ID: 932353780

View in Genome Browser
Species Human (GRCh38)
Location 2:71051845-71051867
Sequence CCTTATATCCAGAGGGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932353780_932353786 -9 Left 932353780 2:71051845-71051867 CCCCTCTCCCTCTGGATATAAGG No data
Right 932353786 2:71051859-71051881 GATATAAGGAAGAGTTTCACAGG No data
932353780_932353787 -8 Left 932353780 2:71051845-71051867 CCCCTCTCCCTCTGGATATAAGG No data
Right 932353787 2:71051860-71051882 ATATAAGGAAGAGTTTCACAGGG No data
932353780_932353790 18 Left 932353780 2:71051845-71051867 CCCCTCTCCCTCTGGATATAAGG No data
Right 932353790 2:71051886-71051908 TGTGCACCCGCTGCGATATTGGG No data
932353780_932353789 17 Left 932353780 2:71051845-71051867 CCCCTCTCCCTCTGGATATAAGG No data
Right 932353789 2:71051885-71051907 GTGTGCACCCGCTGCGATATTGG No data
932353780_932353788 -7 Left 932353780 2:71051845-71051867 CCCCTCTCCCTCTGGATATAAGG No data
Right 932353788 2:71051861-71051883 TATAAGGAAGAGTTTCACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932353780 Original CRISPR CCTTATATCCAGAGGGAGAG GGG (reversed) Intergenic
No off target data available for this crispr