ID: 932340346

View in Genome Browser
Species Human (GRCh38)
Location 2:70959427-70959449
Sequence CTCAGTAAACAGATGGGATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 175}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932340346_932340353 -9 Left 932340346 2:70959427-70959449 CCCTATCCCATCTGTTTACTGAG 0: 1
1: 0
2: 3
3: 14
4: 175
Right 932340353 2:70959441-70959463 TTTACTGAGGACACACTGGGAGG 0: 1
1: 0
2: 1
3: 14
4: 182
932340346_932340356 8 Left 932340346 2:70959427-70959449 CCCTATCCCATCTGTTTACTGAG 0: 1
1: 0
2: 3
3: 14
4: 175
Right 932340356 2:70959458-70959480 GGGAGGCCTGTGGGAGCCCGTGG 0: 1
1: 0
2: 7
3: 59
4: 553
932340346_932340355 -1 Left 932340346 2:70959427-70959449 CCCTATCCCATCTGTTTACTGAG 0: 1
1: 0
2: 3
3: 14
4: 175
Right 932340355 2:70959449-70959471 GGACACACTGGGAGGCCTGTGGG 0: 1
1: 0
2: 1
3: 30
4: 276
932340346_932340354 -2 Left 932340346 2:70959427-70959449 CCCTATCCCATCTGTTTACTGAG 0: 1
1: 0
2: 3
3: 14
4: 175
Right 932340354 2:70959448-70959470 AGGACACACTGGGAGGCCTGTGG 0: 1
1: 1
2: 4
3: 42
4: 402

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932340346 Original CRISPR CTCAGTAAACAGATGGGATA GGG (reversed) Intronic
903263795 1:22144496-22144518 CTCAGTAAACATTTGGTATTGGG + Intergenic
904751689 1:32744566-32744588 CTCACTTTACAGATGGGAAATGG + Intronic
904817759 1:33218764-33218786 CTGAGAAACCAGATGGGTTAAGG - Intergenic
905387747 1:37615923-37615945 CTCAGAAATGTGATGGGATAGGG + Intronic
906130489 1:43452695-43452717 GGCAGAAAACAGATGGGAAAAGG - Intronic
906938729 1:50237100-50237122 CTCAGTAAACTCATGTGAAATGG + Intergenic
907203173 1:52745511-52745533 CTCTGTAAGCATAGGGGATATGG + Intronic
907678395 1:56540151-56540173 CCCATTAAACAGATGAGAAAGGG - Intronic
912159482 1:106964196-106964218 CTCAGAAAGCACATGGGAAAAGG + Intergenic
916629713 1:166599037-166599059 CTCAGCAAAAAGAGGGGACATGG - Intergenic
916723185 1:167500854-167500876 CTCAGTGAGCAGATGGTACAGGG - Intronic
918125384 1:181579257-181579279 CCCAGTTAACAGAGGGGAGAAGG - Intronic
920959110 1:210648571-210648593 CTGAATAAGCAGATTGGATACGG - Intronic
921137386 1:212273713-212273735 ATCAGTATACAGATAGGAGATGG - Intergenic
922336467 1:224622602-224622624 CTCACCAAACAGTTGGGATTGGG - Intronic
923721287 1:236469134-236469156 CTCATTAATCAGAAGGGATAGGG + Intronic
924322278 1:242862164-242862186 TTAAATAAACAGATGGGTTATGG + Intergenic
924754448 1:246929084-246929106 CCCAGTAAAAAAGTGGGATAAGG + Intronic
1065508528 10:26454408-26454430 CTCAGGAATCTGATGGGACAAGG + Intronic
1066262834 10:33745765-33745787 CTCAGGAAACAGATGGAAGAGGG + Intergenic
1070504604 10:77102123-77102145 CTCAGTAAACACATGTGGAATGG + Intronic
1072566289 10:96619403-96619425 CTCAGAGATCAGATGGGATTGGG - Intronic
1074370096 10:112893749-112893771 TTCATTTAACAGATGAGATACGG + Intergenic
1076213056 10:128666460-128666482 CTCAGTAAATAGTTGTGAAATGG + Intergenic
1079574469 11:21986264-21986286 ATCTGTGAACAGATGTGATACGG - Intergenic
1081816340 11:45945554-45945576 CTCAGAAAACAGATGGGGTGGGG - Intronic
1084043870 11:66557967-66557989 CCCATTGTACAGATGGGATACGG - Intronic
1085819128 11:79773132-79773154 CTGAGTAATCAGAAGGGATTTGG - Intergenic
1088512442 11:110591939-110591961 GTCTGTAAACTGATGGGAAAGGG - Intronic
1092959439 12:13581946-13581968 GTAAGTAAACACATGGGTTATGG + Intronic
1093001269 12:13999182-13999204 CTCACTACACAGATGTCATATGG + Intergenic
1097894635 12:64812336-64812358 CACAGTAAACAATTGGTATATGG + Intronic
1099110094 12:78547881-78547903 CTCAGAACAGAGATGGGAGAAGG + Intergenic
1099970484 12:89495202-89495224 CTCAGTGAACAAATTGTATAAGG - Intronic
1100874154 12:98944632-98944654 GACAGTAGACAGTTGGGATAGGG - Intronic
1104927293 12:132320555-132320577 ATCAGTAAACAGAATGGAAATGG + Intronic
1106005267 13:25763842-25763864 CACAGTAGACAGAAGGGATGTGG + Intronic
1106727467 13:32500811-32500833 CTCAGTAGACAGAAGGGAAGAGG - Intronic
1109524979 13:63564342-63564364 CTCTGTAAAGAGAAGGGATCAGG + Intergenic
1115990872 14:39148190-39148212 CTCAGTGAAGATATGTGATATGG - Exonic
1117784974 14:59273877-59273899 CTCAGAAAACACATGTGACATGG + Intronic
1119649813 14:76375800-76375822 GCCAGTTAAAAGATGGGATAGGG + Intronic
1121721398 14:96111346-96111368 CTCAGTATACAGATGAGAACTGG + Intergenic
1123583139 15:21733947-21733969 CTAAGTAATCAAATGGCATATGG + Intergenic
1123619789 15:22176544-22176566 CTAAGTAATCAAATGGCATATGG + Intergenic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1124817346 15:33008291-33008313 CAAATTAAGCAGATGGGATAGGG + Intronic
1125188747 15:36964779-36964801 CTCAGGAAACACATGTGCTATGG + Intronic
1125884296 15:43217075-43217097 CTCATTTAACAGAAGTGATATGG + Intronic
1128925820 15:71654831-71654853 CTCAGTAAACACATGAGATAGGG - Intronic
1131315314 15:91330516-91330538 TTAAGTAAACAGATGGCAGATGG - Intergenic
1133319280 16:4903011-4903033 CTCAGGAAACTGATGGGGGAAGG - Intronic
1136694073 16:32060828-32060850 CTAAGTAATCAAATGGCATATGG - Intergenic
1136794569 16:33004092-33004114 CTAAGTAATCAAATGGCATATGG - Intergenic
1138214158 16:55188665-55188687 GTCATTAAAGAGATGGGATCAGG + Intergenic
1138787394 16:59863763-59863785 TTCAGTCAACAGATGGCAAAGGG - Intergenic
1140847971 16:78907925-78907947 CCCAGTGAACAGATGAGAAAGGG + Intronic
1142347211 16:89561485-89561507 CTCAGCAATCAGATGGAAAAGGG - Intronic
1203096831 16_KI270728v1_random:1265742-1265764 CTAAGTAATCAAATGGCATATGG - Intergenic
1146168287 17:30610230-30610252 ATAAGTAGACAGATGGCATACGG + Intergenic
1146221259 17:31023720-31023742 ATAAGTAGACAGATGGCATACGG + Intergenic
1147303348 17:39546995-39547017 ACCAGTAAACAGATGGTATTTGG + Intronic
1148463032 17:47848905-47848927 CTCAGGATACAGATGGGAGAGGG + Intronic
1149489611 17:57074113-57074135 CTCAGTTCACAGATGAGACAAGG + Intergenic
1152467456 17:80474272-80474294 CACAGTATATAGATGGGCTATGG - Intronic
1153182755 18:2454258-2454280 CTCGAGAAGCAGATGGGATAAGG + Intergenic
1157532980 18:48438007-48438029 CGCTGTAAACAAATGGGATTGGG + Intergenic
1158667401 18:59444875-59444897 CTGATTAAAAAGATGGGAAAAGG - Intronic
1159509818 18:69381707-69381729 CTCTGTTAACAGATTGGATGTGG - Intergenic
1161640818 19:5421675-5421697 CTCAGAAAACAAAGTGGATATGG - Intergenic
1162052958 19:8046230-8046252 CTCAGAAAACAGATGTGGAAAGG + Intronic
1167156853 19:47743785-47743807 CTCAGAAAACAGATAGGCTGTGG + Intergenic
924975491 2:170844-170866 TTCAGGAAATAGATGGGAAAAGG - Intergenic
928130315 2:28644398-28644420 CTCGGTGAAGAGTTGGGATAAGG + Intergenic
928625688 2:33137852-33137874 GTAAGAAAACAGATGGCATAAGG - Intronic
929781889 2:44962444-44962466 GTGAGAAGACAGATGGGATAGGG - Intergenic
930190270 2:48451789-48451811 CTCTTTAGACAGATGGGATTAGG + Intronic
930406575 2:50965025-50965047 CTCATTAAACAAATGAGATAAGG + Intronic
930717084 2:54603360-54603382 CTCTGTAAACACAAGTGATAGGG - Intronic
931319579 2:61163139-61163161 CTTAGAAAACAGAAGGGACATGG + Exonic
931632635 2:64315266-64315288 CTCAGGAGCCAGTTGGGATATGG + Intergenic
932340346 2:70959427-70959449 CTCAGTAAACAGATGGGATAGGG - Intronic
935612520 2:105039898-105039920 CTCAGTAAACATTTGCCATATGG - Intronic
938861802 2:135377113-135377135 TTAAGTAAACAGATGGCAGATGG + Intronic
943249813 2:185504712-185504734 GATAGTAAATAGATGGGATAGGG - Intergenic
943278158 2:185895764-185895786 CTCTGTAAACAGGTTGGAGAGGG - Intergenic
944938011 2:204589889-204589911 CCCAGTGAGCAGATGGGAGATGG + Intronic
945216331 2:207438026-207438048 CTCCGTATAAAGATGAGATAAGG + Intergenic
1172822455 20:37749509-37749531 CTCAGAAAACAGGAGGGAAATGG - Intronic
1174274346 20:49392813-49392835 CTCAGTAAACATATTGCATTTGG - Intronic
1174406040 20:50304065-50304087 CTGAGACAACAGATTGGATATGG + Intergenic
1178106095 21:29320912-29320934 CTGAGCAAACAGATGGGAGCAGG - Intronic
1178781278 21:35605030-35605052 CTGAGGAAACAGATGGGATAAGG - Intronic
1182218719 22:28741328-28741350 CTAAGTAAATGTATGGGATAGGG - Intronic
1182458316 22:30466904-30466926 CTCAGTAAGCAGCTGGGTCATGG + Intronic
951282590 3:20771100-20771122 CCCAGAAAACAAATGGAATATGG + Intergenic
955790693 3:62586094-62586116 CTCAGGAGACACATGGGATCTGG + Intronic
956078295 3:65529992-65530014 ATATGTAAACAGGTGGGATATGG - Intronic
957719976 3:83982213-83982235 CTAAGTAAAATGATGTGATAAGG + Intergenic
959580173 3:107975310-107975332 CTCAGGAAACAGTGGGGATAGGG + Intergenic
961975510 3:131020534-131020556 CACAATAACCACATGGGATAGGG - Intronic
963271044 3:143286144-143286166 TTCAGTCAGCAGATGGCATATGG - Intronic
963990326 3:151645961-151645983 CTCTGTGAACAGAGGGAATAGGG - Intergenic
964559871 3:157982387-157982409 CTTAGTAAACACATGGTATTAGG + Intergenic
965902804 3:173664338-173664360 CTCAGTAAAAAGATAAGAGATGG - Intronic
967140347 3:186552713-186552735 CTCAGTAAACAGGTGTTAAAAGG - Intronic
967604178 3:191424720-191424742 CTCATTAATCAGATGGGACCAGG + Intergenic
970325288 4:14917483-14917505 CTCAGCCAACACATGAGATAAGG + Intergenic
970825477 4:20268017-20268039 CACTGAAAACAGATGGGATTGGG + Intronic
971342539 4:25783804-25783826 CACAGGAAACAAATGGGAAACGG + Intronic
971614747 4:28774129-28774151 CTCAGTAGACAGATTTAATATGG - Intergenic
972309607 4:37867623-37867645 CTCAGGAAAAAGAGGGGATGTGG - Intergenic
976814418 4:89130709-89130731 TTCAGGAAAAAGAAGGGATAAGG + Intergenic
977664047 4:99624515-99624537 CCCAGTAAACAGTTGGGAAATGG - Intergenic
978566621 4:110089468-110089490 CTCAGTATACATAGGGGATTGGG - Intronic
978652709 4:111026649-111026671 CTGAGAAAGCAGATGGGATGAGG - Intergenic
981051758 4:140316153-140316175 CTCAGTCAACAGATGTGAATGGG + Intronic
981858502 4:149325572-149325594 CACATTAAAAACATGGGATAGGG - Intergenic
982479286 4:155889602-155889624 CTCACTTCACAGATGGGAAACGG - Intronic
983247270 4:165302552-165302574 CTCAATAAACAGATTGTATAAGG + Intronic
983376504 4:166935204-166935226 CCCAGGAAACAGTTGGGATAAGG - Intronic
985470547 5:41304-41326 TTCAGGAAATAGATGGGAAAAGG - Intergenic
985970365 5:3373422-3373444 CTCAGTTTACAGATGAGAGAGGG + Intergenic
988628569 5:32903436-32903458 CTCATTAAGGAGATGGGTTATGG - Intergenic
989260203 5:39411010-39411032 CAGAGTAAGCAGATGGGATAAGG + Intronic
990076918 5:51857519-51857541 CTCTTTAAACAGATTAGATAAGG - Intergenic
990667194 5:58086335-58086357 CTCAGTAATCTGAAGGGATTTGG + Intergenic
992508640 5:77412077-77412099 CTGAGCAAACAGATGGGATGGGG - Intronic
994634427 5:102326502-102326524 CTCAGAAGACAGAGGGGATAAGG - Intergenic
994988452 5:106967802-106967824 CTCAGAAAACAGATGGAATATGG + Intergenic
995261306 5:110107371-110107393 CTCAGGCATCAGATGTGATAAGG - Intergenic
996591062 5:125148242-125148264 CAAAGTAAACAGATGAGAAACGG - Intergenic
997653457 5:135538535-135538557 CTCAAAAAACAGATGGAACAAGG - Intergenic
998792990 5:145786200-145786222 CTCAGCATACAGGTTGGATAAGG + Intronic
1000257955 5:159558737-159558759 CTCAGCAATCGGATGGGAAATGG - Intergenic
1001046035 5:168372499-168372521 CTCAGTAAACAGAGGCTATTAGG - Intronic
1001547204 5:172577882-172577904 CTCACTTTACAGATGGGAAACGG + Intergenic
1001547834 5:172581450-172581472 CCCAGACAACAGATGGGACAAGG + Intergenic
1007164975 6:39822818-39822840 CTCAGGACACAGCTGGGACAGGG + Intronic
1008552476 6:52646411-52646433 CTCAGCAAAGATATGGGCTAGGG + Intergenic
1009198682 6:60718285-60718307 CTAAGGGAAGAGATGGGATAGGG - Intergenic
1011262878 6:85486942-85486964 CTCAGTAGCCAGATGGGAAAGGG + Intronic
1014282912 6:119461774-119461796 CTCAGTACACAGATTGGAAGGGG + Intergenic
1015083745 6:129262269-129262291 CTCCCTAAACAGATAGGACAGGG - Intronic
1016072136 6:139751603-139751625 CTAAGAAAAAACATGGGATAAGG - Intergenic
1016684119 6:146862281-146862303 GTCAGCAAACAAATGGGCTAAGG - Intergenic
1024365878 7:48519910-48519932 ATCAGTGAATAGTTGGGATAGGG + Intronic
1027372058 7:77516750-77516772 GTCAGTAAATAGATGGTAGATGG - Intergenic
1027651930 7:80878982-80879004 CACAGTAATCAAATCGGATAAGG + Intronic
1030085495 7:105811995-105812017 CCCAGAAAACAGAAGGGAAAGGG - Intronic
1030778258 7:113563963-113563985 CTCAGAAAAAGGATGGGAGAAGG - Intergenic
1031499625 7:122497535-122497557 CTGAGTTAACAGATGGGAATGGG - Intronic
1032440737 7:131941268-131941290 CTCACTAACAAGGTGGGATAAGG - Intergenic
1032499151 7:132386714-132386736 CTCGGAAAACAGGTGGGATGAGG + Intronic
1036289204 8:7472492-7472514 CTCAGTAAACAGAATGCAAAAGG + Intronic
1036332277 8:7839035-7839057 CTCAGTAAACAGAATGCAAAAGG - Intronic
1040789509 8:51209459-51209481 CTCAGTTAACAGATGGATTGTGG + Intergenic
1041559445 8:59198412-59198434 TTAAGTAAACAGATGGCAGATGG + Intergenic
1041888192 8:62837614-62837636 ATCAGCAGACAGATGGGAAATGG - Intronic
1042908432 8:73798867-73798889 CTCAGCATATAGATGGGCTAAGG - Intronic
1045324601 8:101109021-101109043 CTCAGAAAACAGACAGGACAGGG + Intergenic
1049992196 9:1000537-1000559 CTCAGTGAGTAGAAGGGATAGGG + Intergenic
1051062758 9:13064099-13064121 CTGAGTGAACAGATGGTGTAGGG + Intergenic
1051577235 9:18630624-18630646 CTCAGGAAACACATCAGATAAGG - Intronic
1052013170 9:23434944-23434966 CTTATTCAACAAATGGGATATGG - Intergenic
1052171625 9:25404855-25404877 CTCAGTATAGAGATGAGGTAAGG + Intergenic
1053418920 9:37964567-37964589 CTCATTATGCAGATGGGAAATGG + Intronic
1055139500 9:72859797-72859819 CTCAGAAAACATGTGTGATATGG - Intergenic
1055416238 9:76086474-76086496 CTCTGTGAACAGATGAGATGAGG + Intronic
1056780820 9:89549104-89549126 CTCAGAAAACATATGAGTTATGG + Intergenic
1057755600 9:97832398-97832420 CTCAGAAAAGAGAAGGCATATGG - Intergenic
1057808054 9:98234903-98234925 CACAGTAAAGATCTGGGATATGG + Intronic
1058666648 9:107324176-107324198 CTAAAAAAACAGTTGGGATATGG + Intronic
1058951872 9:109911538-109911560 CTAAGTATACAGCTGGGACATGG - Intronic
1059776886 9:117484991-117485013 CTCAGTAAAATGAAGGGATTGGG + Intergenic
1061565510 9:131436736-131436758 CCCAGGAAACAGTTGGGATGGGG - Intronic
1186472521 X:9832555-9832577 CCCAGTAGGCACATGGGATAGGG + Intronic
1186706283 X:12142454-12142476 CTCAGTAAAAATAGGGGATATGG - Intronic
1191996540 X:67101696-67101718 CTCAGTGAAGAGATAGGATGAGG - Intergenic
1194304686 X:92229126-92229148 CTCAGTAAACACTTTGGAAAAGG + Intronic
1194818883 X:98480828-98480850 CTGAGTAAGCAGATGGGAATTGG + Intergenic
1198232335 X:134702920-134702942 TTCTGTAAACAGATGATATATGG + Intronic
1198281944 X:135151082-135151104 CTCAGTATATATATGGGATTGGG - Intergenic
1198284248 X:135174068-135174090 CTCAGTATACATATGGAATTGGG - Intergenic
1198286635 X:135197564-135197586 CTCAGTATATATATGGGATTGGG - Intergenic
1198289015 X:135221440-135221462 CTCAGTATATATATGGGATTGGG + Intergenic
1198856867 X:141027144-141027166 TTCAATAAACAGATGTGAGATGG + Intergenic
1198905827 X:141560223-141560245 TTCAATAAACAGATGTGAGATGG - Intergenic
1199950665 X:152703425-152703447 ATCTGTAAGCAGATGTGATAAGG - Intergenic
1199952993 X:152720013-152720035 ATCTGTAAGCAGATGTGATAAGG - Intergenic
1199956690 X:152748433-152748455 ATCTGTAAGCAGATGTGATAAGG + Intergenic
1199959017 X:152765036-152765058 ATCTGTAAGCAGATGTGATAAGG + Intergenic
1201915963 Y:19181454-19181476 CTATGTAAACATATGGGTTAAGG - Intergenic