ID: 932340864

View in Genome Browser
Species Human (GRCh38)
Location 2:70961834-70961856
Sequence AGGGAAACTGAGGCCTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2144
Summary {0: 1, 1: 5, 2: 90, 3: 354, 4: 1694}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932340852_932340864 30 Left 932340852 2:70961781-70961803 CCAGAACTACAGCCATACGCCAG 0: 1
1: 0
2: 0
3: 18
4: 306
Right 932340864 2:70961834-70961856 AGGGAAACTGAGGCCTGGGAAGG 0: 1
1: 5
2: 90
3: 354
4: 1694
932340860_932340864 -8 Left 932340860 2:70961819-70961841 CCTCATTGTGTAGATAGGGAAAC 0: 1
1: 4
2: 44
3: 358
4: 1972
Right 932340864 2:70961834-70961856 AGGGAAACTGAGGCCTGGGAAGG 0: 1
1: 5
2: 90
3: 354
4: 1694
932340859_932340864 -7 Left 932340859 2:70961818-70961840 CCCTCATTGTGTAGATAGGGAAA 0: 1
1: 0
2: 10
3: 112
4: 607
Right 932340864 2:70961834-70961856 AGGGAAACTGAGGCCTGGGAAGG 0: 1
1: 5
2: 90
3: 354
4: 1694
932340856_932340864 11 Left 932340856 2:70961800-70961822 CCAGAGCTGGGAGAACAACCCTC 0: 1
1: 0
2: 0
3: 10
4: 167
Right 932340864 2:70961834-70961856 AGGGAAACTGAGGCCTGGGAAGG 0: 1
1: 5
2: 90
3: 354
4: 1694
932340855_932340864 18 Left 932340855 2:70961793-70961815 CCATACGCCAGAGCTGGGAGAAC 0: 1
1: 0
2: 0
3: 10
4: 128
Right 932340864 2:70961834-70961856 AGGGAAACTGAGGCCTGGGAAGG 0: 1
1: 5
2: 90
3: 354
4: 1694

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932340864 Original CRISPR AGGGAAACTGAGGCCTGGGA AGG Intronic
Too many off-targets to display for this crispr