ID: 932353441

View in Genome Browser
Species Human (GRCh38)
Location 2:71049745-71049767
Sequence AAGGGCCTACTGAACTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932353432_932353441 18 Left 932353432 2:71049704-71049726 CCTTTTTAACCCTTCAAGTGCGT No data
Right 932353441 2:71049745-71049767 AAGGGCCTACTGAACTCTGGGGG No data
932353434_932353441 9 Left 932353434 2:71049713-71049735 CCCTTCAAGTGCGTAGAGGATTA No data
Right 932353441 2:71049745-71049767 AAGGGCCTACTGAACTCTGGGGG No data
932353435_932353441 8 Left 932353435 2:71049714-71049736 CCTTCAAGTGCGTAGAGGATTAT No data
Right 932353441 2:71049745-71049767 AAGGGCCTACTGAACTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932353441 Original CRISPR AAGGGCCTACTGAACTCTGG GGG Intergenic
No off target data available for this crispr