ID: 932368075

View in Genome Browser
Species Human (GRCh38)
Location 2:71165933-71165955
Sequence TTGCATTTACACAGGCATCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932368075_932368081 13 Left 932368075 2:71165933-71165955 CCCGGATGCCTGTGTAAATGCAA No data
Right 932368081 2:71165969-71165991 CTGATCCTGTGAGCCTAGGATGG No data
932368075_932368082 14 Left 932368075 2:71165933-71165955 CCCGGATGCCTGTGTAAATGCAA No data
Right 932368082 2:71165970-71165992 TGATCCTGTGAGCCTAGGATGGG No data
932368075_932368080 9 Left 932368075 2:71165933-71165955 CCCGGATGCCTGTGTAAATGCAA No data
Right 932368080 2:71165965-71165987 GATTCTGATCCTGTGAGCCTAGG No data
932368075_932368083 15 Left 932368075 2:71165933-71165955 CCCGGATGCCTGTGTAAATGCAA No data
Right 932368083 2:71165971-71165993 GATCCTGTGAGCCTAGGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932368075 Original CRISPR TTGCATTTACACAGGCATCC GGG (reversed) Intergenic
No off target data available for this crispr