGGACTGAAGGCCTAAAGGACGG + Intergenic
1129204063 15:74024942-74024964 AGGTCTGAAGGGGTGGTGGTGGG + Intronic
1129412284 15:75356561-75356583 AGGTGTCTAGGGCTGCAGGAAGG + Exonic
1129454027 15:75667014-75667036 GGGTGTGAAGGGGTGGAAGAGGG + Intergenic
1129883676 15:79023760-79023782 AGGTCTCCTGTGCTGGAGGAGGG + Intronic
1132140093 15:99385167-99385189 GGGGCTGAAGGGCAGGAAGAAGG - Intronic
1132595255 16:746212-746234 GGGTCTGCAGGGCTGCAGGAGGG + Intronic
1132595300 16:746387-746409 GGGTCTGCAGGGCTGCAGGAGGG + Intronic
1132874053 16:2128075-2128097 AGGTGGGAGGGGCTGGAGGGAGG + Intronic
1133774701 16:8887484-8887506 GTGGCTGAAGGCCTGGAGGAGGG + Intergenic
1133783884 16:8960576-8960598 GGGTCTGAACAGCTTGAGGAAGG - Intronic
1134167396 16:11941498-11941520 AGTTCTCAAGCGCTGGTGGAAGG + Intronic
1134470525 16:14521360-14521382 AGATTTGCCGGGCTGGAGGATGG - Intronic
1134493300 16:14712198-14712220 AGTTCTCAAGCGCTGGTGGAAGG - Intronic
1134498681 16:14751322-14751344 AGTTCTCAAGCGCTGGTGGAAGG - Intronic
1134525235 16:14937952-14937974 AGTTCTCAAGCGCTGGTGGAAGG - Intronic
1134547660 16:15122967-15122989 AGTTCTCAAGCGCTGGTGGAAGG + Intronic
1134581893 16:15377766-15377788 AGTTCTCAAGCGCTGGTGGAAGG + Intronic
1134627279 16:15731252-15731274 AGGACTGAAGGCCTATAGGATGG - Intronic
1134712823 16:16336436-16336458 AGTTCTCAAGCGCTGGTGGAAGG - Intergenic
1134720688 16:16379754-16379776 AGTTCTCAAGCGCTGGTGGAAGG - Intronic
1134946739 16:18332131-18332153 AGTTCTCAAGCGCTGGTGGAAGG + Intronic
1134954004 16:18372257-18372279 AGTTCTCAAGCGCTGGTGGAAGG + Intergenic
1135158161 16:20072051-20072073 AGCTCCGAAGGGCTGAAGGGGGG + Intronic
1135312829 16:21419146-21419168 AGTTCTCAAGCGCTGGTGGAAGG + Intronic
1135365752 16:21851426-21851448 AGTTCTCAAGCGCTGGTGGAAGG + Intronic
1135446062 16:22519736-22519758 AGTTCTCAAGCGCTGGTGGAAGG - Intronic
1135548100 16:23379081-23379103 AGGGATGAATGGGTGGAGGATGG - Intronic
1135548123 16:23379173-23379195 AGGGATGAATGGGTGGAGGATGG - Intronic
1135771424 16:25221142-25221164 ATCTCTGAAGGGCTGGAGGGAGG + Intronic
1136010320 16:27359314-27359336 AGGCCAGAAGGAGTGGAGGAAGG + Intronic
1136098369 16:27974952-27974974 AGGTCTGAAGGGGCAGGGGAGGG + Intronic
1136146046 16:28317314-28317336 AGGGCAGAGGGGCTGGAGGAGGG + Intronic
1136151990 16:28356894-28356916 AGTTCTCAAGCGCTGGTGGAAGG + Intronic
1136168243 16:28470762-28470784 AGTTCTCAAGCGCTGGTGGAAGG + Intronic
1136194756 16:28644289-28644311 AGTTCTCAAGCGCTGGTGGAAGG - Intronic
1136211090 16:28758388-28758410 AGTTCTCAAGCGCTGGTGGAAGG - Intronic
1136255811 16:29038346-29038368 AGTTCTCAAGCGCTGGTGGAAGG - Intergenic
1136309499 16:29397890-29397912 AGTTCTCAAGCGCTGGTGGAAGG + Intronic
1136322942 16:29499654-29499676 AGTTCTCAAGCGCTGGTGGAAGG + Intronic
1136375012 16:29860303-29860325 AGGTCTGCAGGGCTGGAGTGTGG - Intronic
1136437626 16:30239622-30239644 AGTTCTCAAGCGCTGGTGGAAGG + Intronic
1136705531 16:32185058-32185080 GGGTCTGGAAGGCTGGAGCAGGG + Intergenic
1136762382 16:32744349-32744371 GGGTCTGGAAGGCTGGAGCAGGG - Intergenic
1136805717 16:33126037-33126059 GGGTCTGGAAGGCTGGAGCAGGG + Intergenic
1137596780 16:49729081-49729103 TGATTTGAAGGGCTGGAGGAAGG + Intronic
1137634238 16:49971801-49971823 AGGTGTGAGGGTGTGGAGGAAGG + Intergenic
1137655533 16:50154602-50154624 AGGTGTGGAGGGCTGGAGGCGGG - Intronic
1138103153 16:54270624-54270646 AGGCCTGGAGGGCTTGAGAAGGG + Intronic
1138415105 16:56867124-56867146 ATGACTGATGGGCTGGTGGAGGG + Exonic
1138704150 16:58896773-58896795 GGGGGTGTAGGGCTGGAGGAGGG + Intergenic
1139331986 16:66200069-66200091 AGGTGTGGTGGGCTGGGGGAGGG - Intergenic
1139478545 16:67215646-67215668 AGTTGGGCAGGGCTGGAGGAAGG - Intronic
1139857180 16:69990272-69990294 AGTTCTCAAGCGCTGGTGGAAGG + Intergenic
1140028162 16:71311009-71311031 AGGTTTAAAGAGATGGAGGAAGG + Intergenic
1140365490 16:74377651-74377673 AGTTCTCAAGCGCTGGTGGAAGG - Intergenic
1141187567 16:81798793-81798815 AGCTCAGAAGAGGTGGAGGAGGG + Intronic
1141523410 16:84596445-84596467 AGATCTGAAGGGTTGGCTGATGG + Intronic
1141997691 16:87645725-87645747 GGGCCTTTAGGGCTGGAGGAAGG + Intronic
1142032046 16:87843482-87843504 TGGCCTGGAGGGCTGCAGGAGGG + Intronic
1142141158 16:88473455-88473477 AGGGCCGCAGGGCGGGAGGAGGG + Intronic
1142174620 16:88639435-88639457 AGGTCAGGAGGGCCGGAGGGAGG - Intronic
1142175185 16:88642000-88642022 AGACCTGAAGGGGAGGAGGAAGG + Intergenic
1142176986 16:88650023-88650045 AGGGTGGGAGGGCTGGAGGACGG - Intronic
1142225505 16:88875337-88875359 GGGTGGGCAGGGCTGGAGGATGG + Exonic
1203064538 16_KI270728v1_random:1004668-1004690 GGGTCTGGAAGGCTGGAGCAGGG - Intergenic
1142590956 17:1005853-1005875 AGGTATGGAGGGCAGGAGGTGGG + Exonic
1142675079 17:1508575-1508597 AAGACAGACGGGCTGGAGGAAGG + Intronic
1142983210 17:3683218-3683240 AGGTGGGAAGGGTTGGTGGAGGG + Intronic
1143393896 17:6576742-6576764 GGGTCTGAAAGGCAGAAGGAAGG - Intergenic
1144504377 17:15817529-15817551 AGGCCTGAGATGCTGGAGGATGG + Intergenic
1144634133 17:16893197-16893219 AGGCCTGAGATGCTGGAGGATGG + Intergenic
1144671260 17:17133895-17133917 AGGTGTGAAGGGCGGAAGGATGG + Intronic
1144687640 17:17236881-17236903 GGGTCTGAGGGGTTGGCGGAGGG - Intronic
1145168231 17:20633038-20633060 AGGCCTGAGATGCTGGAGGATGG + Intergenic
1145778445 17:27545689-27545711 GGGGCTGGAGGGCTTGAGGAAGG + Intronic
1146164320 17:30576007-30576029 AGGCCTGAGATGCTGGAGGATGG + Intergenic
1146399631 17:32492963-32492985 AAGGCTGGAGGGCAGGAGGAGGG - Exonic
1146498339 17:33343037-33343059 AGGTCTGAAGGATAAGAGGAAGG + Intronic
1146552161 17:33790602-33790624 AAGTCTGTAGGGCTGGAGTCAGG - Intronic
1146663315 17:34679756-34679778 ATGTCTGCATGGCAGGAGGATGG + Intergenic
1146805139 17:35858867-35858889 AGGTGTGAGGGGCAGGAGGCTGG - Exonic
1146820894 17:35982977-35982999 AGGGATGAAGGGAGGGAGGAAGG - Intergenic
1146919133 17:36698215-36698237 AGAGCTGGGGGGCTGGAGGATGG + Intergenic
1147182840 17:38697575-38697597 ATGTCTGTAGGGGTGGAGAAGGG - Intergenic
1147200503 17:38798769-38798791 AGGTAAGGAGGCCTGGAGGATGG + Intronic
1147387847 17:40092229-40092251 GGGTCTGCAGGGCTGGGAGAGGG + Intronic
1148128946 17:45251062-45251084 AGGTGACCAGGGCTGGAGGAGGG - Intergenic
1148450528 17:47774848-47774870 GAGTCTAAAGGGCTGAAGGAGGG - Intergenic
1148552451 17:48558593-48558615 AGGGCTGGGAGGCTGGAGGACGG + Intronic
1148745204 17:49914208-49914230 AGGGCTGAGCAGCTGGAGGAGGG - Intergenic
1148756496 17:49975799-49975821 TGGCCTGAGGGGCTGGGGGAGGG + Intergenic
1148986045 17:51622213-51622235 AGGGCTGAAGGGTTGGGGGAGGG + Intergenic
1149525302 17:57350985-57351007 AGGCCTGAGGGGCAAGAGGAGGG + Intronic
1149578030 17:57727688-57727710 AGGAGGGAAGGGCAGGAGGAGGG + Intergenic
1149990229 17:61379071-61379093 TGGACTGAGGGGCTGGGGGAGGG + Intronic
1150295581 17:64005623-64005645 TGGGCAGATGGGCTGGAGGAAGG - Intronic
1150455029 17:65300486-65300508 AGGTCTGCTGAGCTGCAGGATGG - Intergenic
1150679177 17:67270678-67270700 GGGTGTCAGGGGCTGGAGGAAGG - Intergenic
1151328537 17:73393491-73393513 AGGCCAGATGGGCAGGAGGAAGG + Intronic
1151359933 17:73582739-73582761 ATATCTGAAGGGCTGAAGGGGGG - Intronic
1151569982 17:74921297-74921319 AGGACTGGAGGGGAGGAGGAGGG + Intronic
1153565191 18:6412287-6412309 AGGTTTGGTGGGCTGGAGGCAGG - Intronic
1153754083 18:8262502-8262524 AGCCCTGGAGGCCTGGAGGATGG - Intronic
1153913215 18:9721994-9722016 AGGTCTGTGAGGCTGGAGCAGGG + Intronic
1154118633 18:11633523-11633545 AGTTCTCAAGCGCTGGTGGAAGG + Intergenic
1155105942 18:22666582-22666604 AAGTCCAAAGGGCAGGAGGAAGG - Intergenic
1155637044 18:27968403-27968425 GGGTTTGAAGTGCTGGAGGGGGG + Intronic
1156554769 18:38054713-38054735 AGTTCTTAAGGGCTGGAAGAAGG + Intergenic
1156837075 18:41567264-41567286 AGGCCTGAAGAGATGGAGGAAGG + Intergenic
1156925513 18:42573170-42573192 GGGTGTGAGGGGCTGGGGGAGGG + Intergenic
1157786292 18:50486045-50486067 GGGTGTGAATGGCTGGAGGTAGG - Intergenic
1157919479 18:51699837-51699859 AGGTGGGAGGGACTGGAGGAGGG - Intergenic
1158153112 18:54394441-54394463 AGGTAGGAAGGGAGGGAGGAAGG - Intergenic
1158343296 18:56489241-56489263 ATGTTTGAAGTGCTTGAGGATGG - Intergenic
1158439460 18:57461760-57461782 AGGCCAGAAGGGCTGGGGAAGGG - Intronic
1158548401 18:58415002-58415024 AGCTCTGAAGGGAGGGGGGAAGG - Intergenic
1159010547 18:63055362-63055384 AGGGAGGAAGGGCTGGAGGGAGG - Intergenic
1159916041 18:74188778-74188800 AGGTGGGGAAGGCTGGAGGAGGG - Intergenic
1160385032 18:78491711-78491733 GGCTGTGAAGGGCTGCAGGAGGG + Intergenic
1160458414 18:79019184-79019206 AGGTCTGTGGGGGAGGAGGAGGG - Intergenic
1160872155 19:1282436-1282458 AGGTGTGAAGGGAAGGAGGGAGG + Intergenic
1160872180 19:1282497-1282519 AGGTGTGAAGGGAAGGAGGGAGG + Intergenic
1160877276 19:1302561-1302583 AGGTCTTTACGGCTGGACGATGG + Intergenic
1160899304 19:1419252-1419274 AGAACTGCAGGGCTGGAGGAAGG - Intronic
1161521246 19:4724529-4724551 ATGTCTAAAAGGCAGGAGGAAGG + Intronic
1161742615 19:6032560-6032582 AGGGCTGAGAGGCTGGGGGAGGG + Intronic
1161766485 19:6211591-6211613 AGGGCTGAGGGCCTGGAGGTGGG - Intergenic
1161801909 19:6421076-6421098 TTGTCTGAAGGGCTGTGGGAGGG - Intronic
1162500834 19:11052734-11052756 CTGTCTGCAGGGCTGGGGGAGGG - Intronic
1162995095 19:14329684-14329706 AGGCCTGAAGGCCAGGAGGCAGG + Intergenic
1163499363 19:17666701-17666723 AATACTGAAGGGGTGGAGGAAGG + Exonic
1163499576 19:17668245-17668267 AGCTCAGTAGGCCTGGAGGATGG - Intronic
1163643585 19:18475744-18475766 AGGTGTCCAGGGCTGGAGGTGGG + Intronic
1164134010 19:22394686-22394708 GGGTGTGAGGGGCTGGGGGAAGG + Intronic
1164164797 19:22662074-22662096 GGGTATGAGGGGCTGGGGGAAGG - Intronic
1164756116 19:30691068-30691090 AGGAGTTAAGGGCTGGAGGTGGG + Intronic
1165059249 19:33196797-33196819 GGGACTGAAGGAGTGGAGGAAGG - Intronic
1165079496 19:33299337-33299359 AGGTGTGGAGGGCTGGATGGAGG + Intergenic
1165221044 19:34317055-34317077 ATGGCTGAAGGCCTGAAGGAGGG - Intronic
1165639118 19:37369261-37369283 AGGACTGCAGAGCAGGAGGAAGG + Intronic
1166087681 19:40487855-40487877 GGGCCTGAAGGGCTGGGGCAGGG + Intronic
1166113648 19:40639531-40639553 AGCCCTGGAGGCCTGGAGGATGG - Intergenic
1166318138 19:42000050-42000072 AGGTCAGCATGGCTGGAGGGGGG + Intronic
1166773220 19:45297175-45297197 GGGTCCGAGGGGCTGGAGGAGGG + Intronic
1167423453 19:49417140-49417162 AGGTCTGCTGGGGTGAAGGAGGG - Exonic
1167502864 19:49857314-49857336 GGCTCTGCAGGGCTGGAGGGTGG + Intronic
1167789716 19:51666669-51666691 AGGTAGGAAGGGAGGGAGGAAGG + Intergenic
1168289669 19:55351481-55351503 TGGTCTGGAGGCCGGGAGGACGG + Intronic
925947360 2:8878077-8878099 AGGTGACAATGGCTGGAGGAGGG + Intronic
926721644 2:15965669-15965691 AGCTCTGAAGGGCTGGATGGAGG - Intergenic
927172058 2:20378710-20378732 AGGTCTGAAGCTCTGGAGGGAGG + Intergenic
928388498 2:30889807-30889829 GAGTCTGAAGGGCAGGAGTATGG + Intergenic
928571422 2:32613069-32613091 ATGTGTAAAGGCCTGGAGGAGGG - Intronic
928660552 2:33497974-33497996 AGGAAAGAAGGGCTGGAGAAAGG - Intronic
928660556 2:33497994-33498016 AGGAAAGAAGGGCTGGAGAAAGG - Intronic
929216924 2:39424345-39424367 AGGTGGGAGGGGATGGAGGAAGG + Intronic
929598803 2:43192326-43192348 AGGACTGGAGGTCTGGGGGAGGG - Intergenic
929855243 2:45632101-45632123 TGGTCTGAAGAGCAGGAAGAGGG + Intergenic
930155940 2:48107706-48107728 AGGTCAGAGGGGCTGCAGCAGGG - Intergenic
931743087 2:65266470-65266492 AGGTCAGAAGGGTAGCAGGAGGG + Intronic
932327791 2:70874716-70874738 ACGTTTAAAGGGCTGGAGGTTGG + Intergenic
932338551 2:70944588-70944610 AGGTCTGAAGGGCTGGAGGATGG - Intronic
932455060 2:71844249-71844271 AGGGATGCAGGGGTGGAGGAAGG - Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933167901 2:79095493-79095515 AGGTGGGAAGGACAGGAGGAGGG + Intergenic
933843749 2:86308655-86308677 TGGTCTGAAGAGCTGGAGTGAGG + Intronic
934743014 2:96739677-96739699 AGGTCTGAAAGGCAGGAGTTAGG - Intronic
934780759 2:96968376-96968398 TGGTTTGCAGGGCGGGAGGAGGG - Intronic
935118753 2:100161259-100161281 AGGTCCGGAGGGCCAGAGGATGG + Intergenic
935224170 2:101038677-101038699 GGGACAGAAGGGCGGGAGGAAGG + Intronic
935798167 2:106665584-106665606 AGGACTGAGGGGTTGGAGAATGG - Intergenic
937073937 2:119087424-119087446 TCGTCTGAAAGGCTGGAGAAGGG + Intergenic
937952967 2:127402363-127402385 AGGCCTGCAGGCCTGCAGGATGG - Intergenic
938406979 2:131038259-131038281 AGGGCTGCAAGGCTGCAGGAGGG - Intronic
938407012 2:131038381-131038403 AGGGCTGCAAGGCTGCAGGAGGG - Intronic
938407033 2:131038472-131038494 AGGGCTGCAAGGCTGCAGGAGGG - Intronic
938761592 2:134431073-134431095 AGATGTGAAGGCCTGGAGGGGGG + Intronic
939830294 2:147063448-147063470 AGTTCTGCAGGGCTGGGGGAGGG - Intergenic
940868198 2:158837777-158837799 AGGTCTGAAGGCATGCAGGGAGG + Intronic
941394447 2:164956754-164956776 AGGGCTGAAGGCCTGGGGAAAGG - Intergenic
942669424 2:178358082-178358104 AGGGGTGAGGGGCTGGGGGAGGG + Intronic
942760775 2:179394793-179394815 AGGTATGTAGGGAAGGAGGATGG + Intergenic
943538605 2:189183472-189183494 AGGTCTGTAGCTCAGGAGGAAGG - Intergenic
943567744 2:189536129-189536151 AGGTCTCTAGGCCTGGAGGTGGG + Intergenic
944777524 2:202982141-202982163 AGTCCTGAAGGACTAGAGGACGG - Exonic
944897361 2:204178445-204178467 AGGATTGAAGAGCTGGGGGATGG - Intergenic
946012903 2:216580705-216580727 AGGAAGGAAGGGCAGGAGGAAGG - Intergenic
946372848 2:219290961-219290983 AGGCCTGGAGGCCTGGGGGAGGG + Intronic
946408088 2:219502815-219502837 AGGTATAAAGGCCTGGAGGCAGG + Intronic
946784720 2:223230918-223230940 AGGAAGGAAGGGATGGAGGAAGG - Intergenic
946967724 2:225055638-225055660 AGGTCAGAAGGGCAGTGGGATGG - Intergenic
947123756 2:226844719-226844741 AGGTCTGAAGGGCTGTCAGTTGG + Intronic
947661251 2:231870129-231870151 AGGAAGGAAGGGATGGAGGAAGG - Intergenic
947722184 2:232376908-232376930 AGATCTGGAGGGCAGGAGGCAGG - Intergenic
947859670 2:233349557-233349579 AGCAATGAAGGGCTGGAGAAGGG + Intergenic
948082458 2:235217720-235217742 AGGGCTGAAGTGGTGGGGGATGG - Intergenic
948850305 2:240702396-240702418 AGGTCAGAGGGGTGGGAGGAGGG - Intergenic
1169230985 20:3888962-3888984 AGCACTGCTGGGCTGGAGGAGGG + Intronic
1169362986 20:4967064-4967086 AGGTCAGAAGGGCTGGAGGCAGG + Intronic
1170628706 20:18049800-18049822 AGGTCTGTGGGGCAGGAGGAGGG + Intronic
1170639917 20:18142727-18142749 ACCTCAGAAGGACTGGAGGAAGG + Exonic
1172547520 20:35772920-35772942 AGGTTTGAAGGGCTGAGGAAAGG - Intronic
1172999985 20:39098736-39098758 AGATTTGTGGGGCTGGAGGAAGG - Intergenic
1173151374 20:40569146-40569168 AGCTGTGAAGGGCTGGAAGTTGG - Intergenic
1173182226 20:40814107-40814129 CAGGCTGAAGGGCTGGGGGAAGG - Intergenic
1173253526 20:41377001-41377023 TGGTCAGAGGAGCTGGAGGAGGG + Intergenic
1173338185 20:42130288-42130310 TGGGCTGAAGGGATGGAGGGAGG + Intronic
1173789138 20:45816285-45816307 AGGTCGGAGGAGGTGGAGGAGGG - Intronic
1174171307 20:48619742-48619764 AGAGATGAAGAGCTGGAGGAGGG - Intergenic
1174514769 20:51083273-51083295 AGAGCTGAAGAGCGGGAGGAAGG - Intergenic
1175229569 20:57465252-57465274 TGGTCTGGAGGGCAGCAGGAAGG - Intergenic
1175451824 20:59075938-59075960 AGGTCTGAATGGGTGGAGGTGGG + Intergenic
1175777695 20:61663514-61663536 GGGTCAGAGGGGCCGGAGGAAGG + Intronic
1175798661 20:61788324-61788346 AGCCCTGAGGGGCTGGGGGAGGG + Intronic
1175934718 20:62509516-62509538 AGGTGTGGAGGGGTGGAGGATGG - Intergenic
1175934885 20:62509974-62509996 AGGGGTGAAGGGGTGGAGGGTGG - Intergenic
1175934895 20:62509997-62510019 AGGGGTGGAGGGGTGGAGGATGG - Intergenic
1175934914 20:62510043-62510065 AGGGGTGGAGGGGTGGAGGATGG - Intergenic
1176093382 20:63328805-63328827 AGGGCGGGAGGGCGGGAGGAAGG - Intronic
1178791326 21:35702966-35702988 AGGCCTCCAGGGATGGAGGAAGG + Intronic
1179030674 21:37717304-37717326 AGGTTGGGAGGGCTGGAGGTGGG + Intronic
1179032840 21:37735490-37735512 CAGTGAGAAGGGCTGGAGGAGGG - Intronic
1179536905 21:42058773-42058795 AGGACTGAAGGGCAGCAGGGAGG + Intergenic
1180167226 21:46036439-46036461 TGGTCTGGAATGCTGGAGGAGGG - Intergenic
1181350202 22:22249691-22249713 AGGCCAGCAGGGCTGGAGGCTGG - Intergenic
1181907394 22:26210165-26210187 TGGCCTGAAGGGCAGGGGGAGGG - Intronic
1182585124 22:31340534-31340556 GTGGCTGTAGGGCTGGAGGAGGG + Intronic
1183395505 22:37568813-37568835 AGGTGTGAGGGGCTGGGGCACGG + Exonic
1183620137 22:38967292-38967314 ATTTCTGCAGGGCTGGAGGTGGG + Intronic
1183669245 22:39262644-39262666 AGAGCTGAAGGGCTGAGGGATGG - Intergenic
1184033542 22:41908286-41908308 AGCTGTGCAGAGCTGGAGGAGGG - Intergenic
1184411491 22:44328850-44328872 AGACCTGGAGGGCTGGGGGATGG - Intergenic
1184430978 22:44441471-44441493 AGGTGTGCAGGGCTCCAGGAGGG - Intergenic
1184489333 22:44800042-44800064 TGGTCTGCAGGCATGGAGGATGG + Intronic
1184594505 22:45505540-45505562 AGGTGTGTAGGGCAGGAGTAGGG + Intronic
1184944590 22:47794114-47794136 AGGTGTGAAGGGAGGGAGGAAGG - Intergenic
1185016098 22:48343585-48343607 AGATGGGAATGGCTGGAGGACGG + Intergenic
1185039731 22:48497887-48497909 AGGTTTGGAGGCCTGGAGGCGGG + Intronic
1185335435 22:50269152-50269174 AGACCTGAAGGGCAGGAAGAGGG - Intronic
1185380367 22:50505028-50505050 AGCGCTGCAGGGCTGGGGGATGG - Intronic
949459549 3:4275504-4275526 AGGTCTGCTGGGATGGAGGTGGG - Intronic
949758245 3:7438684-7438706 AAGACTGAAGGGCAGGAGGGTGG - Intronic
949804558 3:7940209-7940231 GGGGCTGGAGGGCTGGGGGAGGG + Intergenic
950096637 3:10334483-10334505 TGGTCTAAAGGGGAGGAGGATGG + Intronic
950287370 3:11755381-11755403 AGGACTAAAGGGATTGAGGAAGG + Intergenic
950421624 3:12902965-12902987 AGGTGTGAGGGGTCGGAGGAGGG + Intronic
950486441 3:13276671-13276693 AAGGCTGATGGGCTGGAGAAAGG + Intergenic
950899327 3:16482998-16483020 ATGTCAGAAGCCCTGGAGGAGGG - Intronic
950938086 3:16863409-16863431 AGATTTTAAGGGCTGGGGGATGG + Intronic
951737867 3:25887654-25887676 AGGCCTGAAGGTCTAGGGGAAGG - Intergenic
953686061 3:45079285-45079307 GGGTCTGAAGGGCAGGGCGAGGG + Intergenic
954146424 3:48636532-48636554 AGGGCCGCTGGGCTGGAGGAGGG + Exonic
954465064 3:50649455-50649477 AGGTCAGAAGAGCTGAGGGATGG + Intergenic
954595220 3:51818785-51818807 AGGTCTGAAGGGATGGGTCATGG + Intronic
955221305 3:57025646-57025668 AGCCCTGAATGGCTGGAGGGAGG - Intronic
955315343 3:57934035-57934057 AGCTATGAAGTGCAGGAGGAGGG - Intergenic
955598081 3:60613563-60613585 AGGAGGGAAGGGCTGGAGGGAGG - Intronic
955627479 3:60933960-60933982 AGCTCTGAATGGCTTGTGGAAGG + Intronic
955944567 3:64180466-64180488 AGGGCTGAAGGGGAGGAGAATGG - Intronic
955992491 3:64642874-64642896 AGGTCTGAAGGCCAGGGGGTGGG + Intronic
956179187 3:66501293-66501315 AGGTGTGAAGGGCGGGAGACTGG + Intergenic
958116874 3:89232014-89232036 AGATCTGAAGGGCAGAAGGGAGG + Intronic
958833637 3:99118401-99118423 AGAACTGAAGAGGTGGAGGATGG + Intergenic
960146653 3:114210898-114210920 AGGGGTGGAGGGCTGGGGGAGGG + Intergenic
960223332 3:115142906-115142928 AGGATGGGAGGGCTGGAGGAGGG + Intronic
960934999 3:122893767-122893789 ATGTAGGAAGGGCTGGAGGGAGG + Intergenic
961280942 3:125765697-125765719 AGGACTGTGGGGCTGGAGCATGG - Intergenic
961315395 3:126032128-126032150 AGGTGTGAAGGGGTGGGGGCTGG + Intronic
961903935 3:130242885-130242907 AGATAGGAAAGGCTGGAGGAGGG - Intergenic
963060706 3:141222492-141222514 AGGTATGATGGGAGGGAGGAAGG + Intergenic
963108576 3:141666129-141666151 AGGACGGAAGGGAGGGAGGAAGG + Intergenic
963112354 3:141698034-141698056 AGGGCTGGGGGGCTGGAGAAAGG + Intergenic
963258529 3:143170239-143170261 AGGTCTGCGGGGCAGGAAGAAGG - Intergenic
964751677 3:160059407-160059429 AGGTGTGAAGTGCAGCAGGAAGG + Intergenic
966734098 3:183175340-183175362 ACATCTGTAGGGATGGAGGAGGG - Intergenic
967104195 3:186242258-186242280 AGGGCTGGAGGGCAGGAGGTGGG - Intronic
967893842 3:194382033-194382055 AGGGGTGAGGGGCTGGAGAAGGG + Intergenic
968647631 4:1748435-1748457 TGGAGTGATGGGCTGGAGGAGGG - Intergenic
968890356 4:3365392-3365414 AGGTCTTGAGGGAGGGAGGAGGG + Intronic
968890518 4:3366281-3366303 AGGGGTGGAGGGCAGGAGGATGG + Intronic
968957819 4:3728118-3728140 CCGTCTGCAGGCCTGGAGGAGGG + Intergenic
969021482 4:4142829-4142851 AGGGAGGAAGGGCTGGAGGGCGG + Intergenic
969350108 4:6593476-6593498 GGGTCTGCAGGGAAGGAGGATGG - Intronic
969370525 4:6728456-6728478 AGGTGTGAAGGTCTTGAGGTGGG - Intergenic
969483219 4:7457888-7457910 AGGTCAGGAGGGCTGCAGGGCGG + Intronic
969499509 4:7544176-7544198 ATGGATGAAGGGATGGAGGATGG - Intronic
969705567 4:8789404-8789426 AGGCCTGAAGGCTGGGAGGAGGG + Intergenic
969722208 4:8898339-8898361 AAGCCAGAAGGGCTGGGGGAAGG + Intergenic
969737220 4:8999938-8999960 AGGACTGTGGGGCTGGAGCATGG - Intergenic
970248636 4:14091054-14091076 AGATCTGAGGGGTTGGAGAATGG + Intergenic
970402571 4:15731867-15731889 GAGGCTGCAGGGCTGGAGGAGGG - Exonic
971523289 4:27582640-27582662 TGGTGTGAGGGGATGGAGGAGGG + Intergenic
971944397 4:33255276-33255298 GGGGCTGAAGGATTGGAGGAAGG + Intergenic
972004527 4:34083160-34083182 AGGAATGAAGGGAGGGAGGAAGG - Intergenic
972255006 4:37344458-37344480 AGCTATGAAGGCCTGGATGAGGG + Intronic
972704981 4:41533329-41533351 GGGTCTGAATGCCAGGAGGAAGG + Intronic
974859552 4:67502997-67503019 GGGGTTGAAGGGATGGAGGAAGG - Intronic
976069085 4:81221109-81221131 AGGGCTGAAGCCCTGGAGGCAGG - Intergenic
976303058 4:83533893-83533915 AAGTCTCAAGGAATGGAGGAGGG + Intergenic
977233599 4:94480670-94480692 AGGTCTGAAGGGTAGAAGGAGGG - Intronic
978276822 4:106961760-106961782 AGTTTTGAAGTGGTGGAGGAAGG - Intronic
978340540 4:107717911-107717933 GGGGCTGAAGGGCTGGGGTAAGG - Intronic
980750090 4:137077064-137077086 AGGTCCTAAAGGCTGGAGGCTGG - Intergenic
981538601 4:145825267-145825289 AAGCCTGCAGAGCTGGAGGAAGG + Intronic
981902652 4:149884909-149884931 GAGTCTGAAGGGAGGGAGGAGGG + Intergenic
983691058 4:170469620-170469642 AGGGCAGAAGGGAGGGAGGAAGG - Intergenic
983858947 4:172680394-172680416 AGGAATGAAGGGCCGAAGGAAGG + Intronic
985189610 4:187358053-187358075 AGCTCTAATGGGCTGGGGGAGGG - Intergenic
985496190 5:207773-207795 AGGTGTGGAGGGGTGGAGGTGGG + Intronic
985553153 5:543354-543376 AGCTCTGAGGGGCTGGATGCTGG + Intergenic
986391879 5:7294719-7294741 GGGTCTGGAGGGCTGGAGTAGGG - Intergenic
987403103 5:17498284-17498306 AGATCTGAAGGGCAGCAAGAAGG + Intergenic
987405284 5:17518420-17518442 AGGTCTGAAGGGCAGCAAGAAGG + Intergenic
987405729 5:17521854-17521876 AGGTCTGAAGGGCAGCAAGAAGG + Intergenic
987406176 5:17525288-17525310 AGGTCTGAAGGGCAGCAAGAAGG + Intergenic
987406623 5:17528722-17528744 AGGTCTGAAGGGCAGCAAGAAGG + Intergenic
987407523 5:17585683-17585705 AGGTCTGAAGGGCAGCAAGAAGG - Intergenic
987407774 5:17587448-17587470 AGGTCTGAAGGGCAGCAAGAAGG - Intergenic
987408221 5:17590885-17590907 AGGTCTGAAGGGCAGCAAGAAGG - Intergenic
987408669 5:17594319-17594341 AGGTCTGAAGGGCAGCAAGAAGG - Intergenic
987409125 5:17597753-17597775 AGGTCTGAAGGGCAGCAAGAAGG - Intergenic
987409240 5:17598484-17598506 AGGTCTGAAGGGCAGCAAGAAGG - Intergenic
987410592 5:17611043-17611065 AGGTCTGAAGGGCAGCAACAAGG + Intergenic
987412872 5:17632141-17632163 AGGTCTGAAGGGCAGCAAGAAGG + Intergenic
987413147 5:17634513-17634535 AGGTCTGAAGGGCTGCAACGAGG + Intergenic
987620279 5:20331313-20331335 AGGAATGAAGGGTAGGAGGAAGG - Intronic
988319990 5:29682790-29682812 AGGTCTGAGGGCCTGGCTGATGG - Intergenic
988520045 5:31937556-31937578 AGTCCTGGAGGGCTGGGGGATGG + Intronic
988908132 5:35810890-35810912 AGGTGTGGAGGACTTGAGGAGGG - Intronic
989474433 5:41857666-41857688 AGGTCTGAAGGAGTGAAGGCAGG - Intronic
989475581 5:41869910-41869932 GGGTCTGAACGGGGGGAGGAGGG - Intronic
989546890 5:42685084-42685106 AGGGCTGTGGGGCTGGGGGAGGG - Intronic
989581686 5:43039581-43039603 ACGGCTGGAGGGCAGGAGGATGG + Exonic
990100742 5:52183299-52183321 AGGGATGAGGGGCTAGAGGAGGG + Intergenic
990120697 5:52447351-52447373 AGTTTTAAAGGGGTGGAGGATGG + Intergenic
990182641 5:53179478-53179500 AGGTATGAAGGGTTGGTGGAGGG + Intergenic
991177144 5:63702302-63702324 AAGGGTGAAGGACTGGAGGAGGG + Intergenic
992078517 5:73213782-73213804 AGGTCTGCGAGGGTGGAGGATGG + Intergenic
992483370 5:77172873-77172895 AGGGGTGAATGGCTGGTGGAGGG - Intergenic
997225804 5:132208602-132208624 AGGTCTGAAGGGCTGGGACAGGG + Intronic
997638274 5:135431265-135431287 AGGTTACAAGGGCTGGGGGAAGG + Intergenic
997661120 5:135590334-135590356 AACCCTGAAGAGCTGGAGGAGGG + Intergenic
997747862 5:136315406-136315428 AGGTGGGAAGGGATGGTGGAGGG + Intronic
998080534 5:139271596-139271618 AGGAGTGCAGGGATGGAGGAGGG + Intronic
999249509 5:150173907-150173929 TGATCTGAATGGCTGGAGGATGG + Intronic
999270301 5:150292992-150293014 AGGTGTGAAGGAATGGAGGCAGG + Intergenic
999439597 5:151591144-151591166 AGGTAAGAATTGCTGGAGGATGG - Intergenic
1001598842 5:172915846-172915868 AGGTGTCAGGGTCTGGAGGAAGG - Intronic
1001877406 5:175213414-175213436 AGGACAGAAGGGAGGGAGGAAGG - Intergenic
1001877417 5:175213454-175213476 AGGACAGAAGGGAGGGAGGAAGG - Intergenic
1002451285 5:179320221-179320243 AGACCTGGAAGGCTGGAGGAGGG - Intronic
1003121048 6:3319236-3319258 AGGTCAGCAGGGCTGGAGCATGG - Intronic
1003226077 6:4207148-4207170 AGGTAGGAAGGGAGGGAGGAAGG - Intergenic
1003618232 6:7674207-7674229 AGGTCTGGAGGGTAGAAGGAAGG + Intergenic
1003727920 6:8786976-8786998 AGGAAAGAAGGGATGGAGGAAGG + Intergenic
1003879285 6:10465695-10465717 AGGTCTGAATGAGGGGAGGAGGG + Intergenic
1004239596 6:13907996-13908018 AGGTAGGAAGGGAGGGAGGAAGG - Intergenic
1005929065 6:30467372-30467394 AGCTCTGCAGGCCTGGAGTAGGG + Intergenic
1006218458 6:32466698-32466720 AGGTTAGAGGGGCTGAAGGATGG - Intergenic
1006388162 6:33743618-33743640 ATGACTCAAGGGCTGTAGGATGG + Intronic
1006503573 6:34473594-34473616 AGGGCTGGAGGGCTGGGGGTTGG + Intronic
1007629441 6:43264699-43264721 AGGTCTGGAGGGCAGCAGGGAGG + Intronic
1007789703 6:44301979-44302001 AAGTCTCAAGGGCTGGGGCATGG - Intronic
1007882859 6:45186702-45186724 AGGGGAGAAGAGCTGGAGGAAGG - Intronic
1008058095 6:46966311-46966333 GGGTGTGAAGGGCTGGGGGATGG - Intergenic
1008572980 6:52832744-52832766 GGCACTGAAGGGCTGGAGAAGGG + Intronic
1008606973 6:53150043-53150065 AGGCGTGAAGGACTGGAAGAGGG + Intergenic
1009828900 6:68904076-68904098 AGGGCTGGAGGGCGGGAGGAAGG + Intronic
1010462970 6:76134087-76134109 AGGTCTGGAGGGAGGGAGGGAGG + Intergenic
1011489304 6:87874261-87874283 AAGGCAGAAGGGCAGGAGGAGGG + Intergenic
1013497205 6:110709356-110709378 AGGGGTGGAGGGCTGGGGGAGGG + Intronic
1014141304 6:117946447-117946469 AGGTCCTAAGGGCTGGAGCTTGG + Intronic
1014856809 6:126412035-126412057 AGGGGTGGAGGGATGGAGGAAGG - Intergenic
1015589124 6:134805463-134805485 GCGTGTAAAGGGCTGGAGGAGGG - Intergenic
1015841395 6:137480800-137480822 AGGCCTGAAGGTTTGGAAGAGGG + Intergenic
1016523352 6:144971847-144971869 AGGAGTGGGGGGCTGGAGGAGGG - Intergenic
1016706790 6:147117980-147118002 AGGACAGAAGGGTTGGAGAAGGG - Intergenic
1019226266 6:170512567-170512589 AGGTCAGGGGAGCTGGAGGACGG + Intergenic
1019637849 7:2085978-2086000 ATGTATGAAGGCCTGGAGGATGG + Intronic
1019735572 7:2648381-2648403 AGGATGGAAGGGGTGGAGGAAGG - Intronic
1019901971 7:4028019-4028041 AGGTAAGAAGGGGAGGAGGAAGG + Intronic
1020169167 7:5831755-5831777 GGGAGTGAAGGTCTGGAGGAGGG - Intergenic
1021099783 7:16574648-16574670 GGGGCTGGAGGGCTGGGGGAGGG + Intronic
1021205299 7:17772838-17772860 AGGTCTGAACAGCTGGAAGAAGG + Intergenic
1021466554 7:20950584-20950606 AGTTCTGAGTGGCTGGAGCATGG + Intergenic
1021617900 7:22521271-22521293 AGTTCTGCATGGCTGGAGGGGGG - Intronic
1021867727 7:24975712-24975734 AGGTAAGAAGTGCTGAAGGAAGG + Intronic
1022489422 7:30805253-30805275 AGGACTGTGGGCCTGGAGGAAGG + Intronic
1022515869 7:30974686-30974708 AGGGCTGTGGGGCTGGGGGAAGG + Intronic
1022558792 7:31327691-31327713 TGGGGTGAGGGGCTGGAGGAGGG - Intergenic
1022643449 7:32209162-32209184 AGGTCTGAAGGGGTGGTCGGGGG + Intronic
1022881158 7:34588749-34588771 GGGTCTGAGAGGCTGGAGGGAGG - Intergenic
1024066113 7:45738053-45738075 AGGGGTGGAGGGCTGGGGGAAGG + Intergenic
1024194469 7:47045480-47045502 AATTCTGAAGGGCAGGGGGAAGG + Intergenic
1024880247 7:54077123-54077145 AAGTCTGAAGTGCTGGAGAGGGG + Intergenic
1025474793 7:60905777-60905799 AGAAATGGAGGGCTGGAGGAAGG + Intergenic
1025512210 7:61584097-61584119 AGAAATGGAGGGCTGGAGGAAGG - Intergenic
1026338781 7:69417708-69417730 CGATCTTCAGGGCTGGAGGAGGG + Intergenic
1026869618 7:73842328-73842350 GGGGCTGCAGGGCTGGGGGAAGG + Intronic
1027130452 7:75586691-75586713 GGGGCTGAAGGGATGGAGCAGGG + Intronic
1027199970 7:76057779-76057801 AGGTCTGCATGGGTGGAGCAGGG - Intronic
1027626976 7:80558117-80558139 AAGTGTGAAGGGTGGGAGGAGGG - Intronic
1028248616 7:88513099-88513121 ACCTCGGAAGGGCTGGATGAAGG - Intergenic
1028990130 7:97040328-97040350 GTGTCAGAAGGGTTGGAGGAAGG + Intergenic
1029058458 7:97771642-97771664 GGGACTGAAAGGCGGGAGGAAGG + Intergenic
1029428812 7:100515851-100515873 AGGTCTGGGGGCCTGGAGGCAGG - Intergenic
1030914001 7:115289800-115289822 AGAGATGAAGGGCTGGTGGAGGG - Intergenic
1031989261 7:128186383-128186405 AGGCCGGAAGGGAGGGAGGAAGG - Intergenic
1032023204 7:128421525-128421547 AGGTCTCAAGGCCTGGAAGTAGG - Intergenic
1032060853 7:128723844-128723866 AGGCAAGAAGAGCTGGAGGAAGG - Intronic
1033245797 7:139715339-139715361 CGTGCAGAAGGGCTGGAGGAAGG - Intronic
1034704439 7:153127822-153127844 AAGACTGGAGGGCAGGAGGAAGG + Intergenic
1034901164 7:154908860-154908882 GGGTCTCCAGGACTGGAGGAGGG - Intergenic
1035270186 7:157715199-157715221 AGGTGGGGAGGGCTGGAGGCGGG + Intronic
1035913047 8:3589601-3589623 GGGTATCAGGGGCTGGAGGAAGG + Intronic
1036258481 8:7222811-7222833 AGGACTGTGGGGCTGGAGCATGG + Intergenic
1036308139 8:7616697-7616719 AGGACTGTGGGGCTGGAGCATGG - Intergenic
1036310536 8:7681407-7681429 AGGACTGTGGGGCTGGAGCATGG + Intergenic
1036433471 8:8711041-8711063 AGCCCTGAAAGGCTGGTGGAAGG + Intergenic
1036695010 8:10968531-10968553 AGGCCTGGAGGACAGGAGGAGGG - Intronic
1037912756 8:22753805-22753827 AGGTGTGAGGGGCTGGAGCTGGG + Intronic
1037927493 8:22855507-22855529 AGGCCTGCAGGGCCAGAGGAAGG - Intronic
1038213025 8:25537442-25537464 GGGTCTGCAGGGCTGGGCGATGG + Intergenic
1038694113 8:29790474-29790496 AGTCCTTAGGGGCTGGAGGAGGG + Intergenic
1039969199 8:42307183-42307205 AGGTGAAAAGGGCTGGAGGTGGG + Intronic
1040575158 8:48645645-48645667 AGATCTGCGGGCCTGGAGGATGG + Intergenic
1041595307 8:59643576-59643598 AGCTCTGACTGGCTGCAGGATGG + Intergenic
1041681236 8:60594623-60594645 GGGGTTGAAGGGCTGGGGGAGGG - Intronic
1042059227 8:64798936-64798958 AGCCCTGAAGGCCTGGAGGTGGG + Intergenic
1042555809 8:70033092-70033114 AGGTCTAAAGGTGTGGAGTAAGG + Intergenic
1043058389 8:75469110-75469132 AGGTCTGAGGTGCAGGTGGAAGG + Intronic
1043165318 8:76896239-76896261 GGGTGTGAGGGGCTGGGGGAGGG - Intergenic
1043779568 8:84314020-84314042 AGTTCTGCATGGCTGGGGGAGGG + Intronic
1043930282 8:86082674-86082696 AAGGCTGAAAGGCAGGAGGATGG + Intronic
1044297562 8:90546305-90546327 AGGGCTGAAGCACTGGAGCAGGG - Intergenic
1046080955 8:109370042-109370064 AGAACATAAGGGCTGGAGGAAGG + Intronic
1047788490 8:128177676-128177698 AGGGCTGAGGGGCTGGAGCTTGG + Intergenic
1048314757 8:133353831-133353853 GGTTCTGAAGGGCTGTAGGGTGG - Intergenic
1048679458 8:136823713-136823735 ATGTCTGATGGTCTGTAGGAGGG + Intergenic
1049270616 8:141693712-141693734 GGGTTTGAAGGGCTGGGGGCAGG + Intergenic
1049361664 8:142214979-142215001 AGGTGGGAAGCGCTGGGGGAGGG - Intronic
1049455089 8:142682619-142682641 GGGCCTGGAGGCCTGGAGGAAGG + Exonic
1049471194 8:142775748-142775770 GGGCCTGATGGGCTGGAGGAGGG - Intronic
1049617327 8:143581325-143581347 AGCTCTGCAAGGCAGGAGGAGGG + Exonic
1049658720 8:143810254-143810276 GGGTCTGTGGGGCTGGAGTATGG - Intronic
1050741581 9:8826464-8826486 AGGCCAGCAGGGCTGGAGGGTGG - Intronic
1051336465 9:16070519-16070541 GGTTCTGAAAGGCTGGAGAAGGG + Intergenic
1051528903 9:18078002-18078024 GGGTGGGAAGGGATGGAGGAAGG + Intergenic
1051829317 9:21257630-21257652 AGGGCTGAAGGGTCCGAGGAAGG + Intergenic
1053123821 9:35563894-35563916 AGGGCTGTGGGGCTAGAGGAAGG + Exonic
1055196794 9:73604279-73604301 AAGTCTGAAGAGCTGGAGACAGG - Intergenic
1055479936 9:76699562-76699584 AGTTCTGCAGGGCTGCAGGCTGG - Intronic
1055497116 9:76866862-76866884 TGGTCAGAAGGGAGGGAGGAGGG + Intronic
1056032449 9:82567222-82567244 AGGGATGAAGGGAGGGAGGAGGG + Intergenic
1056604879 9:88077590-88077612 AGGTTTGAAGGGTGGGGGGAGGG - Intergenic
1056900243 9:90592401-90592423 TGGTCAGAAGGGATGAAGGAGGG - Intergenic
1057367129 9:94433092-94433114 CCGTCTCAAGGGCTGCAGGAAGG - Intronic
1057443576 9:95098636-95098658 GGGCCTGTGGGGCTGGAGGAGGG + Intergenic
1057656207 9:96954978-96955000 CCGTCTCAAGGGCTGCAGGAAGG + Intronic
1057854422 9:98591566-98591588 AGGCGTGAAGTGCTGGTGGATGG + Intronic
1058095041 9:100850330-100850352 AGGTGTGGAGGGTGGGAGGAGGG + Intergenic
1058552843 9:106134023-106134045 TGGTTTGAATGGCTGGAGAAAGG + Intergenic
1058785221 9:108380475-108380497 AGGTCTAATGGGCTGGAGGAAGG - Intergenic
1059453237 9:114383802-114383824 ACTTCTCAAGGGCTGGAGGAGGG + Intronic
1059655684 9:116355256-116355278 AGGAATTAAGGGCAGGAGGAAGG + Intronic
1059675823 9:116538185-116538207 AGGGAGGAAGGGATGGAGGAAGG + Intronic
1059751416 9:117250982-117251004 AGTTCAGAAGGGCTGAAGCAGGG + Intronic
1059763595 9:117362497-117362519 AGGTCAGCAGGGATGGAGGGAGG - Intronic
1059904305 9:118964728-118964750 AGGACAGAAAGCCTGGAGGAAGG - Intergenic
1060208642 9:121697607-121697629 AGGTATTAGGGGCTGCAGGAGGG - Intronic
1061200380 9:129134904-129134926 AGGACAGGAGGGTTGGAGGAGGG + Intronic
1061750947 9:132776623-132776645 AGGATGGAAGGGCTGGAGGATGG + Intronic
1062122809 9:134842635-134842657 AGGTCTCAGGGGTTGGGGGAGGG + Exonic
1062480239 9:136747716-136747738 AGGGCTGGAAGGCTGGAGGCTGG - Intronic
1062480291 9:136747897-136747919 AGGGCTGGAAGGCTGGAGGCTGG - Intronic
1062610947 9:137373195-137373217 TGGTCTGCAGGGCTGGGGCACGG + Intronic
1203781666 EBV:104432-104454 GCGTCTCAAGGTCTGGAGGACGG - Intergenic
1185608540 X:1380662-1380684 AGGGGGGAAGGGGTGGAGGAGGG + Intronic
1185873716 X:3685193-3685215 AGGAGGGAAGGGCTGAAGGAAGG - Intronic
1186772406 X:12830942-12830964 AGATGTGAAGAACTGGAGGAGGG + Intergenic
1186772706 X:12833172-12833194 GGGTGTGAGGGGCTAGAGGAGGG - Intergenic
1187257849 X:17657673-17657695 TGGGCTGCAAGGCTGGAGGATGG + Intronic
1187770398 X:22689533-22689555 AGATCTGAAGGGGTGGGGGAGGG - Intergenic
1188002938 X:24999060-24999082 AGGTAGTAAGGGCTGGAGAAAGG - Intergenic
1188030174 X:25255023-25255045 AGGTCTTAAAGGGTGGAAGAGGG + Intergenic
1188683736 X:33044026-33044048 AGGCCAGAGGGGCTGCAGGATGG + Intronic
1189116812 X:38351384-38351406 AGGTAGGAAGGGTAGGAGGAAGG - Intronic
1189162049 X:38819437-38819459 AGGGCTCAAGGGCTGGAGCATGG - Intergenic
1189908156 X:45783065-45783087 AGGCAGGAAGGGCTGAAGGAAGG + Intergenic
1189942295 X:46137309-46137331 AAGTCTGAAGGCCTGGAGACAGG + Intergenic
1190055947 X:47181196-47181218 AGGCCTGAAGGGCAGGTGGGAGG - Exonic
1190148856 X:47923913-47923935 TGGTCAGCAGGGCTGGAAGATGG - Intronic
1190739564 X:53280260-53280282 AGGGAGGAAGGGATGGAGGAAGG + Intronic
1190988617 X:55522778-55522800 AAGTCTGGAGGGCTGTAGGTAGG - Intergenic
1192218667 X:69181566-69181588 AAGTTTGAGGGGGTGGAGGATGG + Intergenic
1192946006 X:75966202-75966224 AGGTGGGAGGGACTGGAGGAGGG + Intergenic
1194501787 X:94690588-94690610 GGATCTGGAGGACTGGAGGATGG - Intergenic
1194869210 X:99107205-99107227 GGGGGTGCAGGGCTGGAGGAGGG + Intergenic
1195042352 X:101026023-101026045 AGGACAGAAGGGAGGGAGGAAGG + Intronic
1195455977 X:105070275-105070297 AAGCCTGAAGGGTTGGGGGAAGG - Intronic
1196096184 X:111803006-111803028 AGGGGTGGAGGGCTGGGGGAGGG - Intronic
1196787038 X:119429853-119429875 AGGTTTGAAGTCCTAGAGGAAGG + Intronic
1197095694 X:122592013-122592035 AGGTTTGTAGGGCTGCTGGAGGG - Intergenic
1198176969 X:134166105-134166127 AAGTTTGGAGGCCTGGAGGAAGG - Intergenic
1198390516 X:136169221-136169243 AGGTCGCACGGGCTTGAGGAGGG + Intronic
1199558992 X:149142682-149142704 TTGTCTGAAAGGCTGGAGGGTGG - Intergenic
1200039701 X:153356079-153356101 AGGGCTCAAGGGCTGGAGGGAGG + Intronic
1200314691 X:155119664-155119686 AGGTCTGAGAGGCTGGGGAAAGG + Intronic