ID: 932344413

View in Genome Browser
Species Human (GRCh38)
Location 2:70986197-70986219
Sequence CTCTGTGACCAAAAGAAAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 348}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932344409_932344413 28 Left 932344409 2:70986146-70986168 CCTTGGAGGAAGTCAAGTCTAAG 0: 1
1: 0
2: 1
3: 12
4: 164
Right 932344413 2:70986197-70986219 CTCTGTGACCAAAAGAAAGGAGG 0: 1
1: 0
2: 2
3: 42
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932344413 Original CRISPR CTCTGTGACCAAAAGAAAGG AGG Exonic
900634962 1:3658439-3658461 CTCTGTGACAGAAAGGAAAGGGG + Intronic
901846364 1:11985197-11985219 TTCTGTGACCAAATGTGAGGGGG - Intronic
902398449 1:16144798-16144820 AACAGTGACCAAAAGAACGGGGG - Intronic
902656445 1:17872451-17872473 CTCTGTCACCAAAGGACAAGGGG - Intergenic
903203853 1:21765608-21765630 CTCTGTCAAAAAAAAAAAGGGGG + Intronic
903717385 1:25377896-25377918 CTCTGTTTCAAAAAGAAAGAAGG + Intronic
903929353 1:26853516-26853538 TTCTGTGGCCAAAAGCCAGGTGG + Intronic
904255631 1:29252810-29252832 CTCTGTGACCAAATGTGTGGGGG + Intronic
904580874 1:31543416-31543438 CTATGTGTTCAAATGAAAGGAGG - Intergenic
906580593 1:46932584-46932606 CTCTGTGTACAAAAGGAAGGTGG - Intronic
906603131 1:47146308-47146330 CTCTGTGTACAAAAGGAAGGTGG + Intronic
907509514 1:54947757-54947779 CTCTGTGGCAAAATGAAAGCAGG - Intergenic
908283647 1:62569718-62569740 CTCTGTCTCAAAAAAAAAGGGGG - Intronic
908467288 1:64409173-64409195 CTCTGTTATCAAAAGAAAGGTGG + Intergenic
909433968 1:75619062-75619084 CTCTGTCTCAAAAAAAAAGGGGG + Intergenic
911001272 1:93168830-93168852 CTCTGTCTCAAAAAGAAAAGGGG + Intronic
912983607 1:114403377-114403399 TTCTGTCTCCAAAAAAAAGGAGG - Intronic
913584570 1:120261377-120261399 CTTTGTGACCTAAAGATAGTGGG + Intergenic
913623613 1:120636982-120637004 CTTTGTGACCTAAAGATAGTGGG - Intergenic
914566566 1:148873233-148873255 CTTTGTGACCTAAAGATAGTGGG + Intronic
914606253 1:149257007-149257029 CTTTGTGACCTAAAGATAGTGGG - Intergenic
914920630 1:151844944-151844966 CTCTGAGACTGAAAGGAAGGAGG - Intergenic
916027736 1:160849152-160849174 TTCTGTGACCAAATGCAGGGAGG - Intronic
916257176 1:162800984-162801006 CTCTGTCTCAAAAAAAAAGGGGG - Intronic
916421861 1:164645238-164645260 CTATCTCACCAAAAGAAGGGGGG - Intronic
917041031 1:170806696-170806718 CTCTGCTACCAAAGGAAAGGGGG - Intergenic
918326496 1:183416346-183416368 CTTTGGAACCAAGAGAAAGGAGG - Intronic
918623784 1:186635123-186635145 CTTTGTGACCAATAGAAAGTAGG + Intergenic
918984502 1:191606836-191606858 CTAGGTGACCAAAAATAAGGAGG - Intergenic
919323828 1:196080278-196080300 GTCTGTGATCAAGAGAAAGTTGG + Intergenic
921027744 1:211303264-211303286 CTTTCTCACCAAAAGTAAGGAGG - Intronic
922493281 1:226035966-226035988 CTCTGTGAGCAGCAGAAAGAAGG - Intergenic
922499850 1:226088637-226088659 ATCTGTGAGCAAAATAAATGTGG + Intergenic
923224546 1:231927138-231927160 CTCTGTGACTCAAAGAAAAAGGG - Intronic
924512942 1:244742636-244742658 CTCTGTCTCAAAAAAAAAGGGGG + Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1065159553 10:22905325-22905347 CTCTGTGAAAAAAATAAAGAGGG - Intergenic
1067708391 10:48628009-48628031 CTCTGAGACTCAAAGAAAGGAGG + Intronic
1068078965 10:52294393-52294415 CTCTGTGACCAACAGATGTGTGG - Exonic
1068211048 10:53921422-53921444 TTCTGAGGCCAAAATAAAGGAGG - Intronic
1068489220 10:57700941-57700963 TGCTGTTACCAGAAGAAAGGCGG + Intergenic
1068671628 10:59729234-59729256 CTCTGATACCAGAAGCAAGGTGG + Intronic
1068792993 10:61047802-61047824 CTCTGTGACCAATAGTAAGTTGG - Intergenic
1069539344 10:69281908-69281930 CTCTGTGGCCAAAATAGAGCAGG - Intronic
1069618662 10:69822631-69822653 CTCTATGAACAAATGAATGGTGG - Intronic
1069710347 10:70483798-70483820 CTCTGTGACCAGCAGGAAAGGGG - Intronic
1070634710 10:78115942-78115964 CCTTGTGGCCAAAAGAAAGAGGG - Intergenic
1070787478 10:79170386-79170408 CTCTGTGGCTAAAAGGAATGGGG - Intronic
1071297456 10:84232589-84232611 CTCTGTGCCCAGCACAAAGGAGG - Exonic
1071773081 10:88751888-88751910 CACTGTGACCTGAAGAATGGAGG + Intronic
1072119276 10:92392133-92392155 CTCTGTCTCCAAAAAAAAGGGGG - Intergenic
1073074187 10:100813264-100813286 CTCTGTGACTAAAACAAGGGCGG - Intronic
1073364539 10:102927744-102927766 CTCTGTCTCAAAAAAAAAGGAGG + Intronic
1076252972 10:128997618-128997640 CTCTGAGTCCCTAAGAAAGGGGG - Intergenic
1077875302 11:6299904-6299926 CTCTGTGGCTAAAACAAAGACGG - Intergenic
1078135725 11:8650065-8650087 CTTTGTAACCAAAAGAACAGTGG + Intronic
1079566195 11:21886190-21886212 CTCTGTGGCCAATAAAAAGAAGG + Intergenic
1080576246 11:33602134-33602156 CTCAGTGACATAAAGGAAGGGGG - Intronic
1080703076 11:34661734-34661756 ATGTGTCCCCAAAAGAAAGGAGG - Intergenic
1082120013 11:48370061-48370083 ATCTGTGACCAAAAGGTTGGGGG + Intergenic
1084379335 11:68801100-68801122 CTCTGTCTCCAAAAAAAAGGGGG + Intronic
1085895043 11:80628977-80628999 CTCTGTGACCATAAGAGAGATGG - Intergenic
1086938870 11:92774536-92774558 TTCTGTGACTAAAAAAAATGAGG - Intronic
1087023771 11:93629399-93629421 CTCTATGACCAAATGTATGGGGG - Intergenic
1087870794 11:103290466-103290488 ACCTGCAACCAAAAGAAAGGTGG - Intronic
1088591988 11:111411414-111411436 CTCAGTGACCCGAAGAAAGGAGG - Intronic
1089401227 11:118165902-118165924 CTCTGTAGCCAAAAGCCAGGTGG + Exonic
1090715780 11:129429584-129429606 TTCTGTAAGCAAAATAAAGGGGG + Intronic
1091645212 12:2267886-2267908 CTCCGAGACCAAAAGAACAGTGG - Intronic
1093033783 12:14314035-14314057 CTCAGTACCCAAGAGAAAGGTGG + Intergenic
1093198778 12:16161788-16161810 CTCAGTGAGGAAAAAAAAGGGGG + Intergenic
1094697833 12:32839203-32839225 ATCTGTTACCATAAGAAAAGGGG - Intronic
1096365896 12:51027898-51027920 CTCGGGGACCAAAAAAAAGTGGG + Intronic
1096447058 12:51702925-51702947 CTCTATGGCCAAAGGAAAAGAGG - Intronic
1096911645 12:54990194-54990216 CTCTCTTCCCAAAAGAAAAGAGG + Intergenic
1098715867 12:73828041-73828063 CTCAGTGATCAAAGGCAAGGTGG + Intergenic
1099265600 12:80442903-80442925 CACTGTTTCTAAAAGAAAGGAGG - Intronic
1099458642 12:82895797-82895819 CTCTGAAACCAAAAGAGAGAAGG - Exonic
1101549516 12:105748996-105749018 CTCTGAGACGAAAGGAAAGCGGG - Intergenic
1101900738 12:108789490-108789512 CTCACTGACCAAAAGGCAGGAGG - Intronic
1102569874 12:113820909-113820931 CCCTGTGGCCAAAAGAAAGCTGG - Intronic
1102883610 12:116505423-116505445 CTCTGTGAACAAATGAACTGGGG - Intergenic
1104391181 12:128391716-128391738 CTGTGTGACCTAAAGCAAGGAGG - Intronic
1105264582 13:18804717-18804739 CTGTATGATCAAAAGAAAAGAGG + Intergenic
1106194237 13:27479812-27479834 CTCTTTGACCCAATGATAGGTGG - Intergenic
1106869311 13:34001658-34001680 CTCTGTGACTGAGAGATAGGTGG + Intergenic
1108172983 13:47762506-47762528 ACCTGTGATCAAAAGAAAGAAGG + Intergenic
1108531787 13:51333839-51333861 CTCAGTGATAAAAAGAAATGAGG + Intergenic
1109250722 13:60016988-60017010 ATCTGTCACCAAAAGAATGAAGG + Intronic
1110454774 13:75679092-75679114 CTGTGTCATGAAAAGAAAGGGGG - Intronic
1110653545 13:77971167-77971189 CTCTGATACCAGAAGCAAGGTGG + Intergenic
1112472429 13:99701146-99701168 CTCTGTGACCAAAAGTACATAGG + Intronic
1112503528 13:99959643-99959665 CCCTGTGCCCATTAGAAAGGCGG - Intergenic
1115664668 14:35534214-35534236 CTCTGGGACAAGAGGAAAGGGGG - Exonic
1117002989 14:51390601-51390623 ATCAATGACCAAAAGAAAGGGGG - Intergenic
1117354024 14:54906272-54906294 CTCTGTGACCAAATGGGTGGGGG - Intergenic
1118834566 14:69467759-69467781 CTCTGTCTCAAAAAAAAAGGTGG + Intergenic
1120059571 14:79966605-79966627 CACTTTGAACAAAAGAATGGGGG - Intergenic
1120096017 14:80388593-80388615 ATCTGTGAATAAAAGAAAAGTGG + Intergenic
1120182143 14:81354512-81354534 CGATGGGCCCAAAAGAAAGGGGG + Intronic
1120867540 14:89308815-89308837 CACTGTGAACAAATGGAAGGAGG + Intronic
1121032486 14:90670932-90670954 CTCTAAAACCAAAGGAAAGGGGG + Intronic
1121147359 14:91596208-91596230 CTCTGTCTCAAAAAAAAAGGGGG - Intronic
1122313643 14:100813005-100813027 CTCTTTGAGCAAATGAAAAGGGG + Intergenic
1122993239 14:105248761-105248783 CTCTGCAAGCAAAAGCAAGGAGG - Exonic
1124353619 15:28978598-28978620 CTCTATGATTTAAAGAAAGGTGG - Intronic
1125363136 15:38885917-38885939 CTCTGTGAGAAAGAGAAAGGTGG - Intergenic
1127491776 15:59472007-59472029 TGCTGTGACCAAAAGAAATCTGG - Intronic
1127892691 15:63269262-63269284 CTGTGAGACCAAGAGGAAGGAGG - Intergenic
1128624464 15:69185694-69185716 TTCTGTGACCAAAGGTATGGGGG + Intronic
1128698939 15:69789890-69789912 CTCTGTGCCCAAACGAGAGGAGG - Intergenic
1129171613 15:73811551-73811573 CTCTGTTACAAGAAGAAGGGTGG - Intergenic
1129828883 15:78654062-78654084 CTATGTGAACAAGTGAAAGGGGG - Intronic
1129978782 15:79847176-79847198 TTCAGAAACCAAAAGAAAGGTGG + Intronic
1131126550 15:89863062-89863084 CTATATGACAGAAAGAAAGGTGG + Intronic
1131876543 15:96812978-96813000 CTCTGTGATGAAAAGAACTGTGG - Intergenic
1133156095 16:3877407-3877429 CGCTGTCTCCAAAAGAAACGAGG - Intronic
1133527930 16:6624514-6624536 CACTCTAACCAAAACAAAGGTGG - Intronic
1134867036 16:17617675-17617697 CTCTGTTACCAAGAAAAAAGGGG - Intergenic
1135264350 16:21009876-21009898 CTCTGTCAAGAAAAGAAAAGAGG + Intronic
1135596713 16:23749821-23749843 CTCTGGGACGAAAAGTAATGAGG - Intergenic
1136565789 16:31069363-31069385 CTCTTTGAGGAGAAGAAAGGAGG - Intronic
1136931522 16:34422099-34422121 GTCTGAAACCAAAAGAATGGTGG + Intergenic
1136973050 16:34989720-34989742 GTCTGAAACCAAAAGAATGGTGG - Intergenic
1136999761 16:35218202-35218224 TTCTGTGATCAGAAGAAAGAAGG - Intergenic
1137611535 16:49821551-49821573 CTCTGTGACCAGATGAACGGAGG + Intronic
1138108018 16:54301026-54301048 CTCTGTGATGAAAAGATGGGCGG - Intergenic
1138833746 16:60408277-60408299 CTGAGTGACCAAGACAAAGGGGG + Intergenic
1138955904 16:61970611-61970633 TTCTGTGACCAAATGCATGGGGG + Intronic
1139801184 16:69524287-69524309 GTCTGTTCCCAGAAGAAAGGAGG - Intergenic
1140388416 16:74563131-74563153 CTCTATGAACAACAGAAAAGGGG + Intronic
1143836675 17:9698576-9698598 CTCTGATACAAAAAGAAAGAGGG - Intronic
1144395452 17:14838637-14838659 CTCTGAGATCCAGAGAAAGGAGG - Intergenic
1145099789 17:20065178-20065200 TTCTGTGACCAAATGTATGGGGG + Intronic
1146401310 17:32502050-32502072 TTCTGTGACCAAAGGTATGGAGG - Intronic
1148099797 17:45082112-45082134 CTCTGTCTCAAAAAGAAAGGGGG - Intronic
1149186886 17:54008609-54008631 CTCCTTGACCACAAGAAAGATGG - Intergenic
1149747245 17:59110490-59110512 CTCTGTAATTAAAAAAAAGGGGG + Exonic
1151926318 17:77200159-77200181 CCCTGTCTCCAAAAGAAAAGTGG + Intronic
1152112368 17:78364236-78364258 CTCTGTCTCCAAAAAAAAGACGG + Intergenic
1152485735 17:80591330-80591352 CTCTGTCTCCAAAAAAAAGAAGG - Intronic
1152815843 17:82407306-82407328 CCCTGTGACCTAAAGAATGGTGG + Intronic
1154123292 18:11669057-11669079 GTCTGGGAACAAAAGAAAGGTGG + Intergenic
1154125315 18:11687837-11687859 ATATTTGAGCAAAAGAAAGGAGG - Intergenic
1154967397 18:21373341-21373363 CTCTGTCTCGAAAAAAAAGGAGG - Intronic
1155147189 18:23093914-23093936 CTCTGTCTCAAAAAAAAAGGGGG - Intergenic
1157483824 18:48073278-48073300 CTCTGTGACCTAAATGAGGGTGG - Intronic
1157799029 18:50603382-50603404 CCCTGTGACCACAACAAAGAGGG + Intronic
1160735740 19:661641-661663 CTCTGTGACCCAGAGACAGGCGG + Intronic
1160891500 19:1381005-1381027 CTGTGTGACCAACAGAATGGCGG - Intergenic
1160926071 19:1546483-1546505 CTCTGTCTCCAAAAAAAAGGGGG - Intergenic
1161499378 19:4605163-4605185 CTCTGAGACGAAAAGAAAATGGG - Intergenic
1162282067 19:9706792-9706814 CTCTGATACCAAGAGCAAGGTGG - Intergenic
1162758747 19:12875704-12875726 CTCTGTTTCAAAAAAAAAGGGGG - Exonic
1163292128 19:16385701-16385723 GCCTGTTCCCAAAAGAAAGGGGG + Intronic
1163396901 19:17069191-17069213 CTCAGTGACCAGAACAGAGGAGG + Intronic
1166098995 19:40559920-40559942 CTCTCAGACCAAAAGAAATCAGG + Intronic
1166321432 19:42021551-42021573 CACAGTGATCAGAAGAAAGGGGG + Intronic
1166767713 19:45262329-45262351 CTCTGCCTCCAAAAGAAAAGGGG + Intronic
1167541207 19:50088356-50088378 CTCTGTCTCCAAAAAAAAAGGGG + Intergenic
1167867294 19:52338665-52338687 CTCTGTCTCAAAAAAAAAGGAGG + Intronic
1168313413 19:55473071-55473093 CTCTGTTTCCAAAAAAAAGAAGG + Intergenic
1168397836 19:56064031-56064053 CTCTGTCTCAAAAAAAAAGGGGG + Intergenic
1168514548 19:57000714-57000736 CTATGTGGCCAAAAGAGAGTGGG + Intergenic
931207634 2:60163581-60163603 CTGTGATACAAAAAGAAAGGAGG - Intergenic
931304876 2:61018100-61018122 CTCTGTGCTTGAAAGAAAGGGGG + Exonic
931309524 2:61065578-61065600 CCCTGAGTCCAGAAGAAAGGGGG - Intergenic
931897753 2:66752060-66752082 CGGTGTTAACAAAAGAAAGGAGG + Intergenic
932114472 2:69033816-69033838 ATCTGTGTGCAAAAGAAGGGAGG + Intronic
932160847 2:69458172-69458194 GGCTGTGAACAAGAGAAAGGAGG - Intronic
932280244 2:70485243-70485265 GTCTGTCTCAAAAAGAAAGGGGG - Intronic
932344413 2:70986197-70986219 CTCTGTGACCAAAAGAAAGGAGG + Exonic
932895421 2:75634790-75634812 CTCTGTCAAAAAAAAAAAGGTGG + Intergenic
933194466 2:79372502-79372524 TTCTGTGGCTAATAGAAAGGGGG + Intronic
933259292 2:80114044-80114066 CTCAGTGCCCATCAGAAAGGGGG - Intronic
934053334 2:88228763-88228785 CTCTGTGACTATAAGAAAACTGG - Intergenic
935996537 2:108780197-108780219 CTCTGTCACCAAAAAAAAAAAGG - Intronic
936157055 2:110054599-110054621 CTCTGTGAACAAAAGTGTGGAGG + Intergenic
936187639 2:110316845-110316867 CTCTGTGAACAAAAGTGTGGAGG - Intergenic
939782415 2:146465283-146465305 CACTGTTACCAAAAGCCAGGTGG - Intergenic
940012712 2:149071936-149071958 CTCTGTCTCAAAAAAAAAGGGGG - Intronic
940092445 2:149935951-149935973 CTCTCTGGAAAAAAGAAAGGAGG + Intergenic
940198462 2:151123076-151123098 CTTTGTCTCCAAAAGAAAGGGGG + Intergenic
940286447 2:152037753-152037775 CTCTGAGACCTAAAGGGAGGAGG + Intronic
945018241 2:205542880-205542902 CTGTGTAAACAAAAGAAATGTGG + Intronic
947845954 2:233243903-233243925 ATCTGTTACCAAAAGAAAGGTGG + Intronic
947936585 2:234009727-234009749 CTCTGTGAGTAAAAAGAAGGAGG - Intronic
948570940 2:238916761-238916783 CTCTGGGACTAGAAGGAAGGTGG + Intergenic
1170724567 20:18914835-18914857 TTCTGTGACCAAATGTATGGGGG - Intergenic
1172369767 20:34379902-34379924 CTCTGTCTCAAAAAAAAAGGGGG - Intronic
1173140008 20:40473599-40473621 CTCTGGGACAAGAAGCAAGGAGG - Intergenic
1173217697 20:41101520-41101542 CAATGTGACCAAAAAAATGGAGG - Intronic
1173876928 20:46378996-46379018 CTCTGTCTCAAAAAAAAAGGAGG - Intronic
1173894358 20:46539078-46539100 TTCTGTGACCAAAACATATGGGG - Intergenic
1174424227 20:50420699-50420721 CTCTGGGACCCAGAGCAAGGTGG - Intergenic
1174518159 20:51109188-51109210 CTCAGTTACCAAAATAAGGGGGG - Intergenic
1174790013 20:53469531-53469553 CTCTGTCAAGAAAAGAAAGAAGG + Intronic
1177468633 21:21524522-21524544 CTCTGTAACAAAAAAAAAGGGGG + Intronic
1177635758 21:23784814-23784836 CTCTGTCAAAAAAGGAAAGGAGG + Intergenic
1179435781 21:41361182-41361204 CTCTGTGACCAAAGTCAAGGAGG - Intergenic
1179672354 21:42958600-42958622 CTCTGTCTCAAAAAAAAAGGGGG + Intergenic
1179958330 21:44753552-44753574 CTCTGTGTCCACAAGCACGGCGG + Intergenic
1180355241 22:11834140-11834162 CTCTGTCTCAAAAAAAAAGGAGG - Intergenic
1180756860 22:18168401-18168423 CTCTGTCTCCAAAAAAAAGGGGG - Intronic
1182721982 22:32410521-32410543 CTCTATTCCCAAAGGAAAGGTGG + Intronic
1182882456 22:33745236-33745258 CTCTCTGACAAATAGAAAGGAGG - Intronic
1183148068 22:36013776-36013798 ATTTGTGTCAAAAAGAAAGGAGG + Intronic
1183286975 22:36972772-36972794 CCCTGTGACCATAAGAAATAAGG + Intergenic
1183528822 22:38341118-38341140 CTCGGTGACGAAAAGGAAGGAGG - Intronic
949562996 3:5220218-5220240 CTCAGTGGCCAAGAGAAAGGAGG - Intergenic
952114585 3:30163406-30163428 CTCTGTGAAGAAAATAGAGGTGG + Intergenic
952511067 3:34056459-34056481 ATCTGTGAACAAAAGAGATGGGG - Intergenic
952635003 3:35518531-35518553 CTCTGTGACCACATGACAAGAGG - Intergenic
952838393 3:37624295-37624317 CTCTATGACCCGAAGAAAGCTGG - Intronic
953117363 3:40006380-40006402 CTCTGTCTCAAAAAAAAAGGAGG + Intronic
953680496 3:45035167-45035189 CTCTGTGACCCAAGGAGATGGGG + Intronic
954124092 3:48518543-48518565 CTCTGGGACCAAAAGAACTCAGG + Exonic
954280353 3:49572868-49572890 CTGTGTGTGCAGAAGAAAGGAGG + Intronic
955097916 3:55818102-55818124 CTGTTTTGCCAAAAGAAAGGAGG - Intronic
955714213 3:61811401-61811423 CTGTGGGACCAAAAGCAAGAGGG - Intronic
955792004 3:62597723-62597745 CTCTGTGTCCAATAGGATGGGGG - Intronic
957525907 3:81378500-81378522 CTCTGTCAAAAAAAAAAAGGAGG + Intergenic
957827671 3:85469570-85469592 CTTTGTAAGCAAGAGAAAGGGGG + Intronic
961639268 3:128354757-128354779 TTTTATAACCAAAAGAAAGGAGG + Intronic
961777372 3:129298201-129298223 CTCTGTCACCAAAGGAAAGAAGG - Intronic
962829711 3:139129263-139129285 CTCTGTTACCCAAAGTCAGGTGG - Intronic
963062496 3:141235799-141235821 CTCTGAGTCCAAAAGGCAGGAGG + Intronic
963781323 3:149489429-149489451 ATCTATGTCCAAAACAAAGGAGG + Intronic
964616430 3:158671896-158671918 CCCTTTGACCAAAATGAAGGGGG - Intronic
964956943 3:162370965-162370987 CTCTGTGACCACAAAGAAGAAGG - Intergenic
965631109 3:170733974-170733996 CTCTGACAGCAAAAGAAAGCAGG + Intronic
966051420 3:175620801-175620823 TCCTGTGACCAAGAGAAATGAGG + Intronic
966216278 3:177506484-177506506 CTCTGTGACCTTAAGTAAAGTGG - Intergenic
968524668 4:1049937-1049959 CTCTGTCTCAAAAAAAAAGGGGG - Intergenic
973220067 4:47715590-47715612 CTCTGTCTCCAAAAAAAAAGGGG + Intronic
973388077 4:49528582-49528604 CTCTGTCTCAAAAAAAAAGGAGG - Intergenic
973665106 4:53151258-53151280 ATCTGAGACCAAAAGAAAAAAGG + Intronic
973819871 4:54653388-54653410 CTGTGTGACCAAAAGTATTGTGG - Intergenic
974513419 4:62875016-62875038 CTCTGTCTCAAAAAAAAAGGAGG + Intergenic
974589287 4:63922120-63922142 CCCTGTGACCAAGAGGAATGAGG + Intergenic
975422370 4:74182640-74182662 CTCTGTCACAGAAAAAAAGGAGG - Intronic
976456732 4:85256609-85256631 CTCTGAGAACAAAAGAGAGATGG - Intergenic
979924134 4:126538546-126538568 CTCTGTGAGCAAGTGAAAGATGG + Intergenic
980581016 4:134750382-134750404 CATTATAACCAAAAGAAAGGAGG + Intergenic
981252257 4:142617375-142617397 CCCTGTGACCTAAGGGAAGGTGG - Intronic
981456030 4:144954199-144954221 CTCTGTGAGCAACAGTGAGGAGG - Intergenic
981487273 4:145300732-145300754 CTCGCTGACCAGAAGAAAGAAGG - Intergenic
981908144 4:149946887-149946909 TTCTGTGACCAAAAAAGAAGCGG - Intergenic
982136110 4:152275752-152275774 CTCTGTCTCCAAATGACAGGAGG + Intergenic
983076582 4:163333150-163333172 CTCAGTGGGCCAAAGAAAGGAGG - Intronic
984185055 4:176533552-176533574 CTCTATCACCAAAAGCAAGATGG + Intergenic
986279358 5:6311015-6311037 CTCTGTGGCCAACAGAAACTGGG + Intergenic
986326974 5:6683297-6683319 CTCTGTGTCCAAAAGGTAGAAGG - Intergenic
988229168 5:28451627-28451649 CTCTGTGTCTAAAAGAATGTTGG - Intergenic
988590672 5:32546214-32546236 CTCTGTCTCAAAAAAAAAGGGGG - Intronic
989774786 5:45191680-45191702 CTCTTCTACCAAAAGAAATGTGG - Intergenic
990662671 5:58034807-58034829 GTCTGTGACCAAAAGAAGAAAGG - Intergenic
992826853 5:80558585-80558607 CTTTTTGACCACAAGAAAGAAGG + Exonic
994114840 5:96050447-96050469 CTCTGTGATGAGAAGAAAGCTGG + Intergenic
995936282 5:117519487-117519509 ATAGCTGACCAAAAGAAAGGTGG + Intergenic
996148505 5:120005815-120005837 CTGTGTTACTCAAAGAAAGGTGG + Intergenic
996576622 5:124983121-124983143 CTCTGAAACAAAAAAAAAGGTGG - Intergenic
996616823 5:125452210-125452232 CTGTGTGAAGAAAAGAAATGTGG + Intergenic
996993301 5:129663569-129663591 CTTAGTAACCAAAAGAAAGTGGG - Intronic
998126479 5:139626073-139626095 CTCTGTCTCAAAAAAAAAGGGGG - Intronic
998552807 5:143093794-143093816 CTCTGAGAAGAAAGGAAAGGGGG + Intronic
998674556 5:144392502-144392524 CTGTGTGACCAGATGAGAGGTGG + Intronic
1000366135 5:160493037-160493059 CCCTCTAACCAAAAGAAAGTGGG - Intergenic
1002030461 5:176424828-176424850 CTCTGTCTCAAAAAAAAAGGAGG + Intergenic
1002409746 5:179064421-179064443 CTCTGTCTCCAAAAAAAAAGGGG - Intronic
1002935056 6:1664374-1664396 CTCTGTCACCAACAGTGAGGTGG + Intronic
1003538865 6:7000594-7000616 CTCTGTGAAAAAAGGAAGGGAGG + Intergenic
1003630672 6:7783665-7783687 GGCTGTGAACAAGAGAAAGGAGG - Intronic
1003876631 6:10443451-10443473 CTCTGTCTCAAAAAAAAAGGGGG + Intergenic
1004394394 6:15235434-15235456 TTCTGGGACCAAATGAATGGAGG + Intergenic
1004648529 6:17586133-17586155 CTCTCTCTCCAAAAGAAGGGGGG + Intergenic
1005023722 6:21442468-21442490 GTCTGTGACCAAATGCATGGGGG - Intergenic
1006008712 6:31024574-31024596 CCCTGTCAGCAAAAGAAATGTGG + Intronic
1006032006 6:31183208-31183230 CTCTGTTACCAGGAGTAAGGTGG + Intergenic
1006758931 6:36442575-36442597 CATTCTGGCCAAAAGAAAGGGGG - Exonic
1006828479 6:36954532-36954554 CCCCGTTACCAAGAGAAAGGAGG + Exonic
1007235813 6:40390829-40390851 CTCTGTGTCCAGTAAAAAGGAGG + Intergenic
1007346594 6:41236015-41236037 CCCTGGGACCAACAGACAGGAGG + Intronic
1008035191 6:46737846-46737868 GTCTGGGACCCAAAGAAAAGTGG + Intergenic
1009274664 6:61660312-61660334 CTCTGAGACAAAATGGAAGGAGG + Intergenic
1009969733 6:70614171-70614193 CTCTTTCAAAAAAAGAAAGGAGG - Intergenic
1010391424 6:75342626-75342648 CTCTGGGACCATTAGGAAGGTGG + Intronic
1010613269 6:77982615-77982637 ATCTGTGACAAACAGAGAGGAGG + Intergenic
1011224259 6:85089533-85089555 CTCAGTGACAAAAATAAAGATGG + Intergenic
1011749811 6:90443746-90443768 CCCTGTCACCAAAACACAGGTGG - Intergenic
1012603331 6:101126181-101126203 CTCTGTGAATAGAAGAAAGAAGG - Intergenic
1012637212 6:101558985-101559007 CTTGGTAACCAAAAGGAAGGTGG - Intronic
1013591999 6:111626802-111626824 CTTTGTGACAAAAAAAATGGAGG - Intergenic
1013697669 6:112723424-112723446 CCCTGTGCCAAAAAGAAAGATGG + Intergenic
1014257977 6:119183402-119183424 CTCTTTGTCAAAAAAAAAGGAGG - Intronic
1014296412 6:119623833-119623855 TTCTGTGACCTAAAGGAAGAAGG + Intergenic
1014818656 6:125961287-125961309 TTCTGTGACCAAATGTATGGAGG + Intronic
1014830221 6:126094575-126094597 CTCTGAGACTAAAGGAAATGTGG - Intergenic
1015575460 6:134666344-134666366 CTCTGAGACCTAAGGAAAGCTGG + Intergenic
1016260302 6:142161086-142161108 CTATTTGACCCAAAAAAAGGGGG - Intronic
1016959408 6:149657140-149657162 CTCCGTTACTGAAAGAAAGGAGG + Intergenic
1017245828 6:152223609-152223631 CTCTGTCTCAAAAAGGAAGGAGG + Intronic
1017456776 6:154607731-154607753 CTCTTTGGCCTAAAGAAAGGAGG - Intergenic
1017824257 6:158070118-158070140 CTTTGTGAGCATCAGAAAGGGGG + Intronic
1018216829 6:161536439-161536461 TTCTGTTAGCAAGAGAAAGGGGG + Intronic
1019864720 7:3696532-3696554 CTCTGTGAGAAAGAGAAAGTTGG - Intronic
1020165691 7:5806110-5806132 CCCTGTGTCCAAAAAAAAAGGGG - Intergenic
1020496657 7:8861467-8861489 CTCTGTCAAAAAAAAAAAGGGGG + Intergenic
1020833116 7:13115389-13115411 CTCTGTGAGGAAAAAAAAGAAGG - Intergenic
1021615266 7:22497569-22497591 CTCTGTGACCAACATTAAAGAGG + Intronic
1021723174 7:23524564-23524586 CTCTGAGATAAAAAGAAAGAAGG - Intronic
1021874640 7:25037134-25037156 CTCTTTGAACAAAAGACAGATGG - Intergenic
1021967987 7:25940841-25940863 CTCTGTGACCAAATGAAGGAAGG - Intergenic
1022409973 7:30131909-30131931 CTATGGGAACACAAGAAAGGGGG + Intergenic
1022987762 7:35675721-35675743 CTCTTTGAAGAAAAGAAATGAGG - Intronic
1023069444 7:36414428-36414450 CTGTGTGACGAAAAGGAAGGAGG + Intronic
1024127155 7:46310975-46310997 ATTTGTGTCCAAAACAAAGGTGG - Intergenic
1026609809 7:71847673-71847695 CTCTGTCAAAAAAAAAAAGGAGG + Intronic
1026803251 7:73413079-73413101 CTCTGTCTCAAAAAAAAAGGGGG + Intergenic
1028377227 7:90157064-90157086 CTCTGTGACCAACATTAAAGAGG - Intronic
1029696974 7:102220039-102220061 CTGTATGACCAAAATACAGGAGG + Intronic
1030093111 7:105875308-105875330 ATCTGTGACCAAATGCAAAGTGG + Intronic
1030318497 7:108140667-108140689 CTGTGTGAAGAAAAGAAAGGGGG + Intergenic
1030801227 7:113855748-113855770 CTGTGTGTCCAAAAGAAAATAGG + Intergenic
1030952059 7:115803021-115803043 ATCTGTGACCACAAGGAAAGAGG - Intergenic
1031425305 7:121598070-121598092 CTCTAAGACCAAAAAAATGGTGG - Intergenic
1033662505 7:143412104-143412126 CTAGGGGACCAAAAAAAAGGAGG - Intergenic
1034434460 7:151056725-151056747 TTCTGTGACCAGGTGAAAGGCGG - Exonic
1035689025 8:1547674-1547696 CTCAGTGGCCATAAGACAGGTGG + Intronic
1036448707 8:8846244-8846266 CTCTGTCTCCAAAAAAAAGGGGG + Intronic
1036721857 8:11183199-11183221 CTGTATATCCAAAAGAAAGGAGG - Intronic
1037186095 8:16065292-16065314 CTACGTGAGTAAAAGAAAGGCGG - Intergenic
1038094932 8:24297947-24297969 CTCTGTGACAGCAAGAAATGAGG + Intronic
1040575943 8:48651649-48651671 CATTGTGAACAACAGAAAGGTGG - Intergenic
1041252295 8:55946160-55946182 CTCTGTCACCAAAGAAGAGGAGG + Intronic
1041307043 8:56472350-56472372 CTCAGTGACCAAGAGAAGAGAGG + Intergenic
1041891736 8:62877190-62877212 CTCTGGGTCCATAAGATAGGAGG - Intronic
1042034101 8:64511419-64511441 AACTGTGACTAAAAGAAAGCTGG - Intergenic
1042450733 8:68942530-68942552 CTCTGTCTCAAAAAAAAAGGAGG - Intergenic
1042460849 8:69066370-69066392 ATCTCTGAACAAAAGAAAGAGGG - Intergenic
1044115871 8:88333096-88333118 CTCTATGACAAAAAAAAAGAAGG - Intergenic
1046780295 8:118207618-118207640 CTCTGTGACTAAGAGAGATGGGG - Intronic
1046860621 8:119087255-119087277 CCCTGTGACCCAAAGCATGGTGG - Intronic
1047147031 8:122213865-122213887 CTCTGTGATTCAAACAAAGGAGG - Intergenic
1048191464 8:132293446-132293468 ATCTGTGACCAAAGGTATGGGGG - Intronic
1048529905 8:135238148-135238170 CACTGTGATCAAAAGATAGCAGG - Intergenic
1048663556 8:136634626-136634648 CTCTGTCACAAAAAAAAAGGAGG - Intergenic
1050467197 9:5939943-5939965 CTCTGTGACCAAAAAACTGGGGG + Intronic
1051153098 9:14106809-14106831 CTTTGGGAACAAAAGAAAGAAGG + Intronic
1051183469 9:14435774-14435796 CTCTGTGTTTAAAAGGAAGGTGG + Intergenic
1051243304 9:15082922-15082944 GTGGGTGACGAAAAGAAAGGTGG - Intergenic
1051641475 9:19228696-19228718 TCCTGTGTCCAAAAAAAAGGAGG + Intergenic
1052949072 9:34193410-34193432 ATCTGTGACCAAAAGTGTGGGGG + Intronic
1053257903 9:36634697-36634719 CTCTGTTTCAAAAAGAAAAGAGG + Intronic
1053655562 9:40215496-40215518 CTCTGTCTCAAAAAAAAAGGGGG - Intergenic
1053905931 9:42844713-42844735 CTCTGTCTCAAAAAAAAAGGGGG - Intergenic
1054367680 9:64361726-64361748 CTCTGTCTCAAAAAAAAAGGGGG - Intergenic
1054675299 9:67851461-67851483 CTCTGTCTCAAAAAAAAAGGTGG - Intergenic
1054840417 9:69732285-69732307 CTTTGTGACCAAAGGAAACTTGG - Exonic
1055172681 9:73279034-73279056 CTCTGTGAACAAAAAAATAGAGG + Intergenic
1055399545 9:75908482-75908504 CTTTTTGACCAGAGGAAAGGGGG - Intronic
1055560278 9:77515375-77515397 TACAGGGACCAAAAGAAAGGAGG + Intronic
1056493790 9:87135677-87135699 CTCAGTGACCAAAATATAGTTGG + Intergenic
1056570256 9:87808471-87808493 CTCAGTGAAAAAAAAAAAGGGGG - Intergenic
1056736611 9:89215214-89215236 TTCTGTAACAAAAAGGAAGGGGG + Intergenic
1057007777 9:91575778-91575800 CTCTGTACCCAAAAGAAAATTGG + Intronic
1057123935 9:92601563-92601585 CGCTGTGACCAAAAGGACAGAGG + Intronic
1057399660 9:94711934-94711956 CTCTGTCTCCAAAAAAAAAGGGG + Intergenic
1058362630 9:104167638-104167660 CTCTTTGACCAAAAAAAACTTGG + Intergenic
1058575680 9:106398769-106398791 GGCTGTGATCAAAAGGAAGGAGG + Intergenic
1060625960 9:125111729-125111751 CTCTGAGGACAAAAGAAGGGAGG + Intronic
1061538591 9:131265093-131265115 ATCTGTAATCAAAAGAATGGTGG - Intronic
1203552584 Un_KI270743v1:176526-176548 CTCTGTCTCAAAAAAAAAGGAGG - Intergenic
1185686990 X:1937434-1937456 CTCTGTCAAAAAAAAAAAGGAGG + Intergenic
1186518531 X:10185705-10185727 CTCTGTGACTTAAAAAAGGGGGG - Intronic
1186879941 X:13855023-13855045 CTCTGTGTCAAAAAAAAAAGGGG - Intronic
1188245522 X:27832112-27832134 CTCTGTGACCTAGAGGAAAGAGG - Intergenic
1189630560 X:42948102-42948124 CTCTGTGACCAATACAAAGTAGG + Intergenic
1192135838 X:68599447-68599469 ATCTGAGAACAAAAGAGAGGAGG + Intergenic
1192368908 X:70497549-70497571 CTCAGAGACCAAAAGAAAAATGG + Intronic
1194076644 X:89402249-89402271 CTCTTTGAAGAAATGAAAGGAGG - Intergenic
1194153849 X:90362456-90362478 CTCTGTCTCAAAAAAAAAGGTGG - Intergenic
1195917877 X:109953589-109953611 CTCTGTGTTCCATAGAAAGGTGG - Intergenic
1196002203 X:110797441-110797463 CACTGTTAACAAAGGAAAGGGGG + Intergenic
1196990217 X:121320463-121320485 ATCTGTGTCCAAATGAAAGGAGG - Intergenic
1198174901 X:134145552-134145574 CTCTGTCTCTAAAAAAAAGGGGG - Intergenic
1199252261 X:145676744-145676766 CTCTGTGAGAAAAACAAAGTGGG - Intergenic
1199412933 X:147546069-147546091 CACTGTGAACCAAAGAAAGAGGG + Intergenic
1199559078 X:149143827-149143849 CTCTGTCACAAATAGAAAGGGGG + Intergenic
1200120238 X:153786749-153786771 GTCTGTGAACAGGAGAAAGGCGG + Intronic
1200282001 X:154784970-154784992 CTCTGTAACCAGCAGAAAAGGGG - Intronic
1200429286 Y:3057772-3057794 CTCTTTGAAGAAATGAAAGGAGG - Intergenic
1200500199 Y:3939335-3939357 CTCTGTCTCAAAAAAAAAGGTGG - Intergenic