ID: 932352836

View in Genome Browser
Species Human (GRCh38)
Location 2:71045915-71045937
Sequence ATAGTAGGAAGAGTTTCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932352827_932352836 17 Left 932352827 2:71045875-71045897 CCTGCGTTATTGGGAGTAATATC No data
Right 932352836 2:71045915-71045937 ATAGTAGGAAGAGTTTCACAGGG No data
932352826_932352836 20 Left 932352826 2:71045872-71045894 CCTCCTGCGTTATTGGGAGTAAT No data
Right 932352836 2:71045915-71045937 ATAGTAGGAAGAGTTTCACAGGG No data
932352829_932352836 -8 Left 932352829 2:71045900-71045922 CCTCCCTCCCTCTGGATAGTAGG No data
Right 932352836 2:71045915-71045937 ATAGTAGGAAGAGTTTCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932352836 Original CRISPR ATAGTAGGAAGAGTTTCACA GGG Intergenic
No off target data available for this crispr