ID: 932355076

View in Genome Browser
Species Human (GRCh38)
Location 2:71061688-71061710
Sequence GAGAACTGGAGGAATACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932355071_932355076 18 Left 932355071 2:71061647-71061669 CCAGGGTTCAGGGCAGAAAGGGA No data
Right 932355076 2:71061688-71061710 GAGAACTGGAGGAATACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932355076 Original CRISPR GAGAACTGGAGGAATACTGC TGG Intergenic
No off target data available for this crispr