ID: 932347949

View in Genome Browser
Species Human (GRCh38)
Location 2:71007775-71007797
Sequence CTCCTCTGCCTGGCACACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932347949_932347957 -6 Left 932347949 2:71007775-71007797 CCTGTGTGTGCCAGGCAGAGGAG No data
Right 932347957 2:71007792-71007814 GAGGAGCTGGGCCTAGGGAGGGG No data
932347949_932347960 13 Left 932347949 2:71007775-71007797 CCTGTGTGTGCCAGGCAGAGGAG No data
Right 932347960 2:71007811-71007833 GGGGGTCAGAGCTGCCTCTCAGG No data
932347949_932347962 23 Left 932347949 2:71007775-71007797 CCTGTGTGTGCCAGGCAGAGGAG No data
Right 932347962 2:71007821-71007843 GCTGCCTCTCAGGGCTGAGCTGG No data
932347949_932347956 -7 Left 932347949 2:71007775-71007797 CCTGTGTGTGCCAGGCAGAGGAG No data
Right 932347956 2:71007791-71007813 AGAGGAGCTGGGCCTAGGGAGGG No data
932347949_932347961 14 Left 932347949 2:71007775-71007797 CCTGTGTGTGCCAGGCAGAGGAG No data
Right 932347961 2:71007812-71007834 GGGGTCAGAGCTGCCTCTCAGGG No data
932347949_932347958 -5 Left 932347949 2:71007775-71007797 CCTGTGTGTGCCAGGCAGAGGAG No data
Right 932347958 2:71007793-71007815 AGGAGCTGGGCCTAGGGAGGGGG No data
932347949_932347963 24 Left 932347949 2:71007775-71007797 CCTGTGTGTGCCAGGCAGAGGAG No data
Right 932347963 2:71007822-71007844 CTGCCTCTCAGGGCTGAGCTGGG No data
932347949_932347955 -8 Left 932347949 2:71007775-71007797 CCTGTGTGTGCCAGGCAGAGGAG No data
Right 932347955 2:71007790-71007812 CAGAGGAGCTGGGCCTAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932347949 Original CRISPR CTCCTCTGCCTGGCACACAC AGG (reversed) Intergenic
No off target data available for this crispr