ID: 932357521

View in Genome Browser
Species Human (GRCh38)
Location 2:71078492-71078514
Sequence AGCCCCCTAGGAAAAGGTGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 2, 1: 0, 2: 0, 3: 17, 4: 95}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932357521_932357538 30 Left 932357521 2:71078492-71078514 CCTACACCTTTTCCTAGGGGGCT 0: 2
1: 0
2: 0
3: 17
4: 95
Right 932357538 2:71078545-71078567 GGACACTGGGTCTGAAAGGAAGG 0: 1
1: 1
2: 0
3: 18
4: 269
932357521_932357535 17 Left 932357521 2:71078492-71078514 CCTACACCTTTTCCTAGGGGGCT 0: 2
1: 0
2: 0
3: 17
4: 95
Right 932357535 2:71078532-71078554 CTCCAAGCTCAGTGGACACTGGG 0: 2
1: 0
2: 0
3: 13
4: 172
932357521_932357528 9 Left 932357521 2:71078492-71078514 CCTACACCTTTTCCTAGGGGGCT 0: 2
1: 0
2: 0
3: 17
4: 95
Right 932357528 2:71078524-71078546 TCCACCCCCTCCAAGCTCAGTGG 0: 1
1: 0
2: 2
3: 22
4: 250
932357521_932357534 16 Left 932357521 2:71078492-71078514 CCTACACCTTTTCCTAGGGGGCT 0: 2
1: 0
2: 0
3: 17
4: 95
Right 932357534 2:71078531-71078553 CCTCCAAGCTCAGTGGACACTGG 0: 1
1: 1
2: 0
3: 11
4: 168
932357521_932357537 26 Left 932357521 2:71078492-71078514 CCTACACCTTTTCCTAGGGGGCT 0: 2
1: 0
2: 0
3: 17
4: 95
Right 932357537 2:71078541-71078563 CAGTGGACACTGGGTCTGAAAGG 0: 1
1: 1
2: 2
3: 24
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932357521 Original CRISPR AGCCCCCTAGGAAAAGGTGT AGG (reversed) Exonic
901426353 1:9184037-9184059 TGCCCCCCAGCAACAGGTGTAGG - Intergenic
901923602 1:12552582-12552604 AGCCCCTTAGGAAAAAGAATGGG - Intergenic
902577111 1:17385337-17385359 AGCAAACTAGAAAAAGGTGTGGG + Intronic
903128482 1:21263233-21263255 AGGCCCCTAGCAACAGGTGGTGG + Intronic
909346675 1:74596973-74596995 TGCCCTCTGGGAACAGGTGTAGG + Intronic
912204090 1:107491625-107491647 TGCCCCCAAAGAAAGGGTGTGGG - Intergenic
922796586 1:228342552-228342574 AGCCACCTAGGGAAAGGTCCAGG + Intronic
923022515 1:230175670-230175692 AGCCCCCAAGGAGAAGGAGGGGG - Intronic
1062833316 10:620437-620459 GGCCCCCTAGGAATGGGTGCTGG - Intronic
1063768713 10:9172911-9172933 AACTCACTAGGAAAAGGTGACGG - Intergenic
1065876569 10:30002123-30002145 AGCCCCTTAGGAGACAGTGTAGG - Intergenic
1067833830 10:49625716-49625738 AGCCCCCTCGGAGAAGGTAATGG - Intronic
1069925140 10:71844719-71844741 AGCCCCCTACAAAAATATGTAGG - Intronic
1072273692 10:93801899-93801921 AGCCCCCTAGGATCAGGTGCAGG - Intergenic
1072620465 10:97075925-97075947 AGCCCCCAAAGAATAGGAGTTGG - Intronic
1073903753 10:108252678-108252700 AGACCCCAAGGATAAGGTGCTGG + Intergenic
1076882335 10:133245695-133245717 TGCCCCCTAGGGAACGGTGGAGG - Intergenic
1077501663 11:2912266-2912288 AGCCCCCGAGGGGGAGGTGTGGG - Intronic
1077714903 11:4570767-4570789 ATCCCCCTAGGGGAAGGAGTAGG - Intergenic
1083267797 11:61555026-61555048 ATACCCCTGGGAAAAGGTTTTGG - Intronic
1083584700 11:63848240-63848262 AGCCCCCAAGGACAAGGTCTAGG - Intronic
1085241729 11:75062095-75062117 AGAGCCCTAGGAAAAGGTCTGGG - Intergenic
1086560539 11:88163336-88163358 ACCCCAGCAGGAAAAGGTGTAGG + Intronic
1087234179 11:95699997-95700019 AGCCCCAGAGGAAACTGTGTGGG - Intergenic
1093280869 12:17195044-17195066 AACCCACTAGGAAAATGTGCAGG + Intergenic
1097691308 12:62737004-62737026 AGGCCCTTTGGAAAAGGTGCAGG - Intronic
1097753890 12:63387686-63387708 AGTCCCCTAGGACAAGAGGTAGG + Intergenic
1099824933 12:87763021-87763043 AGCCTCCTAAGCAAAGGTATAGG - Intergenic
1104407461 12:128530064-128530086 AGCCTCCTAGGACATGGAGTAGG + Intronic
1105247138 13:18664096-18664118 GGCCCCCTAAGCAAAGATGTTGG - Intergenic
1112000542 13:95205616-95205638 AGCGACTTAGGAAAAGGTGATGG + Intronic
1114183991 14:20386440-20386462 AGACCCGTAGGAACAGGTGTGGG - Exonic
1115465223 14:33707798-33707820 AGCCCCATAGGTCAGGGTGTCGG + Intronic
1118784813 14:69037323-69037345 AGCCGCCTAAGAGAGGGTGTAGG + Intergenic
1118972220 14:70646454-70646476 AGCCCCACAGGAACAGATGTAGG - Intronic
1131648264 15:94369783-94369805 ATCCCACCAGGAAAACGTGTGGG - Intronic
1132390836 15:101437104-101437126 AGGCCCCTTTGAAAAGCTGTTGG - Intronic
1132614075 16:831755-831777 GGCCCGCTGGGAACAGGTGTGGG + Intergenic
1134811464 16:17170546-17170568 AGTTCTCTAGGCAAAGGTGTAGG - Intronic
1135985473 16:27180713-27180735 ATCCCCCTAGGATAAGGCGGGGG + Intergenic
1137489200 16:48916969-48916991 AGCCCCCTGGAAAATGGTGTAGG + Intergenic
1138304755 16:55964508-55964530 AGCCTCCAAGGGAATGGTGTAGG + Intergenic
1138794434 16:59950954-59950976 AGTCCCCAAGGAAAAGAAGTAGG + Intergenic
1141684453 16:85562323-85562345 AGGCCCCTCGGAAAAGGGCTGGG - Intergenic
1142994692 17:3753710-3753732 GGCCCCCAAGGGAAAGGAGTGGG - Intronic
1143120345 17:4602787-4602809 AGCTCCCCAGGAAAAGAAGTGGG + Intronic
1143568167 17:7737766-7737788 GGCCACCTAGGACAAGGAGTGGG + Intronic
1143592657 17:7894907-7894929 GGCCCCCTAGGAGAAGGAGGGGG + Exonic
1153476336 18:5502696-5502718 AGCTCCCTGGGAAAATGTGTTGG - Intronic
1154270190 18:12911966-12911988 AACCCCGGAAGAAAAGGTGTTGG - Intronic
1154441706 18:14395024-14395046 GGCCCCCTAAGCAAAGATGTTGG + Intergenic
1155211778 18:23608274-23608296 AGCTCCATAGGCAAGGGTGTTGG - Intronic
1155322187 18:24630645-24630667 AGCCACTTCGGAAAAGCTGTCGG + Intergenic
1157830411 18:50852075-50852097 ATCTCCCTAGGAAAAGGGATTGG - Intergenic
1158465361 18:57685314-57685336 AGGCCCCTAGGAGAAGGTAGTGG - Intronic
1159115940 18:64113480-64113502 AGCCACCTGGGGAAAGGTGCAGG - Intergenic
1159531954 18:69666230-69666252 TCCACCCTAGGAAAAGGAGTTGG - Intronic
1161961604 19:7526504-7526526 AGCCCAGCAGGAAGAGGTGTCGG - Exonic
1163126424 19:15246674-15246696 AGGCCCATAGGAGAAGATGTAGG + Intronic
1163355151 19:16805724-16805746 AGCCCACTAGGCAAAGCTCTGGG - Intronic
1165299167 19:34957304-34957326 GGCCTCCTAGGAAAAATTGTAGG - Exonic
1168714242 19:58517927-58517949 ACACCCCTAGGAGAGGGTGTTGG + Intronic
932357521 2:71078492-71078514 AGCCCCCTAGGAAAAGGTGTAGG - Exonic
932369978 2:71178757-71178779 AGCCCCCTAGGAAAAGGTGTAGG - Intergenic
934519995 2:95014119-95014141 AGCCCCCTAAGGGAAGGGGTTGG - Intergenic
935141757 2:100359411-100359433 AGGCACATAGGAAGAGGTGTGGG + Intergenic
939102520 2:137911678-137911700 AGCACCCTAGGCAAAAATGTTGG - Intergenic
940597278 2:155811667-155811689 TGCCTCCTAGGAAAGAGTGTAGG - Intergenic
941100801 2:161293107-161293129 ATCCCCCTTGGATAAGGTGGGGG + Intergenic
946024714 2:216664873-216664895 AGCCCCCAAAGAAAGGGAGTAGG + Intergenic
947929237 2:233949822-233949844 AGCCCCAAAGGAAAACGTGTAGG + Intronic
948094050 2:235319707-235319729 AGCCTCCTAGGCAAAGCTATGGG + Intergenic
948978772 2:241481778-241481800 AGCTACATAGGCAAAGGTGTAGG + Intronic
1169427570 20:5508614-5508636 AGCTCCCTAAGAAAAGGAATAGG + Intergenic
1170824998 20:19786116-19786138 AGGTGCCTAGGAGAAGGTGTGGG - Intergenic
1176116290 20:63432922-63432944 AACCCCCTAGGAGCAGGTGACGG + Intronic
1176454360 21:6896149-6896171 GGCCCCCTAGGCAAAGATGTTGG - Intergenic
1176832534 21:13761197-13761219 GGCCCCCTAAGCAAAGATGTTGG - Intergenic
1179545100 21:42108316-42108338 AGCACCCCAGGAAGAGGTGTGGG + Exonic
1182056430 22:27358901-27358923 AGGTACCTAGGAAAAGATGTGGG + Intergenic
954629373 3:52039871-52039893 AGCCCAAAAGGCAAAGGTGTGGG + Intergenic
958896857 3:99839044-99839066 TGCCCACAAGGTAAAGGTGTGGG - Intronic
969876044 4:10136294-10136316 AGACCACCAGGAAAAGGTGATGG + Intergenic
975594665 4:76038409-76038431 ATCCCCCAAGGATAAGGTGAGGG + Intronic
979274031 4:118794671-118794693 ATCCCCCTGAGAAAAGCTGTGGG + Intronic
994450408 5:99934298-99934320 AGCCAGATAGGAAAATGTGTGGG - Intergenic
996400899 5:123061399-123061421 AGCTTCCTAAGAAAAGGTGCAGG - Intergenic
997614401 5:135236672-135236694 AGACCCCTAGGAAAAGCAGAGGG - Intronic
997974995 5:138436246-138436268 AGCCTCCTGGGAAAAGCAGTGGG - Exonic
1002388080 5:178885772-178885794 AGCCACATATGCAAAGGTGTAGG + Intronic
1004169326 6:13283697-13283719 TGGCCCCTGGGGAAAGGTGTTGG - Intronic
1008242196 6:49127394-49127416 AGGCCCAGAGGAGAAGGTGTAGG + Intergenic
1010125128 6:72422368-72422390 AGCCAGCCAGGAGAAGGTGTAGG - Intergenic
1016401592 6:143687385-143687407 AGTCCCCAAAGAAAAGATGTTGG - Intronic
1023824276 7:43998280-43998302 AGCCCATCAGGAAAACGTGTGGG + Intergenic
1026087825 7:67277027-67277049 AGCCCATTAGGAAAACGTGTGGG + Intergenic
1026726409 7:72873186-72873208 AGCCCATTAGGAAAACGTGTGGG - Intergenic
1027117431 7:75492406-75492428 AGCCCATTAGGAAAACGTGTGGG + Intergenic
1027274377 7:76543189-76543211 AGCCCATTAGGAAAACGTGTGGG - Intergenic
1027327820 7:77062154-77062176 AGCCCATTAGGAAAACGTGTGGG - Intergenic
1028165381 7:87532626-87532648 AGTTTCCTAGGAAAAGGGGTGGG - Intronic
1029720072 7:102357648-102357670 AGCCCATTAGGAAAACGTGTGGG - Intergenic
1029752541 7:102551609-102551631 AGCCCATTAGGAAAACGTGTGGG + Intronic
1029770492 7:102650702-102650724 AGCCCATTAGGAAAACGTGTGGG + Intronic
1031169991 7:118281302-118281324 AGCATCTTAGGAAAAGGTGGTGG + Intergenic
1033853471 7:145526935-145526957 ATCCCCCTTGGGAAAGCTGTAGG - Intergenic
1036687384 8:10921040-10921062 AGACCCCTTGGAAAAGGAGCTGG - Intronic
1050212649 9:3280202-3280224 TGCCTCCTGGGAAAAGGTCTAGG + Intronic
1050602317 9:7265418-7265440 AGGCCCCTAAGAAAATGTGAAGG + Intergenic
1055481251 9:76710904-76710926 AGCCCCGTGGGAGAAGGTGCTGG - Exonic
1056848425 9:90059891-90059913 AGCCCACTAGGAGAGGGTCTCGG + Intergenic
1189766594 X:44378489-44378511 AGCCCCCCAGGAAAAGCCCTGGG - Intergenic
1197701851 X:129605686-129605708 AAACCCCTAGGGAAAGGTGCAGG + Intergenic
1200154910 X:153970229-153970251 AGCCCGCTGGGTAACGGTGTGGG + Intronic