ID: 932352829

View in Genome Browser
Species Human (GRCh38)
Location 2:71045900-71045922
Sequence CCTACTATCCAGAGGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932352829_932352835 -9 Left 932352829 2:71045900-71045922 CCTCCCTCCCTCTGGATAGTAGG No data
Right 932352835 2:71045914-71045936 GATAGTAGGAAGAGTTTCACAGG No data
932352829_932352836 -8 Left 932352829 2:71045900-71045922 CCTCCCTCCCTCTGGATAGTAGG No data
Right 932352836 2:71045915-71045937 ATAGTAGGAAGAGTTTCACAGGG No data
932352829_932352837 -7 Left 932352829 2:71045900-71045922 CCTCCCTCCCTCTGGATAGTAGG No data
Right 932352837 2:71045916-71045938 TAGTAGGAAGAGTTTCACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932352829 Original CRISPR CCTACTATCCAGAGGGAGGG AGG (reversed) Intergenic
No off target data available for this crispr