ID: 932352837

View in Genome Browser
Species Human (GRCh38)
Location 2:71045916-71045938
Sequence TAGTAGGAAGAGTTTCACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932352831_932352837 -10 Left 932352831 2:71045903-71045925 CCCTCCCTCTGGATAGTAGGAAG No data
Right 932352837 2:71045916-71045938 TAGTAGGAAGAGTTTCACAGGGG No data
932352827_932352837 18 Left 932352827 2:71045875-71045897 CCTGCGTTATTGGGAGTAATATC No data
Right 932352837 2:71045916-71045938 TAGTAGGAAGAGTTTCACAGGGG No data
932352826_932352837 21 Left 932352826 2:71045872-71045894 CCTCCTGCGTTATTGGGAGTAAT No data
Right 932352837 2:71045916-71045938 TAGTAGGAAGAGTTTCACAGGGG No data
932352829_932352837 -7 Left 932352829 2:71045900-71045922 CCTCCCTCCCTCTGGATAGTAGG No data
Right 932352837 2:71045916-71045938 TAGTAGGAAGAGTTTCACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932352837 Original CRISPR TAGTAGGAAGAGTTTCACAG GGG Intergenic
No off target data available for this crispr