ID: 932341541

View in Genome Browser
Species Human (GRCh38)
Location 2:70965322-70965344
Sequence CGGTGCTGCGGAAGAACTGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 92}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932341525_932341541 30 Left 932341525 2:70965269-70965291 CCTTTCCCTCGCTCGATTCCTTT 0: 1
1: 0
2: 1
3: 23
4: 417
Right 932341541 2:70965322-70965344 CGGTGCTGCGGAAGAACTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 92
932341528_932341541 12 Left 932341528 2:70965287-70965309 CCTTTTCCCGCGCTCCATGCCTC 0: 1
1: 0
2: 0
3: 12
4: 244
Right 932341541 2:70965322-70965344 CGGTGCTGCGGAAGAACTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 92
932341534_932341541 -10 Left 932341534 2:70965309-70965331 CCCCCTCGACTCCCGGTGCTGCG 0: 1
1: 0
2: 1
3: 4
4: 66
Right 932341541 2:70965322-70965344 CGGTGCTGCGGAAGAACTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 92
932341527_932341541 24 Left 932341527 2:70965275-70965297 CCTCGCTCGATTCCTTTTCCCGC 0: 1
1: 0
2: 0
3: 2
4: 61
Right 932341541 2:70965322-70965344 CGGTGCTGCGGAAGAACTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 92
932341529_932341541 6 Left 932341529 2:70965293-70965315 CCCGCGCTCCATGCCTCCCCCTC 0: 1
1: 0
2: 3
3: 59
4: 641
Right 932341541 2:70965322-70965344 CGGTGCTGCGGAAGAACTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 92
932341531_932341541 -2 Left 932341531 2:70965301-70965323 CCATGCCTCCCCCTCGACTCCCG 0: 1
1: 0
2: 1
3: 25
4: 414
Right 932341541 2:70965322-70965344 CGGTGCTGCGGAAGAACTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 92
932341526_932341541 25 Left 932341526 2:70965274-70965296 CCCTCGCTCGATTCCTTTTCCCG 0: 1
1: 0
2: 0
3: 3
4: 64
Right 932341541 2:70965322-70965344 CGGTGCTGCGGAAGAACTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 92
932341533_932341541 -7 Left 932341533 2:70965306-70965328 CCTCCCCCTCGACTCCCGGTGCT 0: 1
1: 0
2: 1
3: 13
4: 138
Right 932341541 2:70965322-70965344 CGGTGCTGCGGAAGAACTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 92
932341530_932341541 5 Left 932341530 2:70965294-70965316 CCGCGCTCCATGCCTCCCCCTCG 0: 1
1: 0
2: 1
3: 27
4: 444
Right 932341541 2:70965322-70965344 CGGTGCTGCGGAAGAACTGAAGG 0: 1
1: 0
2: 0
3: 6
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932341541 Original CRISPR CGGTGCTGCGGAAGAACTGA AGG Exonic
902500071 1:16904907-16904929 GGGTGGGGCGGAAGAACAGAAGG + Intronic
902944658 1:19826121-19826143 GAGTGATGGGGAAGAACTGAGGG - Intergenic
905871356 1:41406383-41406405 CGGTGCTGAGGAAGAATCAAGGG + Intergenic
907549124 1:55289221-55289243 TGGTGCTGAGGAACAAATGACGG - Intergenic
910900590 1:92115825-92115847 TGGTGCTGCCCAAGAACGGAAGG + Intronic
914004542 1:143720914-143720936 GGGTGGGGCGGAAGAACAGAAGG - Intergenic
915099756 1:153490856-153490878 CAGGGCTGGTGAAGAACTGAAGG + Intergenic
916164849 1:161957315-161957337 TGGGGCTGGGGAAGAACTGCCGG - Intronic
920115088 1:203615096-203615118 CAGTGCTGCAGAAGCCCTGAAGG + Intergenic
922648798 1:227318728-227318750 CGGAGCTGCGGGAGGGCTGAGGG + Intergenic
1066360289 10:34723773-34723795 CGATGCAGCGGAGGAACTGCAGG + Intronic
1069874493 10:71553329-71553351 CGGGGCTGCAGAGGAGCTGAGGG - Intronic
1076758276 10:132586524-132586546 TGGTGCTGCGGAACATCTGGAGG + Intronic
1081678480 11:44985220-44985242 CGTTCCTTGGGAAGAACTGAGGG + Intergenic
1081725093 11:45322440-45322462 TGGTGCTCCAGAAGCACTGAGGG - Intergenic
1081838313 11:46176113-46176135 CGGGGCTGTGGATGAACTGGTGG - Intergenic
1083996712 11:66276600-66276622 CTGTCCTGCCCAAGAACTGAGGG + Exonic
1087105010 11:94399988-94400010 CTGTGTTGAGGAAGAAATGAGGG - Intronic
1087401540 11:97672909-97672931 GGGTGCTGGGGAAGTACTGGAGG - Intergenic
1089769880 11:120795221-120795243 CGAGGCTCTGGAAGAACTGAGGG + Intronic
1097056376 12:56252311-56252333 GGGTCCTGGGGAAGAAGTGAAGG + Exonic
1100140894 12:91617530-91617552 CAGTTTTGTGGAAGAACTGAGGG - Intergenic
1105002649 12:132701299-132701321 CGGCGCTGAGGATGAACTGGCGG + Exonic
1105523383 13:21152132-21152154 AGGTGCTGAGAAAGAACTAAGGG + Intergenic
1108717841 13:53099487-53099509 CAGTGCTTCAGAAGAACTAATGG - Intergenic
1118605172 14:67497415-67497437 CCGGGATGAGGAAGAACTGACGG + Intronic
1123110886 14:105866407-105866429 CTCTGCTGGGGATGAACTGACGG + Intergenic
1124872905 15:33561295-33561317 CTGTGCTGGGGAAGAACAGCAGG + Intronic
1128432287 15:67608538-67608560 GGGGGCTGAGGAAGAACTGATGG + Intronic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1138394937 16:56696688-56696710 AAGACCTGCGGAAGAACTGAAGG + Intronic
1139840294 16:69873248-69873270 TGGTGCTGCCACAGAACTGAAGG - Intronic
1142895297 17:2973032-2973054 AGGTGGTGAGGGAGAACTGAAGG + Intronic
1143940921 17:10540602-10540624 CGATGATCAGGAAGAACTGATGG - Exonic
1144679624 17:17184323-17184345 AGGTGCTGCGGAGGCACTGTAGG + Intronic
1147178628 17:38671907-38671929 TGGAGCTGCCGAACAACTGAGGG - Exonic
1148108163 17:45130468-45130490 GGGTGCCGCGGAAGGGCTGAGGG - Intronic
1152215950 17:79032544-79032566 CAGGGCTGGGGAAGAAGTGATGG + Intronic
1160273567 18:77409652-77409674 TGGTGCTGGTGAAGCACTGAGGG + Intergenic
1160980944 19:1816330-1816352 CGGTGCTGTGGATGACCTGTGGG + Exonic
1161836978 19:6654452-6654474 AGGTCCTGAGGAAGAGCTGATGG + Intergenic
1165168083 19:33871186-33871208 CGGTGCTGGGGCAGAGCTCATGG + Intergenic
1166736943 19:45091572-45091594 CGGCGCTGCGAATGGACTGATGG - Intronic
1167337687 19:48896694-48896716 AGGAGCTGCTGAAGAACTGAGGG - Intronic
929820839 2:45272212-45272234 CGGTGGGGTGGCAGAACTGATGG - Intergenic
932341541 2:70965322-70965344 CGGTGCTGCGGAAGAACTGAAGG + Exonic
936484091 2:112911734-112911756 TGGTGCTGCTGAAGGACAGAAGG - Intergenic
938308543 2:130270001-130270023 GGGTGCTGCAGAACAAGTGAAGG - Intergenic
938446787 2:131386835-131386857 GGGTGCTGCAGAACAAGTGAAGG + Intergenic
947463697 2:230323735-230323757 TGGTGCTGCACAAGGACTGAGGG + Intergenic
947472543 2:230412298-230412320 TGGTGCTGCACAAGGACTGAGGG + Intergenic
1169392575 20:5202496-5202518 CTGTGCTGTGGAGGAACTGCAGG + Intergenic
1171216568 20:23356728-23356750 CTGTGTTGTGGAAGAACAGAAGG + Intergenic
1171294042 20:24001778-24001800 TGGGGCTGCGGGAGAACTTAAGG + Intergenic
1171936400 20:31278655-31278677 TGGTGCTGGGAAAGAACTGGAGG + Intergenic
1175267356 20:57710490-57710512 CCGAGCTGCTGGAGAACTGAAGG - Intronic
1175336636 20:58200390-58200412 CAGAGTTGGGGAAGAACTGATGG + Intergenic
1176190884 20:63809075-63809097 CGGTGCTGCAGAGGCACTCAAGG + Intronic
1178545356 21:33488892-33488914 CCGTGCTGCTGAACAAGTGATGG - Exonic
1179840189 21:44067490-44067512 TGTTGCTGAAGAAGAACTGATGG + Intronic
1184021681 22:41825691-41825713 CAGTGCTGGGAATGAACTGAAGG - Exonic
1184369532 22:44073901-44073923 CAGTGCTGCGGATTAAATGAGGG - Intronic
1185266472 22:49906787-49906809 GGGTGCTGCGGAAGAACCCAGGG - Intronic
950699239 3:14728700-14728722 CGATGCTGCGGAAGACGTGAAGG - Intronic
964653457 3:159039343-159039365 CTGTTCTGTGGAAGAACTGAGGG + Intronic
967867456 3:194202061-194202083 AGGTCCTGGAGAAGAACTGAGGG + Intergenic
972308609 4:37856513-37856535 CCTTGCTGCCAAAGAACTGATGG + Intronic
975494086 4:75018924-75018946 CAGAGTTGGGGAAGAACTGATGG + Intronic
976765159 4:88591876-88591898 CGGGGCTGCGGAAGAAAGGCGGG - Intronic
986140422 5:5025080-5025102 CGGTGATGGGGAGGAAGTGATGG + Intergenic
990618087 5:57528507-57528529 AGGTGCTGTGGAAAAACTAATGG - Intergenic
993915150 5:93735467-93735489 AGAGGCTGCAGAAGAACTGAAGG + Intronic
996742292 5:126811820-126811842 CAGTGCCAGGGAAGAACTGATGG + Exonic
997443144 5:133922845-133922867 CTGTGATGGGGATGAACTGAAGG - Intergenic
999125457 5:149242738-149242760 AGGTGGTGGGAAAGAACTGAGGG - Intronic
1003124374 6:3344148-3344170 CAGTGCAACTGAAGAACTGAAGG - Intronic
1006457827 6:34142194-34142216 CGGGGCTGCAGAAGAGCTGCTGG - Intronic
1006511558 6:34524289-34524311 CTGTGCTGGGGGAGAGCTGAGGG - Intronic
1010900817 6:81424947-81424969 TGGTGATGCAGGAGAACTGATGG - Intergenic
1020371786 7:7440139-7440161 CAGTGCTGAGGAAGAAGCGAAGG - Intronic
1023964592 7:44956447-44956469 CGGAGCTCCTGAAGAACAGATGG - Intergenic
1033998029 7:147376339-147376361 GGGTGCTACTGAAGCACTGAGGG + Intronic
1037950743 8:23017522-23017544 GGGTGATGCGGAAGAGCAGAGGG - Exonic
1039798154 8:40932897-40932919 AGGTGCTGCGGAAGGGCTGTGGG - Intergenic
1040718841 8:50292400-50292422 CGGTCCTGAGGAACAACTGAAGG + Intronic
1041201117 8:55452564-55452586 CGGTGCAGCGGGAGAACCGGAGG - Intronic
1046811657 8:118539606-118539628 GGGTCCTGGGGAAGAACTGCTGG + Intronic
1046912140 8:119639958-119639980 ATGTGCTGCGGAAGAAAAGATGG - Intronic
1049238041 8:141522480-141522502 TGGTGCTGGGGAAAAGCTGATGG - Intergenic
1049808991 8:144554891-144554913 TGGTGCTGGGGAGGAACTGGAGG - Intronic
1052890611 9:33696049-33696071 CAGTGCTGTGGATGAACTGCTGG - Intergenic
1055078098 9:72237804-72237826 TTGTGCTGGGGAAGAAGTGAGGG - Intronic
1055624487 9:78161005-78161027 GTGTGCTGTGGAAGAAGTGAGGG - Intergenic
1055710729 9:79058802-79058824 CCAAGCTGCAGAAGAACTGAGGG + Intergenic
1056391554 9:86145969-86145991 GGGAGCTGCTGAAGAACAGAAGG + Intergenic
1056519086 9:87383531-87383553 CAGTCCTCCGGAAGAACAGATGG - Intergenic
1060390091 9:123269468-123269490 CGGCGCTGGGGAAGAATTAAAGG + Intergenic
1193899532 X:87160850-87160872 CTTTGCTGCGTAAGACCTGAGGG + Intergenic
1198963439 X:142205158-142205180 GGGCCCTGAGGAAGAACTGAGGG - Exonic