ID: 932356455

View in Genome Browser
Species Human (GRCh38)
Location 2:71071975-71071997
Sequence CAGAGCAAGGACCAGGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 0, 2: 4, 3: 64, 4: 410}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932356450_932356455 9 Left 932356450 2:71071943-71071965 CCCTCAACTCTTTAAGTAGTTTA 0: 1
1: 0
2: 2
3: 23
4: 252
Right 932356455 2:71071975-71071997 CAGAGCAAGGACCAGGCAGCAGG 0: 1
1: 0
2: 4
3: 64
4: 410
932356449_932356455 10 Left 932356449 2:71071942-71071964 CCCCTCAACTCTTTAAGTAGTTT 0: 1
1: 0
2: 1
3: 17
4: 214
Right 932356455 2:71071975-71071997 CAGAGCAAGGACCAGGCAGCAGG 0: 1
1: 0
2: 4
3: 64
4: 410
932356448_932356455 23 Left 932356448 2:71071929-71071951 CCACTCTTATATTCCCCTCAACT 0: 1
1: 0
2: 0
3: 20
4: 237
Right 932356455 2:71071975-71071997 CAGAGCAAGGACCAGGCAGCAGG 0: 1
1: 0
2: 4
3: 64
4: 410
932356451_932356455 8 Left 932356451 2:71071944-71071966 CCTCAACTCTTTAAGTAGTTTAA 0: 1
1: 0
2: 1
3: 19
4: 300
Right 932356455 2:71071975-71071997 CAGAGCAAGGACCAGGCAGCAGG 0: 1
1: 0
2: 4
3: 64
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932356455 Original CRISPR CAGAGCAAGGACCAGGCAGC AGG Intronic
900224688 1:1527410-1527432 CACAGCAGGGGTCAGGCAGCAGG + Intronic
901192391 1:7420313-7420335 CAGAGCAAGGAGCAGGGCACTGG - Intronic
901303308 1:8215381-8215403 CAGTGCAGAGACCAGGCAGGTGG + Intergenic
902410611 1:16209745-16209767 CAGAGCAAGGACCTGTGGGCTGG - Intronic
902557260 1:17254257-17254279 GAGACCAAGACCCAGGCAGCTGG - Intronic
902816185 1:18918011-18918033 CAGAGGAAGGGGCAGGAAGCGGG + Intronic
903283461 1:22263184-22263206 CAGCGCCAGGTCAAGGCAGCTGG + Intergenic
904590807 1:31614400-31614422 AAGAGCAGAGATCAGGCAGCAGG - Intergenic
904612544 1:31733354-31733376 CAGAGCAGGGACCAGGAAGGTGG + Intronic
904616779 1:31754243-31754265 CAGAGCCAGGAGCAGCCAGCTGG - Intronic
904837228 1:33347139-33347161 CAGAGCAAGGAACAGGCACAGGG + Intronic
904839535 1:33363617-33363639 CAGAACAAAGACCTGGCATCTGG + Intronic
905159611 1:36020141-36020163 CTCAGGAAGGAGCAGGCAGCCGG + Intronic
905207355 1:36350473-36350495 CAGAGCCAGGACTAGGAACCTGG - Intronic
905365653 1:37449864-37449886 CAGAGCCAGGACCATCCAGACGG - Intergenic
905787464 1:40769710-40769732 CAGAGCCAGGACTAGAGAGCAGG + Intronic
906148416 1:43573527-43573549 CAGAGCTGGGGCCAGCCAGCAGG - Intronic
906666669 1:47626978-47627000 CAGGGCAGGGACCAGGCACAGGG + Intergenic
907037277 1:51227693-51227715 CAAAGAAAGGTCCAGGCTGCTGG - Intergenic
907636536 1:56140731-56140753 CAGATCCAGGGCCAGGCATCTGG - Intergenic
907801374 1:57769117-57769139 CGGAGCATGTACCATGCAGCAGG - Intronic
908386559 1:63648231-63648253 CAGAACAATGAAGAGGCAGCCGG + Intronic
910062805 1:83113913-83113935 CAGAGAGAGGACGAGTCAGCTGG - Intergenic
910214191 1:84825758-84825780 CAGAGAAAGGCCCAGGAGGCCGG + Intronic
910459755 1:87436451-87436473 CAGAAGAAGGGCCAGGCACCCGG + Intergenic
912823087 1:112882898-112882920 CAGAGCTAAGGCCAGGCTGCTGG - Intergenic
913478552 1:119262576-119262598 TAGAGCAAGGACTTGGAAGCAGG + Intergenic
914905697 1:151741760-151741782 CAGGGGAAGAAGCAGGCAGCTGG - Intergenic
915399273 1:155610603-155610625 CAGCGCAAGGACTAGGCACGCGG - Intronic
915416388 1:155746183-155746205 CAGCGCAAGGACTAGGCACGCGG - Intergenic
915797837 1:158755522-158755544 TAGAGCAATGACCAGGAAGGAGG - Exonic
916195155 1:162215575-162215597 CAGAGCTCAGGCCAGGCAGCAGG - Intronic
916583378 1:166128407-166128429 CAGTGCAAGGACCAGACCCCAGG - Intronic
917443504 1:175087305-175087327 AAGAGAAAGGAGCAGGTAGCGGG + Intronic
918037956 1:180893946-180893968 GAGAGCAAGTACCAGGCAACTGG + Intergenic
918111558 1:181459318-181459340 CTGAGTCAGCACCAGGCAGCAGG + Intronic
918148731 1:181780475-181780497 CATAGCACTGCCCAGGCAGCTGG + Intronic
919833490 1:201558030-201558052 CACAGCTAGGAAGAGGCAGCAGG - Intergenic
920303791 1:205005987-205006009 CAGAACAAGCACCAGGAAGATGG + Intronic
920433023 1:205930769-205930791 CAGAGGATGGTCCAGGCAGAAGG - Intronic
922696112 1:227731869-227731891 CAGAGGAAGGCGCAGGCCGCTGG + Exonic
922791878 1:228315420-228315442 CATTCCAGGGACCAGGCAGCAGG + Intronic
923039246 1:230308094-230308116 CAGAGCGAGGAACAGGCCCCAGG - Intergenic
923681172 1:236119877-236119899 CAGAGCAAGGTCCTGGAAGCAGG + Intergenic
923765831 1:236891526-236891548 CAGAGGCAGGACCACTCAGCAGG + Intronic
924008874 1:239643100-239643122 CAGAGGAACGATCAGACAGCAGG - Intronic
1064135878 10:12750472-12750494 CAAAGCCAGGACCAGCCAGGTGG + Intronic
1064143257 10:12807644-12807666 CAGGACAAGGAGCAGGTAGCCGG - Intronic
1064334634 10:14427599-14427621 CAGAGCAGTGCCCAGGCTGCTGG - Intronic
1064998406 10:21316089-21316111 GAGGCCAAGAACCAGGCAGCCGG + Intergenic
1065341985 10:24716303-24716325 CAGAGCATGGCACAGGGAGCAGG + Intronic
1066348530 10:34614245-34614267 CAGAGGAAGGACCAGGAACCTGG + Intronic
1067523505 10:47025369-47025391 GAGAGCAGGGCACAGGCAGCAGG - Intergenic
1067580823 10:47444367-47444389 CAGAGCCAGGACCAAGGAGAGGG + Intergenic
1068241381 10:54305892-54305914 CAGAAAAAAGACCAGGAAGCAGG + Intronic
1070736944 10:78869657-78869679 CAGACCAAGGACACGGCAGGAGG - Intergenic
1070770071 10:79077163-79077185 CAGGGCAAGGTCCAGGCACCTGG - Intronic
1071292221 10:84196063-84196085 CAGAACCAGGTCCAGGCATCGGG + Intronic
1072539834 10:96390003-96390025 CAGAGCAAGCACGAGCCAGTGGG - Intronic
1073380999 10:103078061-103078083 AAGAGCAAGGACCAGGGAGGTGG - Exonic
1073559242 10:104482790-104482812 AGGAGCAAGGACCAGACAGCTGG - Intergenic
1075265836 10:120999121-120999143 CAGAGAAAGGCCCTGGCAGTGGG + Intergenic
1076035576 10:127196419-127196441 CAGAGCCAGGGCCAGGAGGCGGG + Intronic
1076289288 10:129331969-129331991 CAAGGCTAGGACCAGGCAGGCGG - Intergenic
1076484862 10:130809389-130809411 CAGAGCATGGACCTGCCCGCTGG + Intergenic
1077102096 11:827008-827030 CGGAGCAGGGACAAGGCTGCGGG - Intronic
1078948493 11:16099994-16100016 GAGAACAAGGACAAGGCAGGAGG + Intronic
1079399002 11:20090738-20090760 CACAGGAAGCACCAGGCAGCTGG + Intronic
1080689877 11:34547627-34547649 CAGAGCAAAGACCAGGCCAAAGG - Intergenic
1083213602 11:61204594-61204616 CAATGAAAGGAACAGGCAGCAGG + Intronic
1084173075 11:67409863-67409885 CCTGGCAAGGACCAGGCAGTGGG + Exonic
1084190925 11:67498392-67498414 CAGAGCCAGGGCCTGCCAGCAGG - Intronic
1084410483 11:69003632-69003654 CAGAGCCAGGAGCAGGCAGGCGG - Intergenic
1084664967 11:70571412-70571434 CAGAGAAAGGGCATGGCAGCAGG + Intronic
1084768491 11:71327471-71327493 CAGAGCAAGGTGCTGGGAGCCGG - Intergenic
1085258643 11:75191584-75191606 CAGAGCAGGGCCAAGCCAGCTGG - Intronic
1085331480 11:75655564-75655586 CAGGGCAAGGCCCAGGCATCTGG - Intronic
1085699426 11:78732959-78732981 CAGAGCCAGGACCAGGCTTGGGG - Intronic
1087701169 11:101438393-101438415 CAAGGCAAGGAGCAGCCAGCAGG - Intergenic
1088733864 11:112709080-112709102 CCAAGCAAGGACTAGGAAGCTGG - Intergenic
1088808601 11:113373952-113373974 GAGAGACAGGGCCAGGCAGCGGG - Intronic
1089297310 11:117477887-117477909 CAGAGCACTGAGAAGGCAGCCGG - Intronic
1089555894 11:119315861-119315883 CAGGGCAAGGGCCAGGCAGTGGG + Intronic
1089589239 11:119529963-119529985 CAGAGCAGGGGTCAGGAAGCTGG - Intergenic
1089630373 11:119780471-119780493 CAGAGCCAGGCGGAGGCAGCAGG - Intergenic
1089820450 11:121221058-121221080 CATAGCCAGCAACAGGCAGCGGG - Intergenic
1090149989 11:124374100-124374122 CTGAGCAAGGCCCTGGCAGGGGG - Intergenic
1090415098 11:126535099-126535121 CAGAGCTGGGAGCAGGCAGATGG + Intronic
1090981302 11:131724885-131724907 CTGGGCAAGGAAAAGGCAGCAGG + Intronic
1091626162 12:2122529-2122551 GAGAGCAAGGACCGGGAGGCCGG - Intronic
1091728783 12:2864641-2864663 CAGAACAAGGACCAGGCCCAAGG + Intronic
1092119371 12:6033444-6033466 TGCAGCAAGGACCAGACAGCTGG - Intronic
1092208573 12:6631812-6631834 AAGAGAAAGGACCAGGGGGCTGG + Intronic
1093778012 12:23099878-23099900 CAGACCAAGAAGCAGGAAGCAGG + Intergenic
1096700691 12:53380662-53380684 CAGAGGGCGGACCAGGCAGGCGG - Intronic
1097990360 12:65825970-65825992 CCCAAAAAGGACCAGGCAGCCGG - Intronic
1098070393 12:66668469-66668491 CAGAAACAGCACCAGGCAGCTGG - Intronic
1098803116 12:74986128-74986150 GAGAGCCAGGAACAGGCAGGAGG - Intergenic
1100329809 12:93572102-93572124 CAGAGCGGGCACCAGGAAGCGGG + Exonic
1100378695 12:94041985-94042007 CAGAGGCAGCACCAGGCATCAGG - Intergenic
1101729637 12:107416365-107416387 CAGAGGAAGGACCAGCTAGCTGG - Intronic
1102819340 12:115894685-115894707 CAGAGCAAGGGGGAGGCAGCAGG + Intergenic
1103571646 12:121848919-121848941 TAGTGCAAGGACCAGGGAGTGGG + Intronic
1103904106 12:124318774-124318796 CGGGGCCAGGACCAGGCAGCTGG + Intergenic
1104521507 12:129480138-129480160 CAGAGGAGGGTCCAGGCAGCGGG + Intronic
1104843206 12:131834408-131834430 CAGAGGGAGGACCAGGCGGCGGG + Intronic
1104876629 12:132039408-132039430 GGGAGCAAGGGGCAGGCAGCAGG + Intronic
1105347774 13:19589600-19589622 CAGAGCCAGGCACAGGGAGCTGG - Intergenic
1105900171 13:24746438-24746460 CACAGCAAGGACCAGGAGGACGG - Intergenic
1107905227 13:45055386-45055408 CAAAACCAGGATCAGGCAGCTGG - Intergenic
1108640840 13:52380957-52380979 CAGAGCTAGGACCATCCAGGTGG + Intronic
1110415373 13:75246499-75246521 CAAAGGAACGATCAGGCAGCAGG - Intergenic
1111959887 13:94798604-94798626 CTCAGCCAGGACCAGGCAGCGGG + Intergenic
1112489075 13:99845735-99845757 CCCAGCAAGGACCAGGCCCCCGG - Intronic
1113453863 13:110433282-110433304 CAGAAATAGGACCAGGCGGCCGG + Intronic
1113842848 13:113370119-113370141 CAGGGCAAGGTGCAGGCTGCAGG + Intergenic
1113847238 13:113399350-113399372 CGGAGCAAGACCCAGGGAGCTGG - Intergenic
1114402456 14:22422490-22422512 CAGAGGAGGGACCAGGCAGAAGG + Intergenic
1114549942 14:23526846-23526868 CCGAGCAGAGACCAGGCAGCAGG - Exonic
1116485023 14:45437262-45437284 CAGAGGATGGCCCAGGCACCAGG + Intergenic
1117166963 14:53045087-53045109 CAGAGAAATGACCATGAAGCCGG - Exonic
1117213889 14:53529694-53529716 CAGAGCAAAGATCAGAGAGCTGG + Intergenic
1117580025 14:57142891-57142913 CAGAGCCAGGGCCGGGCAGGGGG + Intergenic
1119472188 14:74907128-74907150 CAGAGAGAGGCCCAGTCAGCTGG + Intronic
1119728337 14:76935740-76935762 CAGAGCCAGGCCCATGGAGCAGG - Intergenic
1119805957 14:77482546-77482568 CAGAGGAAGGACCAGAGGGCGGG + Exonic
1120974104 14:90233993-90234015 CATAGCAAGGAAAAGGGAGCAGG + Intergenic
1121096302 14:91220182-91220204 CAGGGCTTGAACCAGGCAGCCGG - Intronic
1121100305 14:91245615-91245637 CAGAGCAGGGACCAAGCACAGGG - Intronic
1121168697 14:91835873-91835895 CCGAGCACGGAGCAGGGAGCCGG + Intronic
1121415197 14:93774542-93774564 CAGCCCAAGGATCAGGCAGGAGG - Intronic
1121991545 14:98562527-98562549 CAGAGCAAGGAAGAGGCTGAAGG - Intergenic
1122150234 14:99721711-99721733 CAGAGCTGGGACCAGGAATCAGG - Intronic
1122402735 14:101476791-101476813 CAAAGCAATGAACAGGCAGGTGG - Intergenic
1122799702 14:104223414-104223436 CAGAGAAAGGAGGAGGCAGCTGG - Intergenic
1122876514 14:104668676-104668698 CAGGGCCACAACCAGGCAGCGGG + Intergenic
1124343296 15:28903746-28903768 CAGAGCCAGGACCTGGCACAGGG + Intronic
1124662571 15:31562353-31562375 CAGGCCAGGGACCAGGCAGCCGG + Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1128034613 15:64513789-64513811 CAGATTAAGGAACAGCCAGCTGG + Intronic
1128426723 15:67549081-67549103 CAGAACTGGCACCAGGCAGCCGG - Intronic
1129117721 15:73374636-73374658 CAGATCAAGGGCAATGCAGCTGG - Intergenic
1129322159 15:74781517-74781539 CAGAGCCGGGACCAGGCAGAGGG - Intergenic
1129669503 15:77599352-77599374 TAGGGCAAGGACCAGGCCACAGG - Intergenic
1130052412 15:80494905-80494927 CTAGGCAAGGAGCAGGCAGCAGG - Intronic
1130203912 15:81858325-81858347 CTGAGCTTGGACCAGGCAACTGG - Intergenic
1130532952 15:84761378-84761400 AAGAGCAAGGACCAGGGGGTCGG + Intronic
1130892050 15:88141689-88141711 CAGTGCAGGGACCAGACAGGAGG - Intronic
1131890849 15:96970010-96970032 AAGAGCAAGGGCCCTGCAGCAGG + Intergenic
1132737401 16:1393757-1393779 CGGAGCAAGGCCCAGGCAGTGGG + Intronic
1132872926 16:2123664-2123686 CACAGCAGGGCCCAGGCATCTGG + Intronic
1132973611 16:2700915-2700937 CAGGGCAGGGACCAAGCAGCTGG - Intronic
1133562716 16:6964841-6964863 CACAGCAAGGAGCTGGGAGCAGG - Intronic
1133988235 16:10684696-10684718 CATGACAAGGGCCAGGCAGCTGG - Intronic
1134176116 16:12007815-12007837 AAGAGCAAAGACAAGGCAGCTGG - Intronic
1134552016 16:15142843-15142865 CACAGCAGGGCCCAGGCATCTGG + Intergenic
1134692198 16:16198171-16198193 CAGAGCCAGGACCTGGCGGGTGG + Exonic
1135934963 16:26771757-26771779 CAGAGCAAGGAGCAGGATGGAGG - Intergenic
1137690801 16:50425837-50425859 CAGAGCAGTGACCTGGGAGCCGG + Intergenic
1137697128 16:50468844-50468866 CAGAGAGAGGACTAGGGAGCCGG - Intergenic
1138608658 16:58105730-58105752 CAGAGGAGGGGCCAGGCTGCTGG - Intergenic
1139401256 16:66683713-66683735 CAGAGCATTGACCATCCAGCTGG - Intronic
1139742668 16:69048933-69048955 CAAAGCCAGGCCCAGGCAGATGG + Intronic
1140356021 16:74307484-74307506 AAGAGCAAGACCCAGGCATCGGG + Intergenic
1141080297 16:81045481-81045503 CTGACGAAGGTCCAGGCAGCAGG - Exonic
1141651833 16:85396998-85397020 CAGAGCAAGGACCAAGAGACGGG + Intergenic
1142693640 17:1621524-1621546 CAGAGCAAACAACAGGCAGGAGG + Intronic
1142824101 17:2496882-2496904 AAGAGCAAGGCCCTGGCATCTGG - Intronic
1143483835 17:7242143-7242165 CAGCGCAGGGATCAGGCTGCTGG - Intronic
1143689125 17:8545916-8545938 CAGCACAAGGACAAGGCGGCAGG + Intronic
1144157428 17:12520045-12520067 CATAGCACGCACCAGGCTGCAGG - Intergenic
1145255146 17:21318263-21318285 CAGCGCAGGCAGCAGGCAGCAGG + Intergenic
1145286056 17:21506657-21506679 CAGCTCACTGACCAGGCAGCGGG + Intergenic
1145321460 17:21769692-21769714 CAGCGCAGGCAGCAGGCAGCAGG - Intergenic
1145391550 17:22459634-22459656 CAGCTCACTGACCAGGCAGCGGG - Intergenic
1147046444 17:37755611-37755633 CAGAGCGGGGACATGGCAGCTGG + Intergenic
1147140577 17:38458536-38458558 CAGGGCAAGGACCTTGCAGGTGG + Intronic
1147937788 17:44023536-44023558 CAGAGCAAGGTCAAGGCAGCTGG - Intronic
1148047566 17:44753446-44753468 CTGGGCAAGGGCCAGGGAGCCGG + Intergenic
1148119137 17:45197513-45197535 CAGAAAAAGGCCCAGGCAGGGGG + Intergenic
1149307036 17:55357992-55358014 GAGAGCAATGAAGAGGCAGCTGG + Intergenic
1150305767 17:64084078-64084100 CAGAGAAAGGACCCGGGAGAGGG - Intronic
1151915008 17:77111482-77111504 CAGTGCAAGCAGCCGGCAGCCGG + Intronic
1151940033 17:77286591-77286613 CAGCCCAAGGACCAGGTAGGGGG - Intronic
1152034308 17:77862595-77862617 CAGAGGATGGGCCAGACAGCAGG - Intergenic
1152218184 17:79046604-79046626 CAGCGCAAGCACCGGGAAGCAGG - Exonic
1152757934 17:82094858-82094880 CAGAGCGAGGGCCAGGCTGGCGG + Intronic
1153797284 18:8635592-8635614 CAGAGAAATCACCAGGCAGCAGG + Exonic
1153959360 18:10127569-10127591 AAGAGCCTGGACCAGGCGGCAGG - Intergenic
1157175566 18:45449012-45449034 CAGAGGAAGGTGCAGCCAGCAGG + Intronic
1157413820 18:47485653-47485675 CACTGCAATGACCAGGCAGATGG - Intergenic
1157908969 18:51597330-51597352 TAGAGCCAGAGCCAGGCAGCAGG - Intergenic
1158124886 18:54090322-54090344 CATAGCAAGGAACAGTCTGCAGG + Intergenic
1158588576 18:58761382-58761404 CACAGCAAGGGCCAGGCCACAGG + Intergenic
1160321965 18:77905141-77905163 CAGAGCAAGGCCCTGGCTGGTGG - Intergenic
1160722705 19:604415-604437 CTGAGCAGGGTCGAGGCAGCAGG + Intronic
1160731355 19:643010-643032 AGGAGCAAGGAGCAGGCAGAGGG - Intronic
1160793316 19:932912-932934 CAGAGCAATGAACAGCCAGCTGG - Intronic
1160847233 19:1171998-1172020 CAGAGCACAGAAGAGGCAGCAGG - Intronic
1161266931 19:3368419-3368441 CAGGGCAAGGACCAGCCAGGAGG + Intronic
1161608052 19:5225609-5225631 CAGAGGGTGCACCAGGCAGCTGG - Intronic
1162032404 19:7923176-7923198 AAGGGGAAGGACCTGGCAGCAGG - Exonic
1162453494 19:10768650-10768672 CAACGCAAGGACCAGGAAACGGG - Intronic
1163623184 19:18372863-18372885 CACAGCAAGGATCAGGCAGCTGG + Intergenic
1163717723 19:18881637-18881659 CAGAGCAAGGAACAGGGACTTGG - Intronic
1164083352 19:21879660-21879682 GAGGGCAAGGACCAGGTAGAAGG - Intergenic
1164171303 19:22727963-22727985 GAGAGCAGGGACCAGGCAGGAGG - Intergenic
1164896654 19:31882859-31882881 GTGAGCAAGGAGAAGGCAGCTGG - Intergenic
1165049148 19:33130627-33130649 CAGAGCCAGGGCCTGGCAGGGGG + Intergenic
1166674679 19:44732702-44732724 CAAAGGGAGGACCAGGCAGGAGG + Intergenic
1167806082 19:51786731-51786753 CAGAGCAAGGACCCAGCTGGTGG - Intronic
1168354069 19:55691427-55691449 CCGGGCAAGGACCTGGGAGCAGG + Intronic
926707234 2:15845500-15845522 CAGGGCCAGGACCAGGGAGCAGG + Intergenic
927216508 2:20670572-20670594 CAGAGTCGGGCCCAGGCAGCTGG + Exonic
927636190 2:24819010-24819032 AAGAGACAGGGCCAGGCAGCAGG + Intronic
928243869 2:29610305-29610327 CAGAGCAAAGGACAAGCAGCCGG - Intronic
928859466 2:35839455-35839477 CATTGCAAGGACAAGGCTGCAGG - Intergenic
928881146 2:36097804-36097826 CAGAGGAACGATCAGACAGCAGG + Intergenic
929547360 2:42864326-42864348 GGGAGCAAGGGCCAGGCACCTGG - Intergenic
930755154 2:54966084-54966106 TAGAGCAAGCTCCAGGAAGCAGG - Intronic
932356455 2:71071975-71071997 CAGAGCAAGGACCAGGCAGCAGG + Intronic
932621832 2:73269341-73269363 CAGGGCAAGGAGCAGGCGGCCGG - Exonic
932641647 2:73453495-73453517 CAGAGGAAAGCCCAAGCAGCAGG + Exonic
932909301 2:75789085-75789107 CTGAGCAAGCCCCAGGCTGCTGG + Intergenic
936065471 2:109328876-109328898 CAGAGCATGGAGAAGGCAACTGG - Intronic
936934021 2:117820471-117820493 CAGAGCTAGGAGCAGTCTGCTGG + Intronic
937252618 2:120534120-120534142 CAGGGCTGGGAGCAGGCAGCTGG - Intergenic
937285891 2:120750931-120750953 CAGAGCAAGGTAGAGGCAGGCGG - Intronic
937299610 2:120831213-120831235 CAGAAGAAGGGCCAGGCATCGGG - Intronic
937362206 2:121237231-121237253 CAGAGCCACGACCTGGGAGCTGG - Intronic
938246483 2:129781257-129781279 CAGAGCCAGGACCATTCAGGGGG - Intergenic
941276672 2:163498469-163498491 CAGAGGAAGGAACAGGCAGCAGG + Intergenic
941602402 2:167559116-167559138 CAGAGGAACGATCAGACAGCAGG + Intergenic
941674449 2:168328827-168328849 CAGAGCAATGCCCAGGCTACTGG - Intergenic
941845101 2:170124473-170124495 TAGAGCAATGACCAGAAAGCAGG - Intergenic
942063189 2:172247056-172247078 CAGAGGCAGGACCATGCACCAGG - Intergenic
942212825 2:173688805-173688827 CAGAGGCAGGACCAGCCAGCTGG + Intergenic
943483643 2:188454038-188454060 CTGAGCAAGGCTCAGGCAGCAGG - Intronic
944213159 2:197227348-197227370 TAGAGCAGGGACCTGGAAGCAGG + Intronic
945987243 2:216364691-216364713 CAGAGCTTGGACAAGCCAGCAGG + Intronic
946931468 2:224675702-224675724 GAGAGCAAGGAGAAGGCAGAGGG + Intergenic
948028839 2:234800144-234800166 CAGAGCAAGGAGGATGGAGCTGG + Intergenic
948290581 2:236821236-236821258 CAGAGGAAGGAACAGCCAGGGGG + Intergenic
948824757 2:240568759-240568781 CAGCTCGAGCACCAGGCAGCCGG - Exonic
948846105 2:240683495-240683517 CACAGCCAGGAGCAGGGAGCAGG - Intergenic
1169135181 20:3192953-3192975 CAAAACAGGGATCAGGCAGCGGG + Intronic
1169206057 20:3740920-3740942 CAGAGCAGGGACCAGGTGGTGGG + Intronic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1172388144 20:34548230-34548252 CAGAGCCTGGACCTGACAGCTGG + Intronic
1172590576 20:36114885-36114907 CAGAGCTAGCACCAGACACCGGG + Intronic
1172697984 20:36835477-36835499 CAGGGCATGGACCACGGAGCTGG + Intronic
1172765982 20:37351129-37351151 CAGAGCAAGGAGTAGGGAGATGG - Intronic
1173280207 20:41620314-41620336 CTGAGGTAGGACCAGGCAGCTGG + Intergenic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173849398 20:46208343-46208365 CAGAGCAGGGATGGGGCAGCTGG - Intronic
1174237000 20:49102326-49102348 AAGAGCAAGGACCAAGCAGGAGG - Intergenic
1174376752 20:50131115-50131137 CACAGCAAGTAACAGGCAGGAGG - Intronic
1174417098 20:50374732-50374754 GAGAGCAGGGAGGAGGCAGCAGG - Intergenic
1174634878 20:51990357-51990379 CAGAGGAAGACCCAGGAAGCTGG - Intergenic
1175397585 20:58677369-58677391 CTGAGCAATGCCCAGGAAGCAGG + Exonic
1175768785 20:61609646-61609668 CTGAGCCTGAACCAGGCAGCAGG + Intronic
1175928590 20:62482672-62482694 CATAGCCTGGCCCAGGCAGCTGG + Intergenic
1176098941 20:63356294-63356316 CAGGGCCAGGACAGGGCAGCAGG + Intronic
1176115430 20:63429961-63429983 TGGAGCAGGAACCAGGCAGCTGG + Intronic
1176372015 21:6067852-6067874 CAGAGAATGGACCTGGCTGCTGG + Intergenic
1177350417 21:19932173-19932195 AACAGCAAGGACCAGGGAACTGG + Intergenic
1178393003 21:32214775-32214797 CAGGGCAAGGGCCGGGCTGCAGG - Intergenic
1179269212 21:39836846-39836868 CAGAGGAAGGACCCTGCACCTGG + Intergenic
1179354755 21:40648990-40649012 CTGAGCAAGGCCCAGGCAGGGGG + Intronic
1179751504 21:43470687-43470709 CAGAGAATGGACCTGGCTGCTGG - Intergenic
1179781182 21:43702127-43702149 GAGAGCACCCACCAGGCAGCAGG + Intergenic
1180572532 22:16741306-16741328 AAGAGCAAGGAACAAGTAGCAGG - Intergenic
1180730114 22:17974963-17974985 CAGAGCTGGGCCCAGGCAGCTGG + Intronic
1180867818 22:19129543-19129565 CACTGCAAAGACCAGGCACCTGG - Intergenic
1180985902 22:19903777-19903799 CAGAGCAAGCCCCCGGCAGGTGG - Intronic
1181891087 22:26064156-26064178 CAGAGCACGGAGCATGAAGCAGG + Intergenic
1182261824 22:29078427-29078449 CAGAGGAAAGCCCAGGCAGCAGG + Intronic
1183109916 22:35641456-35641478 CAGCCAAAGGACCAGGCAGATGG + Intergenic
1183937359 22:41270836-41270858 CAGGGCCAGGAACAGGCAGCCGG + Intronic
1184482166 22:44754079-44754101 GAGGGCAGGGACCAGGCAGCTGG - Intronic
1184558775 22:45248892-45248914 CACAGCCATGACCAGGCAGGAGG - Intergenic
1184799087 22:46749170-46749192 CAGAGAAAGCAGCAGGCAGTCGG - Intergenic
1185045629 22:48527402-48527424 CAGGGCAAGGCCAGGGCAGCAGG + Intronic
1185349556 22:50327326-50327348 CAGAGCAAGCTGCAGCCAGCCGG + Intergenic
949534766 3:4987135-4987157 CAGAACTAGGGCCTGGCAGCGGG + Intergenic
950486437 3:13276659-13276681 CAGAGCAAGGCCAAGGCTGATGG + Intergenic
950540400 3:13609072-13609094 CAGAGCCAGGACAGGGCGGCGGG - Intronic
950857829 3:16121897-16121919 GACAGCAAGGACCAGGCATGAGG + Intergenic
952272751 3:31848639-31848661 CAGAGCAGGGAACAGGCATGTGG - Intronic
952275554 3:31872299-31872321 CAGAGCAAGGACAAGAAAGCAGG + Intronic
952612396 3:35226606-35226628 CAGAGGAACGATCAGGCGGCAGG + Intergenic
952880216 3:37980711-37980733 CAGTGCATGGAGGAGGCAGCAGG - Intronic
953852002 3:46471623-46471645 CGGAGAAAGGAGCAGGGAGCGGG + Intronic
954444853 3:50541086-50541108 CAGGGCAAGGACTAGGCTGCTGG + Intergenic
954596194 3:51826997-51827019 CAGAAGAATGACCAGGCAGCAGG + Exonic
954619527 3:51987574-51987596 CAGAGCTGGTGCCAGGCAGCTGG + Exonic
956678480 3:71755707-71755729 CAGCACAAGGACCCTGCAGCCGG - Exonic
957105154 3:75877585-75877607 AAGAGCAAGGAACAAGTAGCAGG + Intergenic
957185822 3:76939956-76939978 CAGAGGAAGGACAAAGCAACAGG + Intronic
957685182 3:83494798-83494820 CAGAAAAAGGAACAGTCAGCAGG + Intergenic
958675660 3:97265529-97265551 CAGAGCAAGGACCAGGAGTAGGG + Intronic
959907636 3:111728314-111728336 CAGTGGAAGGTCAAGGCAGCTGG + Intronic
960254688 3:115499353-115499375 CAGGGCAAGGAAAAGGCAGTGGG + Intergenic
960986670 3:123285552-123285574 GAGTGCAAGTGCCAGGCAGCAGG + Intronic
961432436 3:126892539-126892561 CAGAAGAAGAACCACGCAGCAGG - Intronic
961450489 3:127000218-127000240 CAGAGCAAGGAGGTGACAGCTGG + Intronic
961771506 3:129253526-129253548 CAGAGAAATAACCAGGCATCAGG + Intronic
962851868 3:139314107-139314129 CAGAGGAGAGACCAGGCTGCGGG + Intronic
963007500 3:140739630-140739652 CAGAGAAAAAGCCAGGCAGCAGG - Intergenic
963742077 3:149090479-149090501 GGGGGCAGGGACCAGGCAGCAGG + Intergenic
963916352 3:150862115-150862137 CAGAGCCTGGAGCAGGCAGCAGG - Intergenic
964674872 3:159266907-159266929 CAAAGCAAGGCCCAAGCAGGAGG - Intronic
964708758 3:159648747-159648769 CACAGCTAGAACCAGGCTGCTGG - Intronic
964741854 3:159974881-159974903 GAGGGCAAGGACCAGACAGCAGG - Intergenic
965696620 3:171415071-171415093 CTGAGAAAGAGCCAGGCAGCGGG - Intronic
967672598 3:192256092-192256114 CAGGACAAGGACCAACCAGCTGG - Intronic
968951951 4:3699952-3699974 CACAGCCAGGAGCAGGCTGCAGG - Intergenic
969074743 4:4569075-4569097 TAGAGCAAGGCACAGGGAGCGGG - Intergenic
970487196 4:16536518-16536540 CAGACAAAGGACCTGGCAGCTGG + Intronic
972345425 4:38188725-38188747 CTGAGCAAGGATCAGGATGCAGG - Intergenic
973579804 4:52331853-52331875 CAGACCAATAACCAGGTAGCAGG - Intergenic
974699164 4:65416951-65416973 CTGACCAAGGACTTGGCAGCAGG - Intronic
977922768 4:102663922-102663944 TAGAGCAAGGGCCATACAGCGGG + Intronic
978264082 4:106801346-106801368 CAGAGAAAGTGCCAGCCAGCAGG - Intergenic
979147792 4:117267209-117267231 AAGAGAAGGGACAAGGCAGCAGG + Intergenic
981404043 4:144346378-144346400 TAGAGACAGGCCCAGGCAGCTGG - Intergenic
984498642 4:180531225-180531247 CAGAGCAGAGACCAGTCTGCTGG + Intergenic
985682173 5:1261797-1261819 CAGAGCAAGGGCCCCGGAGCAGG + Intronic
985704853 5:1394401-1394423 CAGAGCCGGGAGCAGGGAGCAGG + Exonic
985781122 5:1872353-1872375 CAGAGCAGGGGCCAGGCCACGGG - Intergenic
985996380 5:3599534-3599556 CGCAGCAAGGACCAGGAAGATGG + Exonic
986249954 5:6046381-6046403 GGGAGCAAGGCCCTGGCAGCTGG - Intergenic
986365345 5:7023198-7023220 CAGAGGAATGCACAGGCAGCTGG - Intergenic
986760628 5:10876677-10876699 CTGAGCCAGGACCAGGGAGGAGG - Intergenic
988066485 5:26232730-26232752 AAGAGCAGCGACCAGGCAGCGGG + Intergenic
990242041 5:53825494-53825516 CAGAGCAGGGAACAAACAGCAGG - Intergenic
992104045 5:73436100-73436122 GAAAGCAAGGACCGGGCAACAGG + Intergenic
992541835 5:77773733-77773755 CAGAGGAAGGACCAGGCAAAAGG - Intronic
995294111 5:110498767-110498789 CAGAGCAAGTCCCAGAAAGCAGG + Intronic
995508006 5:112880480-112880502 GAGAGCAACTATCAGGCAGCTGG - Intronic
997015121 5:129923694-129923716 CAGATCAAGAACTAGGCAGAAGG + Intronic
998147760 5:139739993-139740015 CTGAGCTAGGACCAGCTAGCTGG + Intergenic
998804402 5:145904504-145904526 CAGAGCCAAGTCCAGGCTGCAGG - Intergenic
999056558 5:148584313-148584335 CAGAGCCAGGACTAGACAGATGG + Intronic
999616689 5:153432535-153432557 CAGAGCTAGGACTAGACATCTGG - Intergenic
1000264225 5:159619469-159619491 CAGAGCAAGGACCCGGGGGCAGG - Intergenic
1000607721 5:163342452-163342474 CAGAGGAAGAACCAGGCAGATGG - Intergenic
1001273422 5:170332643-170332665 CAGAGGAAGCCCCAGGTAGCAGG + Intergenic
1001422660 5:171599385-171599407 CAGAGCCAGGAAATGGCAGCCGG + Intergenic
1002344093 5:178535982-178536004 CAGGGCAAGGGCCAGGCCCCGGG + Intronic
1002462099 5:179379071-179379093 CAGAACAAGAACCAGGATGCAGG - Intergenic
1002796041 6:471600-471622 TGCAGCAAGGCCCAGGCAGCGGG + Intergenic
1003568286 6:7239065-7239087 CACAGCAAGGGCCTGGCACCTGG - Intronic
1003980375 6:11384147-11384169 CAGTGGGAGGTCCAGGCAGCTGG - Intergenic
1004626712 6:17384075-17384097 CAGGCCCAGGAGCAGGCAGCAGG - Intergenic
1005067552 6:21833131-21833153 ATGAGCAAAGCCCAGGCAGCAGG + Intergenic
1005298516 6:24449305-24449327 CATAGCAGGGACCACGCATCCGG - Intronic
1005775789 6:29129840-29129862 CAGAGCGGGGCTCAGGCAGCAGG - Intergenic
1006076065 6:31533262-31533284 GAGAGCAAGGACCAAACATCTGG + Intronic
1006177189 6:32129394-32129416 CAAAGCCAGTACCCGGCAGCAGG + Exonic
1007194495 6:40048956-40048978 CTGAGCAATGCCCAGCCAGCAGG - Intergenic
1007252149 6:40503064-40503086 GAGAGCAAGGACAGGGCAGAGGG + Intronic
1007601314 6:43083364-43083386 CAGAAGAAGGACCAGGCAGATGG - Intronic
1007618916 6:43199656-43199678 GAGAGCAAGGCTCAGGCACCAGG + Intronic
1007629634 6:43265571-43265593 CACACCCAGCACCAGGCAGCAGG + Intronic
1008122396 6:47633500-47633522 AAGAGCAAGGGCCAGGCAAGAGG - Intergenic
1009535581 6:64878863-64878885 CAGAGCAATGACCAAGAGGCTGG - Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010482723 6:76374761-76374783 CAGAGGAACAATCAGGCAGCAGG - Intergenic
1010990086 6:82470311-82470333 CAGAGGAACAATCAGGCAGCAGG + Intergenic
1011570425 6:88728724-88728746 TAGAGGAAGGTACAGGCAGCGGG - Intronic
1012523646 6:100151016-100151038 CAGAGAAAGGAGCAGCTAGCAGG + Intergenic
1013670684 6:112399416-112399438 CTGAGCAAGGCCCTGGCAGAGGG - Intergenic
1014169936 6:118267471-118267493 CAGGGCTTGGGCCAGGCAGCTGG - Intronic
1014445243 6:121519226-121519248 CTTAGCAAGGATCACGCAGCTGG - Intergenic
1015471633 6:133612785-133612807 CAGAGGAAGGAGCATGCAGAGGG - Intergenic
1015898505 6:138039977-138039999 CAGAGCAAGTACCACACAGAAGG + Intergenic
1016937130 6:149455701-149455723 CAGAGTCAGGGCCAGGCAGGGGG + Intronic
1017656070 6:156631075-156631097 GAGAGCAAGGTCCAGGCACAGGG + Intergenic
1017869520 6:158475114-158475136 CAGAGTAAGGAACGGGCACCAGG + Intronic
1018211454 6:161486552-161486574 CAGAGCAAGGATCAGAATGCAGG + Intronic
1019365869 7:632501-632523 CAGTGCCATGACCCGGCAGCGGG - Intronic
1019594076 7:1850382-1850404 CTGAGCTGGGCCCAGGCAGCTGG - Intronic
1021808849 7:24382998-24383020 CAGGGCAAGTACAAGGAAGCAGG + Intergenic
1022043595 7:26604037-26604059 AAGAGCAAGGAGCAGGAATCTGG + Intergenic
1022230412 7:28408489-28408511 CAGAGCCAGGGCCAGACTGCAGG - Intronic
1022495485 7:30850483-30850505 GAGGGCCAGGACGAGGCAGCGGG - Exonic
1022510907 7:30934281-30934303 CAGAGCAAGGACAGGTGAGCTGG - Intergenic
1022596572 7:31718743-31718765 CAGGGCACAGACCTGGCAGCTGG + Intergenic
1022637298 7:32148732-32148754 CAAAGCAATGACCTGGGAGCTGG - Intronic
1024472181 7:49775491-49775513 CAGAGCCACCATCAGGCAGCAGG - Exonic
1024618930 7:51140684-51140706 CAGATCTAGCACCAGGCAGCAGG + Intronic
1024926347 7:54619282-54619304 CAGAGCTAGCACCAGAAAGCTGG + Intergenic
1025223127 7:57133164-57133186 CAGGGCAGGGACCGGGCAGGAGG + Intronic
1025633926 7:63304830-63304852 CAGGGCAGGGACCGGGCAGGAGG + Intergenic
1025648771 7:63443338-63443360 CAGGGCAGGGACCGGGCAGGAGG - Intergenic
1025782640 7:64615462-64615484 GAAAGCAAGGACCAGGCAGGAGG - Intergenic
1026181532 7:68045359-68045381 CAGACCACGGACCAGGTACCAGG + Intergenic
1026871091 7:73852266-73852288 CAGAACAAGATCCAGGCAGGAGG - Intergenic
1026876709 7:73883431-73883453 CTGGGCAAGACCCAGGCAGCTGG + Intergenic
1027231353 7:76274499-76274521 TGGATCATGGACCAGGCAGCGGG - Intronic
1027819988 7:83030549-83030571 AAGAGAAAGGACCATGCAGCAGG + Intronic
1028585476 7:92447578-92447600 CGGTGAAAGGACCAGGCCGCTGG - Exonic
1028887716 7:95952780-95952802 CAGAGGAAGGACGAGGCAGAGGG - Intronic
1029170724 7:98627550-98627572 GACAGCAAGGGCCAGGCTGCGGG - Intronic
1029690024 7:102175181-102175203 CAGAGTGGGGACCGGGCAGCGGG - Intronic
1030891554 7:115005223-115005245 CAGAGCCAAGACCAGAAAGCTGG + Intronic
1032086289 7:128885498-128885520 AAGACCAAGCTCCAGGCAGCAGG + Intronic
1032516589 7:132510666-132510688 GAGGGCAAGGAGCAGGCTGCAGG + Intronic
1032738494 7:134714366-134714388 CAGAGGAAGGACAAGTCGGCTGG - Intergenic
1032839721 7:135704265-135704287 CAGAGCAAGGCCCTGCCATCAGG + Intronic
1034556640 7:151854537-151854559 CCTGGCAAGGGCCAGGCAGCGGG + Intronic
1035076512 7:156181101-156181123 CAGAGCAAGGAGCTGGCCGCGGG - Intergenic
1035076518 7:156181142-156181164 CAGAGCAAGGAGCTGGCTGCAGG - Intergenic
1035214669 7:157356341-157356363 CAGAGCAGGCAACAAGCAGCAGG - Intronic
1036739632 8:11348531-11348553 GAGAGCACGGACCAGCCAGGGGG - Intergenic
1036916824 8:12812106-12812128 CAGAGCAAGGATCTGGCAATCGG + Intergenic
1037911732 8:22747757-22747779 AACAGCCAGGGCCAGGCAGCGGG - Intronic
1038459203 8:27702377-27702399 CAGTGCCAGGACTGGGCAGCGGG - Intergenic
1038780989 8:30568400-30568422 CAGAGTGAGGGGCAGGCAGCGGG + Intronic
1040331502 8:46388058-46388080 CAAAGCAAAAACCGGGCAGCAGG + Intergenic
1041311229 8:56518922-56518944 CTGAGCAAGGACCAGCCCCCAGG - Intergenic
1041803589 8:61825619-61825641 CAGAGAAAGGACAAGGCATGGGG - Intergenic
1042689960 8:71486658-71486680 CAGAGCCAAGACCTGACAGCAGG + Intronic
1042876923 8:73448756-73448778 CAGAGCAACGACAATCCAGCTGG + Intronic
1042877431 8:73452032-73452054 CAGAGCAAGGAGCTGGGTGCAGG + Intronic
1044785006 8:95784054-95784076 CAGAGCTAGGACTTGGCATCTGG - Intergenic
1045105388 8:98887760-98887782 CAGAGCAAGGAGCAGTCAGCAGG + Intronic
1045544016 8:103112081-103112103 CAGAGCAAGGGACGGGCAGAGGG + Intergenic
1045655326 8:104381209-104381231 CACAGCAGGGACCAGGAAACAGG - Exonic
1046672245 8:117068902-117068924 AATAGCAAGGACCAGGCTGTTGG - Intronic
1047421046 8:124708509-124708531 CAGACCAAGGCAAAGGCAGCTGG + Intronic
1048319863 8:133390033-133390055 CACAGCAGGCAGCAGGCAGCAGG + Intergenic
1048942938 8:139418288-139418310 CAGAGCAAGGTCCAGGAAAGGGG - Intergenic
1049204476 8:141357324-141357346 CAGCGCAAAGACACGGCAGCAGG + Exonic
1049392705 8:142380356-142380378 CAGAGCAGGGAGGACGCAGCTGG + Intronic
1051401390 9:16687329-16687351 TAGACCAAGGAGCAGGTAGCAGG - Intronic
1053027811 9:34745111-34745133 TAGAGCAAGGAGCAGCCAGCTGG + Intergenic
1053377956 9:37624162-37624184 TAGAGCAAGGGCCACCCAGCAGG + Intronic
1055737007 9:79341353-79341375 CAGTGCTTGGACCAGGAAGCAGG - Intergenic
1056255492 9:84795230-84795252 AACAGCAAAGACCTGGCAGCAGG - Intronic
1057165884 9:92925151-92925173 CAGAGCAGAATCCAGGCAGCTGG - Intergenic
1057518608 9:95742245-95742267 CAGAGCAAGGACATGTCACCAGG + Intergenic
1057596598 9:96419399-96419421 CAGAGGAAGGACCGGGCGGAGGG + Intergenic
1060736205 9:126067960-126067982 CAGAGCAAGGAGAGGGGAGCAGG + Intergenic
1060939816 9:127536785-127536807 CAGAGCTAGGACCAGGAGGGTGG - Intronic
1060977024 9:127770866-127770888 AAGAGCATGGGCCAGGAAGCTGG + Intronic
1061519915 9:131111884-131111906 CAGGGCCAGGACCGGGCTGCAGG - Intronic
1061852441 9:133424024-133424046 CAGAGCAGGGTCCAGGAGGCAGG + Intronic
1061924568 9:133799609-133799631 CAGCCCAAGCACCAGGCAGGAGG - Intronic
1061941621 9:133887085-133887107 CAGAGGAGGGCCCAGACAGCAGG + Intronic
1062126949 9:134869110-134869132 CAGAGCAGGGGCCAGGCGGCCGG - Intergenic
1062286630 9:135775961-135775983 CAGAGCAGGGACCAGTGACCTGG + Intronic
1062410373 9:136421116-136421138 CGGCGCAGGGCCCAGGCAGCTGG - Intronic
1062579589 9:137223394-137223416 CCGAGGAAGCACCAGGCCGCAGG + Intergenic
1062597618 9:137306256-137306278 CAGAGTAAGGAGCAGGCTTCGGG - Intergenic
1185481021 X:446367-446389 CACAGCATGGCCGAGGCAGCAGG + Intergenic
1185501522 X:600248-600270 CAGGGCAATGAGCAGGCAGGGGG - Intergenic
1186993007 X:15089204-15089226 CAGAGGAACGATCAGGCAGCAGG + Intergenic
1187785761 X:22884131-22884153 CAGAGCAAGGATCAGCAACCTGG - Intergenic
1188545858 X:31306039-31306061 CAGAGGAAGTCCCAGGTAGCTGG + Intronic
1189254299 X:39625629-39625651 AATACCAAGGACAAGGCAGCAGG + Intergenic
1190375572 X:49785340-49785362 CAGGGCAGGGTCCAGGCAGGGGG - Intergenic
1191874941 X:65787071-65787093 CAGAGAAAGGACCAGGTTTCAGG + Intergenic
1192193673 X:69014782-69014804 CAGAGCTAGGACCAGGACCCAGG - Intergenic
1192528221 X:71866376-71866398 CAGAGCAAGGAGCAGAAGGCTGG - Intergenic
1192673975 X:73175512-73175534 CATAGGAAGGATCAGGCAGTGGG + Intergenic
1193582675 X:83285171-83285193 CAGAGGAATGATCAGGCAGCAGG - Intergenic
1194128214 X:90046209-90046231 CAGAGAAAGCACCAACCAGCAGG + Intergenic
1194665276 X:96670904-96670926 AAGATCAAGGACCTGGCACCAGG - Intergenic
1195045305 X:101050036-101050058 CAGAGGAGGGACAAGGAAGCTGG + Intronic
1195666634 X:107437342-107437364 CAGAGAAAGCACAAGGCAGGAGG - Intergenic
1197147781 X:123188168-123188190 CAGAGAAAGCAACAGGCAGCTGG - Intronic
1198450931 X:136766999-136767021 CAGAGAACGGACCCCGCAGCTGG + Intronic
1198494184 X:137174174-137174196 AACAGCAAGGATCAGACAGCAGG - Intergenic
1198640958 X:138756252-138756274 CAGAGAAAAGAGAAGGCAGCTGG + Intronic
1202263813 Y:22997275-22997297 CTGAGCAAGGCTCAGGCAGGAGG - Intronic
1202416804 Y:24631017-24631039 CTGAGCAAGGCTCAGGCAGGAGG - Intronic
1202453983 Y:25039069-25039091 CTGAGCAAGGCTCAGGCAGGAGG + Intronic