ID: 932347805

View in Genome Browser
Species Human (GRCh38)
Location 2:71007174-71007196
Sequence GCATCTACCCAGTTTTTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932347802_932347805 -10 Left 932347802 2:71007161-71007183 CCTCCCTTTCTTTGCATCTACCC No data
Right 932347805 2:71007174-71007196 GCATCTACCCAGTTTTTTTGAGG No data
932347800_932347805 -1 Left 932347800 2:71007152-71007174 CCCATCTCACCTCCCTTTCTTTG No data
Right 932347805 2:71007174-71007196 GCATCTACCCAGTTTTTTTGAGG No data
932347801_932347805 -2 Left 932347801 2:71007153-71007175 CCATCTCACCTCCCTTTCTTTGC No data
Right 932347805 2:71007174-71007196 GCATCTACCCAGTTTTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932347805 Original CRISPR GCATCTACCCAGTTTTTTTG AGG Intergenic
No off target data available for this crispr