ID: 932352835

View in Genome Browser
Species Human (GRCh38)
Location 2:71045914-71045936
Sequence GATAGTAGGAAGAGTTTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932352826_932352835 19 Left 932352826 2:71045872-71045894 CCTCCTGCGTTATTGGGAGTAAT No data
Right 932352835 2:71045914-71045936 GATAGTAGGAAGAGTTTCACAGG No data
932352829_932352835 -9 Left 932352829 2:71045900-71045922 CCTCCCTCCCTCTGGATAGTAGG No data
Right 932352835 2:71045914-71045936 GATAGTAGGAAGAGTTTCACAGG No data
932352827_932352835 16 Left 932352827 2:71045875-71045897 CCTGCGTTATTGGGAGTAATATC No data
Right 932352835 2:71045914-71045936 GATAGTAGGAAGAGTTTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932352835 Original CRISPR GATAGTAGGAAGAGTTTCAC AGG Intergenic
No off target data available for this crispr