ID: 932340494

View in Genome Browser
Species Human (GRCh38)
Location 2:70960214-70960236
Sequence CAGCTGTCCCTGGGCAGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 470
Summary {0: 1, 1: 2, 2: 4, 3: 52, 4: 411}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932340484_932340494 26 Left 932340484 2:70960165-70960187 CCAAGCAGGCAGGGGCTGGCAGG 0: 1
1: 0
2: 7
3: 75
4: 670
Right 932340494 2:70960214-70960236 CAGCTGTCCCTGGGCAGCTCAGG 0: 1
1: 2
2: 4
3: 52
4: 411
932340491_932340494 -7 Left 932340491 2:70960198-70960220 CCAGCATCGAGACTGGCAGCTGT 0: 1
1: 0
2: 2
3: 7
4: 120
Right 932340494 2:70960214-70960236 CAGCTGTCCCTGGGCAGCTCAGG 0: 1
1: 2
2: 4
3: 52
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932340494 Original CRISPR CAGCTGTCCCTGGGCAGCTC AGG Intronic
900117758 1:1035759-1035781 CAGCTGTCACTGATCAGGTCAGG - Intronic
900154612 1:1198935-1198957 CTGCTGTCCCTGTGGAGCGCAGG - Intergenic
900264392 1:1750131-1750153 CAGCCTTCCCTGGGCTCCTCCGG + Intergenic
900386804 1:2414367-2414389 CTGCTGTTCCTGGGCAGGTGGGG + Intergenic
900860578 1:5226434-5226456 CAGGTGTCCCTGGGAAGCACTGG + Intergenic
901201179 1:7468304-7468326 CAGCTGTGCCTGGCAACCTCCGG - Intronic
901531890 1:9859026-9859048 AAGGTGTCCCTGGGCTGCTTTGG - Intronic
901768929 1:11520864-11520886 AGGCTGTCCCTGGCCCGCTCAGG + Intronic
902048504 1:13543506-13543528 GAGCTGGCCCTGGGCAGTTTAGG - Intergenic
902330227 1:15727660-15727682 CAGCTGTCCCTGGTCAGGGAGGG + Exonic
902605903 1:17569250-17569272 CAGCTGTTCTGGGGCACCTCTGG - Intronic
902778581 1:18690384-18690406 CAGCAGCCCCTGGGGAGCTGCGG - Intronic
903803593 1:25988440-25988462 CATCGGCCCCTGAGCAGCTCAGG + Intronic
904851478 1:33462932-33462954 CAGTTCTCTCTGGGCAGCCCTGG + Intergenic
905315023 1:37076964-37076986 CAGCTGCCCCTGGCCTCCTCTGG + Intergenic
905793776 1:40803925-40803947 CAGAGTTCCCTGGGGAGCTCAGG - Intronic
905886931 1:41496600-41496622 CAGCAGTCCCCGGGGAGCTCCGG + Intergenic
906289768 1:44612073-44612095 CAGCTGTCCCCGAGCATCTGAGG + Intronic
906344345 1:45005917-45005939 CAGCCAAACCTGGGCAGCTCAGG - Intronic
906383870 1:45350310-45350332 CAGCTGTTCCAGGACACCTCAGG - Intronic
908428389 1:64031402-64031424 AAGCTGACCCTGGGGGGCTCAGG - Intronic
908513472 1:64869311-64869333 CTGATGTCCTTGGGCAGTTCTGG + Exonic
913112183 1:115666596-115666618 CAGTTCTCCCTGGGGAGCTGGGG - Intronic
913326494 1:117632769-117632791 CTGCTGTTCCTGGTCAGATCAGG - Intergenic
914046664 1:144099376-144099398 ACCCTGTCCCTGGGCAGCCCAGG + Intergenic
914131446 1:144861310-144861332 ACCCTGTCCCTGGGCAGCCCAGG - Intergenic
914322979 1:146583186-146583208 CTGCTCCCCCTGGGCAGCCCTGG + Intergenic
914334244 1:146700542-146700564 CAGCTGTCCCTGGGTAGCTCAGG + Intergenic
915736829 1:158090470-158090492 GAAGTGTCCCTGGGCAGCCCTGG - Intronic
915808197 1:158876942-158876964 CAGCTGGTACTGGGCTGCTCTGG + Intergenic
915898056 1:159826705-159826727 AAGTTGTCCCTGGGCCTCTCTGG - Intergenic
915954097 1:160208652-160208674 CAGTTGTACCTGGGCTGGTCTGG - Intronic
916578145 1:166085303-166085325 CTGGGGACCCTGGGCAGCTCAGG + Intronic
921185409 1:212665624-212665646 CAGCTGTCCCCGGGCTGCCTGGG - Intergenic
923156987 1:231287943-231287965 CAGGTGTCCCTGGGTATCTGTGG - Intergenic
924113715 1:240725495-240725517 CAGCTGTCCTTGGTCATTTCTGG + Intergenic
924236138 1:242000933-242000955 TAGCAGTCCCTGGGTAGCTTTGG - Intergenic
924270121 1:242323631-242323653 CAGCAGTTCCTATGCAGCTCGGG - Intronic
924610398 1:245568644-245568666 CAGCTGGCCCTGGGCGTCACAGG + Intronic
924893985 1:248316452-248316474 CATCTGTCCCTTGGCAGAGCTGG + Intergenic
1063002308 10:1936026-1936048 CAGCTTATGCTGGGCAGCTCAGG - Intergenic
1063126322 10:3139527-3139549 CAGCCGCCCCTCTGCAGCTCAGG - Intronic
1065189385 10:23196235-23196257 CCTCTGGCCCTGGGCATCTCTGG + Intergenic
1066189397 10:33042141-33042163 AGGCTGCCCCAGGGCAGCTCAGG + Intergenic
1066369331 10:34806843-34806865 CAGGAGTCCCTGCACAGCTCAGG + Intronic
1067222212 10:44352514-44352536 CAGCTGAGCCTGGCCAGCTGTGG + Intergenic
1069641785 10:69961140-69961162 CAGCTGTGGCTGGGAAGCCCAGG + Intronic
1070590460 10:77796980-77797002 CACCTGTCACTGGGCAGGTCTGG - Intronic
1070705652 10:78636075-78636097 CAGCTATCCCTGTGTAGCTGAGG - Intergenic
1070761148 10:79025136-79025158 GAGCTGTCCTTGGGCATCACTGG - Intergenic
1072310640 10:94150957-94150979 GAGCTGTCCATGGTCAGCTGTGG + Intronic
1072755201 10:98016002-98016024 AAACTGAGCCTGGGCAGCTCTGG - Intronic
1073125327 10:101145754-101145776 CAGGTGTCCCTTGGCAGCTCAGG - Intergenic
1075015437 10:118907256-118907278 CCTCTTTCCCTGGGCAGCTGGGG + Intergenic
1075801775 10:125159194-125159216 CGGCTGTCCCTGCGCCGCACCGG + Intronic
1076138162 10:128058891-128058913 CATGTGGCCCTGGGGAGCTCTGG + Intronic
1076697916 10:132255994-132256016 CCGGCATCCCTGGGCAGCTCCGG + Intronic
1076869685 10:133187246-133187268 CAGCTGACCAGGGGCAGCACTGG - Intronic
1078551272 11:12281981-12282003 CAGCTCTCCCAGGGCAACTAAGG - Intronic
1080605985 11:33865105-33865127 CAGCACTACCTGGGCACCTCTGG + Intronic
1081383728 11:42446503-42446525 CTGCTGTCACTGTGCATCTCAGG - Intergenic
1081513279 11:43798679-43798701 CAGTTGTCCCTGGGTATCTATGG + Intronic
1081621207 11:44620085-44620107 CACCTGTCCCTAAGCAGCTCAGG - Exonic
1081658402 11:44873167-44873189 CAGTGGTCCCTTGGCAGCACAGG + Intronic
1081742083 11:45447990-45448012 CCCCTGTCCCTGGGCAGTCCTGG - Intergenic
1081818491 11:45967603-45967625 CAGCTGTCCAAGGATAGCTCAGG - Intronic
1083149879 11:60785342-60785364 GCGCTGTCTCTGGGGAGCTCCGG + Exonic
1083203502 11:61133722-61133744 GAGCTGTTCCTGAGCTGCTCTGG - Intronic
1083276678 11:61600828-61600850 CATCTCTCCCTGGGCACCTTGGG + Intergenic
1083290846 11:61689160-61689182 CAGCTGTCCCAGGGCAGTGGAGG - Intronic
1083518083 11:63279127-63279149 CAGCTGATTCTGGGCTGCTCAGG + Intronic
1084172507 11:67407265-67407287 CTACTGTCCCTGAGAAGCTCAGG - Intronic
1084435557 11:69137272-69137294 CAGCTCTCCCTGGACATGTCAGG - Intergenic
1084858500 11:72003674-72003696 TGGCTGTGCCTGAGCAGCTCTGG + Intronic
1086947161 11:92854346-92854368 GAGCTGTGGCTGGGCAGCTGTGG + Intronic
1087036126 11:93758342-93758364 CAGCTGCGCCTGGGCAGTTGGGG - Intronic
1088513681 11:110604289-110604311 CAGCTGGCCCTTGGCATCACTGG + Intronic
1088750047 11:112835706-112835728 CAGCTGCCTCTGAGCAGCACTGG + Intergenic
1089387366 11:118077176-118077198 CAGAAGTCCCTGGTCAGCACTGG - Exonic
1089606164 11:119642635-119642657 CAGCCATCCCTCGGCATCTCTGG + Intronic
1089708344 11:120297279-120297301 CAGGTGTCCCAGGGCAGGGCAGG - Intronic
1090644661 11:128758007-128758029 AAGCTGTCCTGGGGCAGCCCTGG + Intronic
1090780624 11:130003227-130003249 CAGCTGTGCCTGGGTGTCTCGGG + Intergenic
1091001912 11:131916907-131916929 CAGCTGTCCATGGGAAGATCAGG - Intronic
1091361440 11:134981248-134981270 CAGCTGTCCCCGTTCAGGTCAGG - Intergenic
1091976608 12:4830743-4830765 CCTCTGTCCCTGGGCTGCTTGGG + Intronic
1092708246 12:11308251-11308273 CTGTTGTCCCTGGGCAGGTCTGG + Exonic
1094213272 12:27915133-27915155 CATCTGTTCCTTGGCAGCTTTGG + Intergenic
1094845213 12:34358521-34358543 CAGGGGACCCTGGGCATCTCAGG - Intergenic
1094849021 12:34374053-34374075 CAGGTGACCCTGGGCATCCCTGG - Intergenic
1094855292 12:34400194-34400216 CAGGGGACCCTGGGCAGCACTGG + Intergenic
1096775410 12:53960836-53960858 CAGCGGTCCCTGCTCTGCTCTGG - Intergenic
1097236549 12:57544180-57544202 CAGCTGTCTCTTGGCAACTGTGG + Intronic
1098028864 12:66234236-66234258 CATCTGTCACTAGGCAGCACCGG - Intronic
1098803113 12:74986103-74986125 CAGCTGTGCCTGGGAAGGTGGGG + Intergenic
1099634008 12:85189275-85189297 CAGCCCTCTCTGGGCAGCTCTGG + Intronic
1102656115 12:114483739-114483761 GTGCTTTCCCTGGACAGCTCAGG - Intergenic
1103194437 12:119029962-119029984 CAGCTGTCCCAAGGCATTTCTGG + Intronic
1103524416 12:121558375-121558397 GTGCTGTCCCAGGGCTGCTCAGG - Intronic
1103613407 12:122137689-122137711 CACCCCTGCCTGGGCAGCTCTGG - Intronic
1103925633 12:124422234-124422256 CAGCTCTCCCTGGGGTTCTCGGG + Intronic
1104664722 12:130639652-130639674 CAGATGAGTCTGGGCAGCTCGGG + Intronic
1104707547 12:130958641-130958663 CGCCTGCCCCCGGGCAGCTCTGG + Intronic
1106248703 13:27968465-27968487 CAGCAGTCCCTCGGCAGCCAAGG - Exonic
1106480533 13:30133840-30133862 CAGGTGTCTCTGGACAGCTGAGG + Intergenic
1107389983 13:39953696-39953718 CAGTTTTCACTGGGCATCTCCGG - Intergenic
1109357339 13:61247660-61247682 CAGCTGGCCCTGGGCTGCCGAGG + Intergenic
1113618841 13:111699540-111699562 CAGCTCCCCATGGGCAGCTGGGG + Intergenic
1113624370 13:111784801-111784823 CAGCTCCCCATGGGCAGCTGGGG + Intergenic
1114771361 14:25431072-25431094 CAGGGCTCCCTGGGCTGCTCTGG - Intergenic
1114820250 14:26009717-26009739 CAGCTGTTACAGGGCAGCACTGG - Intergenic
1115245135 14:31287086-31287108 CTGCTGTCCATGGACAGCTCAGG + Intergenic
1115311722 14:31984996-31985018 CAGCTGGTACTGGGCTGCTCAGG + Intergenic
1115879555 14:37899636-37899658 CAGTAGTCCCTGGCCAGCTGTGG + Intronic
1117521339 14:56554192-56554214 CAGCTGTGCCAGGGCACCTGGGG - Intronic
1117539574 14:56733483-56733505 CAGGAGTCCCAGGGCAGCTCTGG + Intergenic
1117991198 14:61435551-61435573 CCACTGTGCCTGGCCAGCTCCGG - Intronic
1118158371 14:63263869-63263891 CAGTGCACCCTGGGCAGCTCAGG + Intronic
1118886154 14:69867796-69867818 AAGCTGTCCTTGGTCATCTCTGG + Intronic
1119166862 14:72501898-72501920 TCGCTGTGCATGGGCAGCTCAGG - Intronic
1119182388 14:72613844-72613866 CAGCTGTCCCCGGGGAGGCCTGG - Intergenic
1121485943 14:94314401-94314423 ATGCTGTCCCTGGGCACCTGTGG - Exonic
1122091141 14:99341355-99341377 CAGCTGTGCCTCTGCACCTCAGG + Intergenic
1122206735 14:100151403-100151425 CAGCTGAGCATGGGCAGCACAGG + Intronic
1122588355 14:102826807-102826829 CAGCTGTCCTTTGGCAGCCCTGG - Intronic
1122716881 14:103701247-103701269 TGGCTGTCCCGGGCCAGCTCCGG - Intronic
1122738196 14:103855693-103855715 CAGGTTTCCCCGGGCAGCTGTGG - Intergenic
1123122920 14:105926442-105926464 CATCTCTCCCTGGGAGGCTCAGG + Intronic
1123174150 14:106401406-106401428 CAGCTGCCCCCTGGCATCTCCGG + Intergenic
1123405563 15:20017861-20017883 CATCTCTCCCTGGGAGGCTCAGG + Intergenic
1123514894 15:21024509-21024531 CATCTCTCCCTGGGAGGCTCAGG + Intergenic
1123942368 15:25222761-25222783 CAGTGGTCCCAGGGCAGCCCTGG + Intergenic
1125155484 15:36580004-36580026 CAGCAGTGCCTGGGCCGCCCAGG + Intronic
1125676186 15:41503723-41503745 CAGGTGTCCATGGGGAGCACTGG - Exonic
1128089974 15:64912602-64912624 CAGCTGGCCTGGGGCAGCTTTGG + Intronic
1128108083 15:65058890-65058912 TGGCTGTCCCTGGGCACCACTGG + Intronic
1128354029 15:66911732-66911754 CAGCACTCCCTGCCCAGCTCTGG - Intergenic
1128457322 15:67838960-67838982 CCGCTGTCCCTGGGTGGCTCCGG + Intergenic
1128539056 15:68512266-68512288 TTGCTGTCCCTGGGCTGCTTTGG - Intergenic
1128978649 15:72170597-72170619 CCTCTCTCCCTGGGCAGGTCGGG + Intronic
1129363178 15:75037316-75037338 CAGCTCACCCTGGGGGGCTCTGG - Intronic
1129717500 15:77860689-77860711 CTGCTGCCCCTGGGCCACTCTGG + Intergenic
1130461252 15:84159508-84159530 CTGCTGCCCCTGGGCCACTCTGG - Intergenic
1130580602 15:85134280-85134302 CAGCTCTCTCTGGGCAGCCATGG - Intronic
1131267148 15:90923108-90923130 CAGCAGTCTCAGGGCAGCTGTGG - Intergenic
1131605563 15:93899950-93899972 TAGCTCTCCCTGGGCAGGTGTGG - Intergenic
1132543295 16:521447-521469 CAGCTCTCCCTACGCTGCTCGGG + Exonic
1133204349 16:4224068-4224090 CTGTGCTCCCTGGGCAGCTCTGG - Intronic
1133729752 16:8569340-8569362 CAGCTCTCTCTGGGGAGCTCTGG - Intergenic
1135141154 16:19923276-19923298 CAGCCCTCACTGGGCAGCCCTGG + Intergenic
1135279227 16:21139558-21139580 CACTTGTCCCTGGGAAGCTGAGG - Intronic
1136264978 16:29110822-29110844 CAGCTGTGCCTGGGAGGGTCGGG - Intergenic
1136382001 16:29900190-29900212 CCGCTGGCCCTAGGCAGCCCGGG - Intergenic
1137594920 16:49717121-49717143 CAGGTGTCCCTGGGGACTTCTGG + Intronic
1138414089 16:56861356-56861378 ACCCTGTCCCTGGGCAGCTGTGG - Intergenic
1138510991 16:57508328-57508350 CTGCTGCCCCTGGGCTGCTGTGG + Intergenic
1138575915 16:57907239-57907261 CATCCGTCACTGGGCAGCTCAGG - Intronic
1138595678 16:58027775-58027797 CAGCTCTCCCTGGCCAGGCCAGG - Intronic
1138673718 16:58635909-58635931 AGGCTGTCAATGGGCAGCTCTGG - Intergenic
1139846626 16:69925736-69925758 AAGATGTCCCTGAGCAGCTGGGG + Intronic
1139999374 16:71010690-71010712 CAGCTGTCCCTGGGTAGCTCAGG - Intronic
1140010581 16:71127664-71127686 CTGCTACCCCTGGGCAGCCCTGG - Intronic
1140912762 16:79468612-79468634 CAGCTCACCCTGGGCAGGCCAGG + Intergenic
1141535008 16:84673125-84673147 CAGCTGTGCCTGGCTTGCTCCGG + Intergenic
1141642833 16:85351274-85351296 CAGCAGCCCCTGGGCTGCTGTGG + Intergenic
1141705394 16:85661784-85661806 CGGCTCTCCCTGAGCAGCTCGGG - Intronic
1141746838 16:85931666-85931688 CAGCTGTGCCTGCTCAGCCCGGG + Intergenic
1142003694 16:87679116-87679138 CAGCTGAGCCTGGCCAGCTGGGG - Intronic
1142054000 16:87980507-87980529 CAGCTGTGCCTGGGAGGGTCGGG + Intronic
1142497385 17:313522-313544 CAGCTGGCCCTGGGAAGATCTGG - Intronic
1144735887 17:17555280-17555302 CTGCTGTCTCCAGGCAGCTCTGG - Intronic
1145231086 17:21173698-21173720 CAGCTGTCCCTGCAAAGGTCTGG - Intronic
1145250694 17:21295495-21295517 CGGCTGCACCTGGGCAGCCCTGG + Intronic
1145255969 17:21322584-21322606 CTGCTGGCCCTGGGCACCACAGG + Intergenic
1146844828 17:36175932-36175954 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1146857133 17:36263867-36263889 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1146863482 17:36324508-36324530 CTGCTGCCCTTGGGCAGCTGTGG + Intronic
1146873045 17:36387777-36387799 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1146880403 17:36438863-36438885 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1147066342 17:37925096-37925118 CTGCTGCCCTTGGGCAGCTGTGG + Intronic
1147075928 17:37988402-37988424 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1147077875 17:38004657-38004679 CTGCTGCCCTTGGGCAGCTGTGG + Intronic
1147087453 17:38067948-38067970 CTGCTGCCCTTGGGCAGCTGTGG - Intronic
1147093811 17:38128592-38128614 CTGCTGCCCTTGGGCAGCTGTGG + Intergenic
1147103397 17:38191911-38191933 CTGCTGCCCTTGGGCAGCTGTGG - Intergenic
1147276860 17:39325122-39325144 CACCTGACCCTGGGAAGCTGAGG + Intronic
1147608327 17:41786497-41786519 CAGCCGTCCCTGGGCAGGTGAGG - Intronic
1149010657 17:51853375-51853397 CTGCTGTCCCTGTGCTGGTCAGG + Intronic
1149557181 17:57581690-57581712 CAGTTGTCAGTGGGCAGCCCTGG - Intronic
1149847971 17:60018380-60018402 CTGCTGCCCTTGGGCAGCTGTGG - Intergenic
1151745858 17:76011434-76011456 CTGCAGCCCCTGGGCAGCTCTGG - Intronic
1152125624 17:78444952-78444974 GAGCTGTCCATGCCCAGCTCAGG + Intronic
1152359006 17:79821651-79821673 GAGCTGGCCTTGGGCAGGTCTGG + Intergenic
1152512647 17:80800980-80801002 CTGCTGTCCCTGGGCCACACGGG - Intronic
1152792880 17:82291758-82291780 GAGCTGTCCCTGGCAGGCTCCGG - Intergenic
1154326295 18:13393188-13393210 GAGCATTCTCTGGGCAGCTCTGG - Intronic
1154334744 18:13456385-13456407 AGGGTTTCCCTGGGCAGCTCTGG + Intronic
1154493866 18:14941675-14941697 CAGCTGTCCCCGTTCAGGTCAGG + Intergenic
1155429222 18:25738111-25738133 CAGCTGTCCCTGGGCAGATGAGG + Intergenic
1157289007 18:46396918-46396940 CAGCTGTGCCTGGGCAGCCTGGG + Intronic
1157478899 18:48040275-48040297 CCACTGTCCATGGGCTGCTCAGG + Exonic
1158567623 18:58568479-58568501 CAGCTGACCCTGGGTAACTGAGG - Intronic
1158979878 18:62749669-62749691 CAGCTGTGCCTGCACATCTCTGG + Intronic
1160070601 18:75624694-75624716 CAGCTGTGACTGGGGAGCTCGGG + Intergenic
1160721993 19:601865-601887 AAACTCTCCCTGGGAAGCTCTGG - Intronic
1160840888 19:1146665-1146687 CAGCTTCCTCTCGGCAGCTCTGG - Intronic
1160881544 19:1323152-1323174 CAGCTGTGACTGGCCTGCTCTGG + Intergenic
1161157524 19:2740269-2740291 CAGGCGCCCCTGGACAGCTCTGG - Intergenic
1161201801 19:3019335-3019357 CAGCTGAGCCTGGGCAGCCAGGG + Exonic
1161383966 19:3981229-3981251 CAGCTGTCCCTGCCCAGCTGAGG + Intronic
1161513151 19:4682913-4682935 CCGCTGTCCCGGGGCCGCCCTGG + Intronic
1161574453 19:5047976-5047998 CAGCACAGCCTGGGCAGCTCAGG - Intronic
1162502031 19:11059646-11059668 CAGCTGTCCAGGGGCAACACAGG + Intronic
1162524196 19:11197812-11197834 CTGCTGTCCCTGGGCCGCTGCGG + Intergenic
1162614208 19:11784157-11784179 CACCTGTCCCTGGGCATGTGTGG + Intergenic
1163027408 19:14520284-14520306 CAGCTGCCCCTGGGCAGACAGGG + Intronic
1163638661 19:18449662-18449684 CAGCTGGCCCAGGGCAGCCCAGG - Intronic
1164254115 19:23512258-23512280 GAGCCCTCTCTGGGCAGCTCTGG - Intergenic
1164637460 19:29801926-29801948 CAGGGGTCCCTAAGCAGCTCAGG - Intergenic
1165073281 19:33267787-33267809 CAGCTGGCCTGAGGCAGCTCGGG - Intergenic
1165081554 19:33309956-33309978 CAGCTGGCCCTGGGCTGCTAGGG + Intergenic
1165093923 19:33400492-33400514 CAGCTGTGCCTGGGCCGGTGTGG + Intronic
1165266038 19:34664431-34664453 CTGGTGTCCCTGGGCAGGGCTGG - Intronic
1166293468 19:41877841-41877863 CAGCTGTCCTTGAGCAGGTGAGG - Intronic
1166357584 19:42236261-42236283 CAGCTGTCTCTGTGCAGTCCTGG + Intronic
1167137157 19:47623670-47623692 CAGCTGAGCCTGGGGAGGTCAGG + Intronic
1167252193 19:48405251-48405273 CAGCAGGGCCTGGGCACCTCTGG - Exonic
1167292201 19:48630494-48630516 CTGCAGCCCGTGGGCAGCTCCGG - Exonic
1167562293 19:50233065-50233087 ACGCTGTCCCAGGGCTGCTCAGG + Intronic
1167711250 19:51112570-51112592 CAGCTGTCTCTCTCCAGCTCTGG + Intergenic
1168088800 19:54068115-54068137 CATCATTCCCTGGGCAGCTGTGG + Intergenic
1168358466 19:55717873-55717895 CATCTGTCCCTGTGGAGCTGGGG - Intronic
1202686218 1_KI270712v1_random:52790-52812 ACCCTGTCCCTGGGCAGCCCAGG + Intergenic
925427692 2:3763922-3763944 CAACAGTCACTGAGCAGCTCTGG - Intronic
925962403 2:9030015-9030037 CAGCTGTGCCGGGTCAACTCTGG + Intergenic
926325884 2:11784950-11784972 CCGCAGTCGGTGGGCAGCTCGGG + Exonic
926349169 2:11979952-11979974 AAGCAGACCATGGGCAGCTCTGG + Intergenic
926761942 2:16285785-16285807 CTGCAGTCCCTGGGCAGGTCAGG + Intergenic
927484085 2:23477151-23477173 CAGCAGTCCCGGGGCTGCTATGG - Intronic
927508331 2:23628869-23628891 CAGCTGACCCTGGGGAGGGCGGG + Intronic
928168268 2:28986615-28986637 CTGCTCACCCTGGACAGCTCAGG + Intronic
929030874 2:37649000-37649022 CAGCTGACCCCAGGCAGCCCTGG - Intronic
929766744 2:44850073-44850095 GAACTGTCCATGGGCAGCTTTGG + Intergenic
929866391 2:45720819-45720841 CCACTGTGCCTGGCCAGCTCAGG - Intronic
930728870 2:54709133-54709155 CAGCTGTCCCTGGGAAGGCGGGG - Intergenic
931691354 2:64837270-64837292 GAGCTGGCCCTGGGGAGCCCTGG - Intergenic
932340494 2:70960214-70960236 CAGCTGTCCCTGGGCAGCTCAGG + Intronic
932758354 2:74423963-74423985 CACCTGTCCCTGGGCAGGCTCGG - Exonic
934245505 2:90302030-90302052 ACCCTGTCCCTGGGCAGCCCAGG - Intergenic
934263241 2:91495009-91495031 ACCCTGTCCCTGGGCAGCCCAGG + Intergenic
934539008 2:95159446-95159468 CCGCTGTCCCTGCCTAGCTCCGG + Exonic
935939902 2:108227352-108227374 AAACTGTCCCTGAGCAACTCAGG - Intergenic
936040012 2:109142523-109142545 CCGTTGTCCCTGGGGAGCCCAGG - Intronic
937831672 2:126431112-126431134 CAGCTGGCCCTGGTCATCTTTGG - Intergenic
938102693 2:128507891-128507913 CAGGTGTCCCTGGGAGGCCCTGG - Intergenic
938128361 2:128690581-128690603 CACCTGTCCCTGTGCCGGTCGGG + Intergenic
938132012 2:128724798-128724820 AGGCTGTCCCTGGGCAGGCCCGG + Intergenic
941009132 2:160278552-160278574 CATCTGTCACTAGGCAGCACCGG - Exonic
941979003 2:171434449-171434471 CAGCTTTCCCTGGGCCCCGCCGG + Exonic
942210031 2:173660836-173660858 CAGCTGCCCCTGGCAAGCCCTGG + Intergenic
943301968 2:186213995-186214017 CAGCTGTCACTGAGCAGCATGGG + Intergenic
943576548 2:189637651-189637673 CAGCTGACCCTGGGCAGGTTGGG - Intergenic
943984941 2:194606341-194606363 AAGCTGTCCCTGCCCAGCCCTGG - Intergenic
944011848 2:194983203-194983225 CATCTGTCACTGGGCTGCTCTGG - Intergenic
946076495 2:217077826-217077848 CAGCTGTCCCTAGGGAGGTGGGG + Intergenic
946306256 2:218858711-218858733 CACCTGTCCCTTGGCACCCCGGG + Intergenic
1168858830 20:1030115-1030137 CAGCTTTTCCTGGTCTGCTCAGG + Intergenic
1170534133 20:17323696-17323718 CAGTTTTCCATGGGCAGCACAGG + Intronic
1171174431 20:23040839-23040861 CAGCCTTCCCTGGGCCGCTGTGG - Intergenic
1171225424 20:23438472-23438494 CAAGTGGCCCTCGGCAGCTCAGG + Intergenic
1171334444 20:24370833-24370855 CAGCTGGCCCAGGGCAGTCCGGG + Intergenic
1172705483 20:36879252-36879274 GCCCTGTCCCAGGGCAGCTCAGG + Intronic
1172770421 20:37379217-37379239 CACCTTTCCCTGGGAACCTCAGG + Intronic
1172773472 20:37394616-37394638 CAGGGGTCCCTGGGCTGCACTGG + Intronic
1173254941 20:41387562-41387584 CGGATGCCCCTGGGCAGCACGGG + Intergenic
1173662902 20:44746234-44746256 CAGCCGTCCCGGGGCGCCTCTGG + Intronic
1174069564 20:47890021-47890043 AAGCGGGCCCTGGGCAGCTGGGG + Intergenic
1174327400 20:49790337-49790359 CAGCTGTCCCAGGGCCTCTCAGG - Intergenic
1174597316 20:51694142-51694164 CACCCTTCCCTTGGCAGCTCTGG + Intronic
1174704766 20:52644185-52644207 CAGCTGGCCCTTTGCAGCTGTGG + Intergenic
1174920819 20:54700080-54700102 AACCTGTCTGTGGGCAGCTCAGG - Intergenic
1175601053 20:60273507-60273529 CTTCTCTGCCTGGGCAGCTCGGG + Intergenic
1175689170 20:61053246-61053268 CATCTGCCCCTGGGCTGGTCTGG + Intergenic
1175960045 20:62631363-62631385 CAGTTGTGCCTGGGGAGCTCTGG + Intergenic
1175988554 20:62776453-62776475 CACCTGTCCCTGGGCAGCCACGG + Intergenic
1176067894 20:63208779-63208801 CTGCTGTGCCTGGGCAGCTCTGG - Intronic
1176171348 20:63697733-63697755 CAGCCTCCCCTGGGGAGCTCTGG + Intronic
1177404228 21:20645400-20645422 CAGCTGCAGCTGGGCAGCTATGG - Intergenic
1178286504 21:31329727-31329749 CAGCAGTCACTGGGCAGCAGGGG - Intronic
1179586204 21:42375519-42375541 CAGCTAGTCCTGGGCAGCTCTGG - Intronic
1179710794 21:43211889-43211911 CAGCTGGCCTTGGGGAGCTGGGG + Intergenic
1179718705 21:43303348-43303370 CTCGTGTCCTTGGGCAGCTCCGG - Intergenic
1179818665 21:43923775-43923797 CTTCTGTCCCTGGGGAGCTGGGG + Intronic
1179894857 21:44355821-44355843 CAGCTGTCCCTCCGCATCCCTGG + Intronic
1179907978 21:44434032-44434054 CAGCTGTCCTGGGGCAGCCACGG + Intronic
1180035326 21:45245426-45245448 GCGCTGGCCCTTGGCAGCTCAGG + Intergenic
1180109267 21:45640467-45640489 CAGCGGTCCCTGTGCAGGGCAGG + Intergenic
1180961510 22:19764423-19764445 CGGCTGTCCCCAGGCGGCTCTGG + Intronic
1180963559 22:19773816-19773838 CAAATCTCCCTCGGCAGCTCAGG - Intronic
1181421407 22:22801579-22801601 CTCCTGTCACTGGGCATCTCAGG - Intronic
1181500695 22:23314080-23314102 CAGCTCTCCCATGGCAGCCCAGG + Intronic
1181582253 22:23834850-23834872 CTGCCGTCCCTGGGCCGCCCTGG + Exonic
1182832641 22:33316079-33316101 CAGCTGTCCATGGACAGGTATGG - Exonic
1183257837 22:36774353-36774375 CAGGCTTCCCTGGCCAGCTCAGG - Intronic
1183457474 22:37930498-37930520 CAGCTTTCCCTCGGCAGCTGCGG - Intronic
1183701698 22:39454719-39454741 CCCCTGACCCTGGCCAGCTCTGG + Intergenic
1183901732 22:41010788-41010810 CAGCTGACCCTGAGCTCCTCAGG - Intergenic
1184676767 22:46047426-46047448 CACCTGCTTCTGGGCAGCTCAGG + Intergenic
1184841459 22:47054740-47054762 GGGCTGTTCCTGGGCAGGTCGGG + Intronic
1185062183 22:48612774-48612796 CAGCGGGCCCTGGGCACATCAGG - Intronic
1185398950 22:50606142-50606164 CAGCTGTCCCTCATCACCTCTGG + Intronic
950123479 3:10497050-10497072 CTGCTGACCTTGGGCAGCTGTGG + Intronic
950604322 3:14064863-14064885 CAGCTGCCCCAGTGCAGCCCTGG + Exonic
952953734 3:38543929-38543951 CAGCTGTCACTGGGTCACTCTGG - Intergenic
952959628 3:38581156-38581178 CAGCTGGCCCTGGGCGGCAAGGG + Exonic
953367067 3:42354064-42354086 CAGCTCTGCCTGGACAGCCCTGG + Intergenic
954139852 3:48599227-48599249 CAGGTGTCCCTGTGCAGGCCAGG - Intronic
954619800 3:51989052-51989074 CAGCTGTCACTGGGCAGGGCAGG - Exonic
954875632 3:53801308-53801330 CCGCTTTCCATGGGCAGCTTTGG - Exonic
956463930 3:69500181-69500203 GAGCTGTCCCCGGGCTGCTCTGG + Intronic
956736466 3:72242375-72242397 CAGTTGTCCCTGGAGAGGTCTGG - Intergenic
960715286 3:120569168-120569190 CATCTGACCCTGGGCACCTTTGG - Intergenic
961790267 3:129371065-129371087 CTGGTGTCCCTGGGCAGCTTCGG + Intergenic
962105385 3:132383568-132383590 CAGCTGTGCCTGGGAAGGTGGGG + Intergenic
962363447 3:134760825-134760847 CTGCTGTCCTGGGGCACCTCCGG + Intronic
964751398 3:160057254-160057276 CAGGTGTCCCTGGGTATCTGTGG - Intergenic
965687863 3:171324533-171324555 CACCTGACCCTCGCCAGCTCAGG - Intronic
967198414 3:187049548-187049570 CAGGTGTCCCTCCTCAGCTCAGG + Intronic
968521583 4:1036827-1036849 CAGCTGTCCCCGCTCAGCCCTGG - Intergenic
968938100 4:3624182-3624204 GGGCTGTGCGTGGGCAGCTCTGG - Intergenic
968940408 4:3634662-3634684 CACCCCTCCCTGGTCAGCTCAGG - Intergenic
969057760 4:4412872-4412894 CAGCTGTCACTGGGTAGCTTGGG + Intronic
970479683 4:16460360-16460382 CAGCTGTCCCTGAGCTCCACAGG - Intergenic
970586533 4:17519748-17519770 CAGCTTTCCTAGGGCAGCACTGG + Intronic
973584453 4:52376703-52376725 CAGGAGTACCTGGGCAGCTGGGG + Intergenic
973954395 4:56049001-56049023 CAGCTGTCCCTGGGCGAAGCCGG + Intergenic
976688280 4:87840049-87840071 CAGCAGTCCATGGGCACCTGAGG - Intronic
979233846 4:118376770-118376792 CAGCTGTCCTCAAGCAGCTCTGG + Intergenic
982417845 4:155157707-155157729 CACATGGCCTTGGGCAGCTCTGG - Intergenic
983563938 4:169130096-169130118 CAGTTGTCACTGGGCTGCTTGGG + Exonic
983928566 4:173429156-173429178 CAGCTGTCCCTGGGGAAATCAGG - Intergenic
984551862 4:181170450-181170472 CCGCTGTGCCTGGCCAGCTGAGG - Intergenic
984857221 4:184205620-184205642 CTGCTTTCCCAGGGCTGCTCTGG + Intronic
984980811 4:185279220-185279242 CACCTCACCCTGGGCTGCTCCGG + Intronic
985481070 5:111282-111304 CAGCTTCCCTGGGGCAGCTCTGG + Intergenic
985546729 5:513680-513702 GAGCTGTCCCTGGGCCCCTGAGG - Intronic
985834332 5:2259758-2259780 CAGGTGCACCTGAGCAGCTCAGG - Intergenic
986148683 5:5106151-5106173 CAGCAGTCTCTGGGCAGCAAAGG + Intergenic
986637178 5:9834998-9835020 AACCTGTTGCTGGGCAGCTCAGG - Intergenic
986769420 5:10958276-10958298 CTGCTGTCCCTGGGCTGAGCTGG + Intergenic
986974711 5:13381692-13381714 CAGCTGGCGCAGGGCTGCTCTGG - Intergenic
988202902 5:28091656-28091678 AATCTGTCCCTGGGCTGCTTGGG + Intergenic
989999204 5:50873220-50873242 AAGGTGTCCCAGGGCATCTCAGG + Intergenic
991507228 5:67337941-67337963 CAGCTGTCACTGGGCCTCTGTGG + Intergenic
994200808 5:96973725-96973747 CAGCTGTCCCTAGGCATCTGTGG - Intronic
997146205 5:131436319-131436341 CACCTATTCCGGGGCAGCTCTGG + Intronic
997234178 5:132263323-132263345 CAGCTGTGGCAGGGCAGCTGAGG - Intronic
997603489 5:135156441-135156463 CACTAGTCCCTGGGCACCTCAGG - Intronic
997675351 5:135708604-135708626 CAGCTATCCCAGGGCAACCCTGG + Intergenic
998146453 5:139731785-139731807 CTGCTGTCCCTGGGTACCTGGGG - Intergenic
998564813 5:143207512-143207534 CTGTTGTCCCTGGCCAGCTTTGG - Intronic
1001090251 5:168734850-168734872 CAGCTCTCCCTGAGGAGTTCAGG - Intronic
1001665611 5:173431360-173431382 CAGCTGTCCCTGGCAAGCTGGGG + Intergenic
1002199727 5:177520968-177520990 GAGCTGCCCCTGGGGAGCTGAGG + Intronic
1002312653 5:178324053-178324075 CAGAGGTCCCTGGGCGGCCCTGG + Intronic
1002594182 5:180311623-180311645 CAGCTGTCCAGTGGCAGCTCTGG + Intronic
1002969442 6:1998825-1998847 CAGCTGTCCCTTGGCATCCATGG - Intronic
1003270308 6:4602349-4602371 CAGCTGTGCCTGGGCCCCGCAGG - Intergenic
1003301860 6:4891351-4891373 CAGCTGTGCCTGGTCATCCCAGG - Intronic
1003641830 6:7882046-7882068 CAGATGTCAGTGGGCTGCTCTGG - Exonic
1004424954 6:15501021-15501043 CAGCCGGTCCTGGGCAGTTCTGG - Exonic
1004814961 6:19302867-19302889 AGACTGTCCCTGGGCTGCTCAGG + Intergenic
1005664165 6:28033930-28033952 GAACTGTTTCTGGGCAGCTCTGG - Intergenic
1006003998 6:30988182-30988204 CAGCGGGCCCTGAGCAGCCCCGG + Exonic
1006300527 6:33191604-33191626 CAGCTGGCTCTGGGGAGCACTGG - Intronic
1006510146 6:34517028-34517050 TGGCTGTCCATGGGCATCTCAGG + Intronic
1006515324 6:34542222-34542244 CAGCTTTCCCTGGGAAGCAGGGG - Intronic
1006576867 6:35053000-35053022 CATCTCTCCTTGGGCAGCTGGGG - Intronic
1006802148 6:36766110-36766132 CCCCTGTCCCTGGGCATCCCTGG - Intronic
1007699743 6:43759632-43759654 CTGCTGCCCCTGGGGAGGTCTGG + Intergenic
1008000852 6:46358330-46358352 AAGCTGTCCCAGGGAAGCCCTGG - Intronic
1009451864 6:63810529-63810551 CAGCTGGGGCTGGCCAGCTCAGG + Intronic
1010713290 6:79200418-79200440 CAGGAGTCCCTGAGCAGCACAGG + Intergenic
1013373954 6:109496232-109496254 CAGCAGTAGATGGGCAGCTCTGG + Intronic
1013571394 6:111429929-111429951 GAACTCTCCGTGGGCAGCTCGGG + Intronic
1014605021 6:123462914-123462936 CTGCTAACCCTGAGCAGCTCGGG - Intronic
1014688736 6:124534856-124534878 CAGTTGTCCCTTGGCATCTGTGG + Intronic
1017193787 6:151679773-151679795 CAGCTGTGCCTGGGACACTCCGG + Intronic
1017407896 6:154139595-154139617 AAGGTGTCCCTGGGCTGCACAGG - Intronic
1017829767 6:158115721-158115743 CACCTGTACCTCAGCAGCTCTGG + Intronic
1017926522 6:158915597-158915619 CAGCTCTCCAGGGGCAACTCAGG - Intergenic
1018216159 6:161530160-161530182 CAGGTGTTCCTGGACAGCACAGG + Intronic
1019564773 7:1673873-1673895 GAGCTGTCCTGGGGCAGCTGGGG + Intergenic
1021595907 7:22316687-22316709 CAGGTCTCCCTGTGCTGCTCAGG + Intronic
1022570527 7:31448843-31448865 CAGCTGTGCCTGAACAGCTCAGG + Intergenic
1022693144 7:32677688-32677710 ATCCAGTCCCTGGGCAGCTCTGG - Intergenic
1022920819 7:35012248-35012270 ATCCAGTCCCTGGGCAGCTCTGG - Intronic
1023545693 7:41315940-41315962 CAGATGCCCCTGGCCAGCTGAGG + Intergenic
1023612603 7:41986428-41986450 CAGCTTTCCTTGGGGAGGTCTGG - Intronic
1024220719 7:47284429-47284451 CAGCTCTCCCTTGGCAGCATGGG - Intronic
1024240018 7:47427589-47427611 CTTCTGGCCCTGGGCAGCTGTGG - Intronic
1024407443 7:48998696-48998718 CATCTGTCCCTGTGCAGCTAGGG - Intergenic
1024786339 7:52911602-52911624 CAGCTGTGCCTGGGGGGCACAGG + Intergenic
1025210913 7:57019263-57019285 CAGCTGTCCTTGGGGGGCTGGGG - Intergenic
1025232515 7:57211954-57211976 TAGCGGGCCCTGGGCAGCTGGGG + Intergenic
1025661042 7:63557584-63557606 CAGCTGTCCTTGGGGGGCTGGGG + Intergenic
1026104959 7:67413572-67413594 CAGCTGGCCCTGCCCAGCTCAGG - Intergenic
1026618580 7:71929893-71929915 CAGCTGTCCCTCGGTATCTGTGG + Intronic
1029415913 7:100443161-100443183 CAGCTGTCCCTGGGCTCTTTGGG - Intergenic
1029544295 7:101202182-101202204 CAGCTGTTCCTGGGCCGCCGGGG - Intergenic
1029917082 7:104221525-104221547 CAGCTGTCCCTTGGTATCTGTGG - Intergenic
1029979332 7:104863510-104863532 AAGCTGTCCTGAGGCAGCTCAGG - Intronic
1032057249 7:128693599-128693621 CAGCAGTGTTTGGGCAGCTCTGG - Intergenic
1033629160 7:143140175-143140197 CAGCTCTGCCTGAGGAGCTCAGG + Intergenic
1034279059 7:149838851-149838873 CAGCGGACGCTCGGCAGCTCGGG - Intronic
1035166423 7:156993119-156993141 CAGCTGCCCCTAGGGAGCTGCGG - Intergenic
1035458166 7:159023065-159023087 CGGTGGTCCCTGGGCAGCTAGGG + Intergenic
1035786580 8:2266098-2266120 GAGCTGTCCCTCAGCAGCGCAGG + Intergenic
1035806227 8:2455618-2455640 GAGCTGTCCCTCAGCAGCGCAGG - Intergenic
1037893318 8:22635714-22635736 CAGCACTCCCTGCGCAGCTCTGG - Intronic
1037998377 8:23369555-23369577 CATCCCTCCATGGGCAGCTCTGG - Intronic
1039562052 8:38520412-38520434 CTGATGTCCCTGAGGAGCTCAGG - Intronic
1039735321 8:40325378-40325400 AAGATGTCCCTGGGCATCACAGG + Intergenic
1039900733 8:41750777-41750799 CAACAGTGCCTGGGCTGCTCTGG + Intronic
1040302010 8:46192948-46192970 CAGCCCTCCCAGGACAGCTCAGG - Intergenic
1040336091 8:46416744-46416766 CAGCTTCCCCTGGACAGCCCTGG - Intergenic
1040545165 8:48393325-48393347 CTGCTGCCCCTGGGAATCTCTGG + Intergenic
1040589593 8:48778245-48778267 CTGCAGTGCCTGGGCAGCTCTGG + Intergenic
1041409304 8:57535953-57535975 CAGCGGTCCCAGGGAGGCTCAGG + Intergenic
1044430654 8:92103059-92103081 CAGCTCTCTCTGCGCAGCGCCGG - Intronic
1045553284 8:103191854-103191876 CAGCTTTCCCTGGGTAGCTTGGG - Intronic
1046315290 8:112493000-112493022 CAGCTGTCCCTTGGTATCCCTGG - Intronic
1047000680 8:120569590-120569612 CAGCAGTCCATGGACAGCTGAGG - Intronic
1047305044 8:123645808-123645830 CAGCTGTCCCTGGGATGTCCAGG + Exonic
1047939627 8:129816488-129816510 CAGCTGGTGCTGGGCTGCTCAGG + Intergenic
1048208064 8:132431431-132431453 CAGGCATCCCTGGCCAGCTCTGG + Intronic
1048274507 8:133056066-133056088 CAGGTCTCCCTGGGCAGGGCAGG + Intronic
1048971718 8:139648769-139648791 CAGCTGGCACTGGGTAGCACCGG + Intronic
1049338691 8:142100408-142100430 ACACTGTCCCTGGGCTGCTCTGG - Intergenic
1049431957 8:142569396-142569418 CACCAGCCCGTGGGCAGCTCTGG + Intergenic
1049449991 8:142655419-142655441 CTGCTTTCCCTGGGCAGTCCTGG - Intergenic
1049512739 8:143037947-143037969 CAGCTGAGCCTGGCCAGCCCCGG + Intergenic
1051506041 9:17828851-17828873 CAGTTTTCCCTGGACAACTCTGG + Intergenic
1053607779 9:39678764-39678786 CAGCTGACCCTGGGATGCTCAGG - Intergenic
1053865628 9:42435124-42435146 CAGCTGACCCTGGGATGCTCAGG - Intergenic
1054245756 9:62663645-62663667 CAGCTGACCCTGGGATGCTCAGG + Intergenic
1054356754 9:64070207-64070229 CAGATGGCCGCGGGCAGCTCGGG - Intergenic
1054453070 9:65413524-65413546 GGGCTGTGCTTGGGCAGCTCTGG + Intergenic
1054559881 9:66698176-66698198 CAGCTGACCCTGGGATGCTCAGG + Intergenic
1054804663 9:69386014-69386036 CAGGTGGCTCTGGCCAGCTCAGG + Intronic
1056768416 9:89459619-89459641 CAGCTGTCCCTGCTCAGCCCTGG + Intronic
1057444181 9:95102609-95102631 AAGCTGACCTTGGGCTGCTCTGG - Intronic
1058508383 9:105689622-105689644 CAGCTGTCCCAGGCCAGGACAGG + Intergenic
1059277432 9:113108318-113108340 CAGGTGTGCGTGGGCAGCCCAGG - Intergenic
1059278819 9:113116233-113116255 CAGGTGTGCGTGGGCAGCCCAGG + Intergenic
1061672606 9:132197573-132197595 CAGCTGTCCCGGGGAGGCCCAGG + Intronic
1062200454 9:135300125-135300147 GAGCTGTCCTTGAGCAGCACAGG - Intergenic
1062295454 9:135822921-135822943 CAGCTGTCCTTGGGGAGACCGGG + Exonic
1062501463 9:136853745-136853767 CAGGGGTCCCAGGGCAGCTGCGG - Intronic
1062527221 9:136982836-136982858 CAGCCGCCCCAGGGCACCTCAGG + Intronic
1062538550 9:137031536-137031558 CAGGTGTCGCTGGGCAGCTCTGG + Exonic
1186485586 X:9932287-9932309 CGGCCCTCCCGGGGCAGCTCTGG - Exonic
1186499830 X:10042253-10042275 CAGGTGGCCCTGGGCAGCCTTGG + Intronic
1186720328 X:12296916-12296938 CAGCTGCCCCTTGGCAGGACAGG + Intronic
1192495286 X:71612477-71612499 CGGGTGACCCTGGGCAGCTCCGG - Exonic
1195850333 X:109275846-109275868 CAGGGCTCCCTGTGCAGCTCTGG + Intergenic
1197016032 X:121627090-121627112 CAGCAGTAGCTGGGCAGCACTGG + Intergenic
1198052097 X:132959671-132959693 AATCTGTCCCTGGGCAGCACTGG + Intronic
1202378004 Y:24255636-24255658 CTGCTGCCCCTGGGCCACTCTGG + Intergenic
1202492778 Y:25414485-25414507 CTGCTGCCCCTGGGCCACTCTGG - Intergenic