ID: 932356565

View in Genome Browser
Species Human (GRCh38)
Location 2:71072630-71072652
Sequence GCACAACTCCACCTGGGGAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 1, 2: 1, 3: 9, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932356565_932356570 -7 Left 932356565 2:71072630-71072652 CCTTTCCCCAGGTGGAGTTGTGC 0: 1
1: 1
2: 1
3: 9
4: 178
Right 932356570 2:71072646-71072668 GTTGTGCTCATATCTGGAACAGG 0: 1
1: 0
2: 0
3: 6
4: 86
932356565_932356571 6 Left 932356565 2:71072630-71072652 CCTTTCCCCAGGTGGAGTTGTGC 0: 1
1: 1
2: 1
3: 9
4: 178
Right 932356571 2:71072659-71072681 CTGGAACAGGCTCCAACTGCAGG 0: 1
1: 0
2: 1
3: 7
4: 169
932356565_932356573 23 Left 932356565 2:71072630-71072652 CCTTTCCCCAGGTGGAGTTGTGC 0: 1
1: 1
2: 1
3: 9
4: 178
Right 932356573 2:71072676-71072698 TGCAGGCTCATCAACCCTGATGG 0: 1
1: 0
2: 0
3: 9
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932356565 Original CRISPR GCACAACTCCACCTGGGGAA AGG (reversed) Exonic
902292975 1:15447109-15447131 GGACAACCACTCCTGGGGAAGGG + Intronic
903622965 1:24711403-24711425 GCATAACTCTACCTGCTGAATGG - Intergenic
905205160 1:36339248-36339270 GCTGAACTCCATCTGGGGTAGGG - Intergenic
905298305 1:36968691-36968713 CCACAGCTCCACGTGGGGCAAGG + Intronic
908989591 1:70070591-70070613 ACACCACTCCAGTTGGGGAAGGG + Intronic
909050029 1:70755241-70755263 GGACAACTCCAAGTGGGGAGGGG - Intergenic
916665822 1:166966478-166966500 GCAAAAATCCACCTGGGCAGTGG - Intronic
917733231 1:177897390-177897412 ACAAAACCCCAGCTGGGGAAGGG + Intergenic
919309956 1:195894713-195894735 GCACAAGGCCAGCTGGAGAATGG + Intergenic
920618856 1:207524190-207524212 GCAAAGCTCAACCTGGGCAAGGG + Intronic
920620635 1:207542758-207542780 GCAAAGCTCAACCTGGGCAAGGG + Intronic
920622417 1:207561315-207561337 GCAAAGCTCAACCTGGGCAAGGG + Intronic
921230667 1:213067070-213067092 GGACAACTCGACGTGGGGAGGGG - Intronic
922932889 1:229403889-229403911 GCACACCTGCCCCTCGGGAAAGG + Intergenic
1064520015 10:16191021-16191043 ACCCAATTCCACCTGGGGTAGGG + Intergenic
1065322718 10:24524155-24524177 GCACAACTGCACCAGCAGAAAGG + Intronic
1065490892 10:26280438-26280460 GGACAACTCGAACTGGGGAGGGG + Intronic
1066088660 10:31996192-31996214 CCACAAGGCCATCTGGGGAAGGG - Intergenic
1066569356 10:36754302-36754324 GCAAAACTCCATCTAGAGAAAGG + Intergenic
1069346206 10:67472913-67472935 GATCAACTCCATTTGGGGAAAGG - Intronic
1070171881 10:73939180-73939202 GGACAACTCAAAATGGGGAATGG - Intergenic
1070495148 10:77014900-77014922 GCACACCTGCACCTGAGCAACGG + Intronic
1073765562 10:106678801-106678823 TCAGAACACCACCTGGGTAATGG + Intronic
1074054091 10:109906534-109906556 GCACAACTCCAGATTGTGAATGG - Intronic
1076147174 10:128132275-128132297 CCAGAGCTCCACCTGGGGATTGG - Intergenic
1076169852 10:128309936-128309958 CCATATCTCCACCTGGGGACAGG + Intergenic
1076406334 10:130214566-130214588 GTACAACTCCCCCTGGAAAATGG - Intergenic
1076469746 10:130710180-130710202 CCTCAACCCCACCTGGGGAGGGG - Intergenic
1076561814 10:131371864-131371886 AGGCAACACCACCTGGGGAAAGG - Intergenic
1078014241 11:7599536-7599558 GCCCAGCACCACCTGGGGAGAGG + Intronic
1078187947 11:9068315-9068337 ACAAAACTCCACCTGGGAACAGG - Intronic
1081043095 11:38235869-38235891 GCACATCTCCACATGGTGACAGG - Intergenic
1082036958 11:47652764-47652786 GGACAACTCAAACTGGGGAGAGG - Intergenic
1083055642 11:59816490-59816512 GTACAACTCAAAGTGGGGAAGGG + Intergenic
1083621760 11:64052816-64052838 GCAGAACCCCACCTGGGCAAAGG - Intronic
1083927179 11:65815064-65815086 GGCCAAGTCAACCTGGGGAAGGG - Intergenic
1085273596 11:75284268-75284290 GGACCACACCATCTGGGGAAAGG + Exonic
1087146599 11:94819588-94819610 GGACAACTCCAAGTGGGGGAAGG - Intronic
1089217591 11:116844225-116844247 GCACTGCTTCAACTGGGGAAAGG + Intronic
1089340154 11:117751811-117751833 GCTCAACTCCACTTGGGAGAGGG - Intronic
1089508369 11:118979807-118979829 GCACAAATGCACCTGGGAAAAGG - Intronic
1090405745 11:126474994-126475016 GCCCAGCTCCTCCTGGGGTAAGG - Intronic
1090963659 11:131579736-131579758 GCAGGGCTTCACCTGGGGAAGGG + Intronic
1100403935 12:94256530-94256552 GCAGAACACCGCCTGGGGAAAGG + Intronic
1103613038 12:122135591-122135613 GCGCAAGACCCCCTGGGGAAGGG + Exonic
1103647510 12:122406052-122406074 GCAAGACTCCATCTGGGGGATGG + Intronic
1103675580 12:122653127-122653149 GCTCTACTCCACATGGAGAAAGG - Intergenic
1104608444 12:130206840-130206862 GCACAACTCAAGTTGGGGTAAGG - Intergenic
1108379562 13:49843104-49843126 GCACAACTCAAAGTGGGGAGAGG - Intergenic
1113610624 13:111642399-111642421 TCCCAGCTCCACCTGAGGAAAGG - Intronic
1117499413 14:56337446-56337468 TCACATTTCCACCTTGGGAAGGG - Intergenic
1118510408 14:66465727-66465749 GGACAACTCCAAGTGGGGAGGGG - Intergenic
1121438940 14:93936731-93936753 GCACAGTCCCACCTGGGGACAGG + Intronic
1121657006 14:95604621-95604643 GCACAGCTACACATGGGGCAGGG - Intergenic
1124033108 15:26029206-26029228 GGACAACTCCAAGTGGGGAGGGG + Intergenic
1124884520 15:33672410-33672432 TCATAACTCCTCCTGTGGAAGGG - Intronic
1124939978 15:34209630-34209652 CGACAGCTGCACCTGGGGAAGGG - Intronic
1129701204 15:77769552-77769574 GCCCAGCTCAACCTGGGGTATGG - Intronic
1130941168 15:88510500-88510522 ACACAACTTCTCCTGGGTAATGG + Intergenic
1132524039 16:405486-405508 GCACAAAGCCACCAGTGGAAAGG - Intronic
1132975651 16:2709942-2709964 CCACAACTCTACCTGGTCAAGGG - Intergenic
1133201720 16:4207833-4207855 AGTCACCTCCACCTGGGGAAAGG - Intronic
1136268031 16:29132205-29132227 GCACTACTTCTCCTGGGGAATGG - Intergenic
1137586539 16:49667182-49667204 GCACAACTGCCCCTTGGGATAGG - Intronic
1138296656 16:55891541-55891563 GGACAACTCAAAGTGGGGAAGGG + Intronic
1138494911 16:57402224-57402246 GCACAATGCCACCTGGGTCATGG - Intergenic
1141090660 16:81128261-81128283 GCACAACTTCTCTTAGGGAATGG + Intergenic
1142071338 16:88092543-88092565 GCACTACCTCTCCTGGGGAATGG - Intronic
1142702861 17:1674781-1674803 GCACAACTCCGCCTCGGGAGTGG - Intronic
1143586487 17:7853199-7853221 AAACACCTCCACCTGGGGCAGGG - Exonic
1144780836 17:17807643-17807665 GCACCACCCCACATGGGGCACGG - Intronic
1146627247 17:34444017-34444039 GCAGAACTGCACCTGGGGTGAGG - Intergenic
1147606227 17:41775305-41775327 CCAGAACTCCTCCTGAGGAAGGG + Intronic
1147958673 17:44152841-44152863 GCCCTACTCCACCTTAGGAAGGG + Intronic
1148647768 17:49229204-49229226 GCCAAATTCCAACTGGGGAAGGG - Intronic
1148797317 17:50203256-50203278 GCACAAAACCAGCTGGGGGAGGG - Intergenic
1150805668 17:68316895-68316917 CTACAGCTCAACCTGGGGAAGGG - Intronic
1151365101 17:73611911-73611933 GCCCAACTCTGCGTGGGGAAGGG + Intronic
1152135862 17:78503000-78503022 CCACACTTCCACCTGGGGACGGG + Exonic
1152207817 17:78984532-78984554 GGACAACTCCAAGTGGGGAGGGG - Intergenic
1152294358 17:79457975-79457997 GCACAACCTCACCTGGGCCAGGG + Intronic
1159025570 18:63179621-63179643 TCCCAACTCCACCTAGGGGAGGG + Intronic
1159960877 18:74555077-74555099 GCTCACCTCCACCTACGGAAAGG + Intronic
1161520393 19:4720581-4720603 GAACCACTCTCCCTGGGGAAGGG - Intronic
1162823617 19:13237791-13237813 ACCCAGCTCCACCTGGGGATGGG + Intronic
1164108635 19:22133887-22133909 TCACAATTCCACCTGTGGATAGG - Intergenic
1164804334 19:31104637-31104659 GCCAAACTCCACCTGCTGAAGGG - Intergenic
1165090203 19:33383096-33383118 ACAAAACTCCAGATGGGGAAAGG - Intergenic
1167958181 19:53084795-53084817 GCACCTCTGCACCTGGGGTAGGG + Intronic
1168076107 19:53981742-53981764 GCCCTACACCACCTGGGGGATGG + Intronic
925040693 2:731462-731484 GGACAACTCCACAAGGGGAGGGG - Intergenic
925243165 2:2352127-2352149 GCGCCACTGCACCTGGGCAACGG + Intergenic
926126038 2:10272418-10272440 GCACAATTCCACCTGTAGCAGGG - Intergenic
926348366 2:11970676-11970698 GGACAACTCAAACTGGGGAGGGG - Intergenic
931197677 2:60068213-60068235 CCACATCTCCACCTGGGGTAGGG + Intergenic
931247814 2:60505833-60505855 GAACAACTCTACCTGAGGGAGGG + Intronic
932356565 2:71072630-71072652 GCACAACTCCACCTGGGGAAAGG - Exonic
932668979 2:73720262-73720284 CCGCATCTGCACCTGGGGAAAGG - Intergenic
935680691 2:105634463-105634485 GAAAAACTACATCTGGGGAAAGG + Intergenic
937057784 2:118953994-118954016 GCAAAACTCCACAGGGAGAAAGG + Intronic
941709138 2:168693426-168693448 CCACATCACCACCTGGGGAAAGG - Intronic
945668342 2:212770356-212770378 CCCCAACTCCACCTGAGGGAGGG - Intergenic
946657646 2:221965589-221965611 GCACAGCTTTCCCTGGGGAAAGG + Intergenic
946896509 2:224329553-224329575 GCAAAACTCCACCTGTAGGAGGG - Intergenic
948321168 2:237070986-237071008 GCAGAAATCCTGCTGGGGAAGGG + Intergenic
1169352007 20:4875707-4875729 GTAAAAATCCACCTGGGGGATGG - Intronic
1169441284 20:5635977-5635999 GCAAAACTCCACCTCAGAAAAGG + Intergenic
1170966811 20:21080846-21080868 GCACCACTGCACCTGGCTAATGG - Intergenic
1172219768 20:33265681-33265703 GGACAACGCCACCTGTGGAGAGG - Intergenic
1173308004 20:41870152-41870174 GCAACACTCCACTGGGGGAAGGG + Intergenic
1173722763 20:45273873-45273895 GGAAAACCCCAGCTGGGGAATGG - Intergenic
1175989433 20:62780348-62780370 CCACACATCCACCTGGGGACTGG - Intergenic
1176147922 20:63573690-63573712 CCACATCTGCACCTGGGGAGGGG + Intronic
1176952780 21:15065390-15065412 GGACAGCTCCTCCTGGGGACCGG + Intergenic
1177206566 21:18017399-18017421 GCACATCTTCACATGGTGAAAGG - Intronic
1179139031 21:38707037-38707059 GCATAACTGCACATGGGTAATGG - Intergenic
1182859414 22:33546353-33546375 GGAGATCTCCACCTGGGAAAAGG - Intronic
1183732810 22:39628077-39628099 GCAGAACTCGACCTGAGGGAGGG - Intronic
1184192208 22:42902356-42902378 GCACATGTCCACCAGGGGGAGGG - Intronic
952668866 3:35941781-35941803 GTAGATTTCCACCTGGGGAAGGG - Intergenic
952838902 3:37627928-37627950 GCACATCTGCCTCTGGGGAAGGG + Intronic
954363440 3:50134294-50134316 AGTCCACTCCACCTGGGGAAGGG + Intergenic
955867997 3:63405962-63405984 TCACAACACCACCTGGAGATGGG + Intronic
956731434 3:72200231-72200253 GGACAACTCAAAGTGGGGAAGGG + Intergenic
961204982 3:125074806-125074828 TCACAACTCCACGTGGAGGAAGG + Intergenic
961319218 3:126061395-126061417 CAACACCTCCTCCTGGGGAAGGG + Intronic
962436732 3:135373900-135373922 GCACAACTCCCTGTGGGGAGAGG - Intergenic
967399174 3:189041546-189041568 GCAAAACTGCACATGGGGCATGG + Intronic
970549738 4:17167174-17167196 GCACAAGACCACATGGGCAAAGG - Intergenic
976741120 4:88358537-88358559 TCACAACAGCACCAGGGGAATGG - Intergenic
977918197 4:102616398-102616420 GCACAAATTCACTGGGGGAATGG - Intronic
979848346 4:125545385-125545407 GGACAACTCAAAGTGGGGAAGGG + Intergenic
982763416 4:159315973-159315995 TCTAAACTCCCCCTGGGGAAGGG + Intronic
990115629 5:52387150-52387172 GAATCACTCCATCTGGGGAAAGG - Intergenic
990898371 5:60724155-60724177 GCACCACTGCACCTGGCCAAGGG + Intergenic
991024102 5:62011307-62011329 TCACAACTCCCTGTGGGGAAAGG - Intergenic
997475414 5:134139641-134139663 GCCCAACTCCAGCTGAGGACAGG - Intronic
997853818 5:137355803-137355825 GCAGGACTCCACCTGGGGGCTGG - Intronic
998571568 5:143263927-143263949 GGACAACTCCAAGTGGGGAGGGG + Intergenic
998788443 5:145738192-145738214 ACATTACTCCAGCTGGGGAAGGG - Intronic
999227613 5:150040051-150040073 ACACAACTTCACCTGGGGAAAGG - Intronic
1000045630 5:157519795-157519817 GCAGAAATCAACCTGGGGACAGG - Intronic
1004289156 6:14350748-14350770 GCACAACCCCAGGAGGGGAAAGG + Intergenic
1006173593 6:32109099-32109121 CCACACCTTCACCTGGGGCATGG + Intronic
1006549179 6:34806672-34806694 GCAAAACTCCATCTTGGGGAGGG - Intronic
1014125171 6:117768929-117768951 GGACAACTCTACTTGGTGAAGGG - Intergenic
1015695595 6:135976424-135976446 CCACACCTCTACCTGGGGAAGGG + Intronic
1019162707 6:170079895-170079917 TCACAACTCCCTGTGGGGAAGGG - Intergenic
1019303596 7:322046-322068 GCACATCGCCACCTGGGCTAGGG - Intergenic
1020785923 7:12571876-12571898 GCACAAGACCTCCTGGGGAGAGG - Intronic
1020913487 7:14162910-14162932 GCACAAATCGACCTGGATAAAGG - Intronic
1022840669 7:34161083-34161105 GGACAACTCCATTTGGGGCAAGG - Intergenic
1023932256 7:44713072-44713094 GCACAGCCCCAGCAGGGGAAGGG - Intergenic
1028822250 7:95225905-95225927 ACTCACCTCCACCTGGGGTAAGG + Intronic
1029669547 7:102019684-102019706 GTACAACTCCACCACGGGAAGGG - Intronic
1034287651 7:149899095-149899117 ACACTACTCCAGCAGGGGAATGG - Intergenic
1034663477 7:152793827-152793849 ACACTACTCCAGCAGGGGAATGG + Intronic
1035461528 7:159041950-159041972 GCCCAACTCCACCTGGGGAACGG + Intronic
1036659304 8:10697770-10697792 GCACACCTCCAGGTGGGCAACGG - Exonic
1037435707 8:18861123-18861145 GCACAAGACCACCAGGGCAAGGG + Intronic
1037890517 8:22621660-22621682 GCACAGCTCCAGATGGGTAAGGG - Intronic
1040408500 8:47132825-47132847 GCCCACGCCCACCTGGGGAAAGG + Intergenic
1040758129 8:50805357-50805379 AAAGAACTCCACCTGGGGACTGG + Intergenic
1042611854 8:70608466-70608488 CCACAGCGCCACCTGGGGACCGG + Intergenic
1045167630 8:99624827-99624849 GCAAAACTCCATCTCAGGAAGGG - Intronic
1048388496 8:133936980-133937002 GGACAACTCCAAGTGGGGAGGGG - Intergenic
1049237054 8:141517689-141517711 GGAAAACGCCACCTGGGGAGAGG - Intronic
1051607312 9:18928385-18928407 GGGCAAGTCCAGCTGGGGAACGG + Exonic
1052261795 9:26525284-26525306 GGACAACTCTATCAGGGGAAGGG + Intergenic
1056267526 9:84914482-84914504 ACAGCACTCCACCAGGGGAAAGG + Intronic
1057844796 9:98515083-98515105 GCTCAGTCCCACCTGGGGAAGGG - Intronic
1059399606 9:114060748-114060770 GCCCAATTCCAGCTGGGGTAAGG + Intronic
1185728620 X:2443469-2443491 GCAGAACTCCCCTTGGAGAATGG - Intronic
1190071497 X:47283621-47283643 GCACATCTCCACGTGGGCGAAGG - Intergenic
1193897388 X:87129696-87129718 TCACAACACCACCTGAGCAAGGG + Intergenic
1195195823 X:102497255-102497277 GGACAACTCAAAGTGGGGAATGG - Intergenic
1195220657 X:102742976-102742998 GGACAACTCCAAGAGGGGAAGGG + Intronic
1195270040 X:103220357-103220379 CCCCAACTACTCCTGGGGAAGGG + Intergenic
1198306454 X:135388557-135388579 GGACAACTCAAAGTGGGGAAGGG - Intergenic
1199324059 X:146476514-146476536 GCACAACTCCACATCAGGCAGGG + Intergenic
1199438545 X:147841997-147842019 GCAGAGCTTCATCTGGGGAATGG - Intergenic
1200820562 Y:7578436-7578458 TCACAACTCCTCATGGGCAAGGG - Intergenic
1200849814 Y:7871431-7871453 GCACAATTACACTTGTGGAAAGG + Intergenic
1201901397 Y:19048341-19048363 TCCCAAGGCCACCTGGGGAAGGG - Intergenic
1202252919 Y:22891585-22891607 TCACAATTACACCTGTGGAAAGG + Intergenic
1202262284 Y:22982407-22982429 TCACAACAACACCTGTGGAAAGG - Intronic
1202405908 Y:24525334-24525356 TCACAATTACACCTGTGGAAAGG + Intergenic
1202415274 Y:24616148-24616170 TCACAACAACACCTGTGGAAAGG - Intronic
1202455513 Y:25053938-25053960 TCACAACAACACCTGTGGAAAGG + Intronic
1202464872 Y:25144748-25144770 TCACAATTACACCTGTGGAAAGG - Intergenic